Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Bird watching group

343 views

Published on

A presentation I gave to a bird watching group in arabic.

Published in: Science
  • Be the first to comment

  • Be the first to like this

Bird watching group

  1. 1. HAGenetics.org وا)'%ا#ت ا)+%ر .-, ا) 012 ف 3ت ا) 4 67 ل 89 ا)';اد 8= ا)@%? A19BCD %2 ر E د AFG( اA?H'(A ا)@%? 2 A1H ا) 4 CD ا)+%ر ;I رJ?0K( 0ة M'9 26-3-2014
  2. 2. 0ة M'N اA+?07 لOHE ن#Q ا؟C'( ا8S@( اTE02?H9 • 3%م؟ ا) 4 %V9 • 3ت؟ ا) 4 CV9 • ت.%H4N اCDAW ا)%را AX ودرا A3 ا) 4 تD627Q • ا 3ت S@( اCD ا) 32 %ع AX ودرا A3 ا) 4 تD627Q • ا اع %#Z وا T? ا)] 0 G[2H-(C • رؤ? 2 HAGenetics.org
  3. 3. C'( ا8S@( ا ;^H_ A4#Z وا ا)` 6? و 329 %ع a-2`9 ا)@ 9 8S@( ا 13 ن b?Ac?%d و 39 %ي =%ان HAGenetics.org ة f^BZ وا ؟C'( ا8S@( اgBCDA= و=;ة 0hI أCV9
  4. 4. A-`( ا ;^H_ HAGenetics.org 8SE أي gBCDA= و=;ة 0hI أCVA-`( ا A?%'( اaSj%( ا@d ا)]م 89^3@H?A-`( اTE0_ 0ه l 0W@ _ 2 ىnh2_
  5. 5. ؟o-`( ا0W@_ ;^H_ HAGenetics.org م[#Q ا0G.? ا)` 6 0W@2_ A-`( ا اة %#,H? 9@ن CD د%B%9A-`( ا .] ؟ ا) 3%اة A-`( ا[.CD;B%? 9ذا
  6. 6. A-`( ا اة %# ;^H_ A?%'( اaSj%(d )-]م تH- ا) 12 %2 ي '?A-`( ا[.A-`( ا #%اة 9% ت X% ا)@ 0و 9 ا) 3%وي qH'(d,H?9 %2 ي '_A-`( ا #%اة HAGenetics.org 3%م ا) 4
  7. 7. 3%م؟ ا) 4 %V9 HAGenetics.org ا)'ة 2ب E د %B%( ا 0ة Ks 313b_C ا) 2 تH- ا) 12 #0@K_AKE و 3، X= أ 3، .Gu،3(@sZo+? ا)` 0 ASHE و= 0وف Ah-d ن%d%2@98'#%V 3%م ا) 4
  8. 8. oGv_ 3%م ا) 4 ا)'ة 2ب E HAGenetics.org wd2EH= أ أ# ,H? ا)'ة 2ب E %3 م B
  9. 9. oGv_ 3%م ا) 4 ا)'ة 2ب E CB دو f9 ن%H?0vG( • ا ;?%-G? د 3%م ا) 4 CDwd2E _'%ي 0vG( ا 67 ? • gV?67gx19 A.%H4989 9@%ن 2ب EE • 9% ت X% 0و 9 E,H_ ل%bD ?' 2%ي ن#Z اCD 2ب EE • bD٢٣,-. HAGenetics.org A . 9 ل%bD أو 9% ت X% 0و 9 E A3B ل%bD أو 9% ت X% 0و 9 E
  10. 10. oGv_ 3%م ا) 4 ا)'ة 2ب E A#%@9 ن#Q ا 67 ? ن%@_o-. • و bD٤٦ ع%H و 49 wd2E89 6ث W89 ? 2@%ن 2ب EE • = 0ف -9 رات 2ب EE8907Z اbK( • ا ;?;'2(~b`9 ٢٣bK( ا ا) 34 898?07Z اw-bK( ا نE • إذا  ا) 34 ن%@?XX 2ب EE 0E ذ ا) 34 ن%@?XY,O# أ HAGenetics.org o . 9 ل%bD أو 9% ت X% 0و 9 E A3B ل%bD أو 9% ت X% 0و 9 E
  11. 11. ًÇG?0[_ ا) 34 _';?; HAGenetics.org ؟É9%3BÉd2ECD8?07Z اw-bK( اHV9 X X X Y
  12. 12. IK_ 3%م ا) 4 ا)'ة 2ب E وا)' 0وف ت، H-@( ا ت، 'Kb( ا • .;د وآ 07 bDEwda-2`_ ت'Kb( ا د;.T=oHÖ09 ل%bK( • ا ول Ü اbK( ا%V ل%bK( ا0GE • أ HB _@%ن ا)@ 2ب CD 0ات [K( اq1d • 3ت B,H_A9%^K و 9 0وءة [9 29 وي à? ز%_o. 9%ز ) 3ت • ا) 4 ل%bK( اwd HAGenetics.org ا)@ 2ب CD 0ة OE 0ات [D و ت'KI • 0اء_^ Ö8@H?Ü وA9%^K90l ت، H-E، = 0وف _'%ي 0ات [K( ا هnV • ,319 دون 89 0ره @9HB و 89o#%@9oSHEoh-d 2%ب @9 • ا)@ 2ب CV وoSHE 0وف =àd أر (A,T,G,C) oH-EE و تH-E89o#%@9H • ا) 4 C_äE = 0وف 6ث W %2 ي '_ (AAC, ATG, etc.)
  13. 13. HAGenetics.org IK_ 3%م ا) 4 ا)'ة 2ب E ATGCCATCACAAATGCGG CTATGCCATGACAAATGC GGCTAATGCCATGACAAAT GCGGCTAATGCCATGACAA ATGCGGCTAATGCCATGAC AAATGCGGCTACATGACAA ATGCGGCTAATGCCATGAC AAATGCGGCTAATCATGAC AAATGCGGCTACATGACCA TGACAAATGCGGCTACATG ACAACAACAACAACAACAA CAACAACAACAACATATATA TATATATATATATATATATATAT ATATATATATATATATATATATA TATATATATATATATATATATAT ATATATATATATATATATATATA TATATATATATATATATATATAT ATATATATATATATATATATATA TATATATATATATATATATATAT Met-Pro-Ser-Met-Arg-Lue-Cys- His-Asp-Lys-Cys-Gly-stop aÖ%_ و داء %X ن%.à3I ا Bla bla bla bla bla More bla bla bla bla
  14. 14. 2ب E 3;ن (CDX _ 0 ا)%)@%م a'29CD • ٥ ا)' 0ف g4=CD ع%G+9 ن#Q ا 3KKI و١٢g4=CD ا)@ 2ب 31 Gu%( • ا)' 0وف 29 ;ت Ü^c1dT#4d ا)' 0وف #GX إ إ), ا)@%? 89 HAGenetics.org IK_ 3%م ا) 4 ا)'ة 2ب E
  15. 15. HAGenetics.org %3 م B ة=T2E^( 3ت S@( اE %1 ن G2X8? آ 07 ًÇG?0Ö وV د%B و 2ب E # 01 ف 3ت S@( ا890O@( ا
  16. 16. HAGenetics.org 3ت وا) 4 AW ا)%را 49 ل CD ث'dZ ا %+7 ات ا)@ 2ب %2 ي '_C ا) 2 3ت ا) 1 àHB .1 (DNA)
  17. 17. HAGenetics.org 3ت وا) 4 AW ا)%را 49 ل CD ث'dZ ا %+7 ات ا)@ 2ب %2 ي '_C ا) 2 3ت ا) 1 àHB .1 (DNA)
  18. 18. HAGenetics.org 3ت وا) 4 AW ا)%را 49 ل CD ث'dZ ا %+7 ات 3%م ا) 4 ا)@ 2ب 0اج `2X 2. ا (DNA)
  19. 19. HAGenetics.org 3ت وا) 4 AW ا)%را 49 ل CD ث'dZ ا %+7 ات 3%م ا) 4 ا)@ 2ب 0اءة Ö .3 (DNA)
  20. 20. HAGenetics.org ت .%H4N اCDC3 ا) 4 627 ف Q وا ا) 32 %ع
  21. 21. HAGenetics.org ت .%H4N اCDC3 ا) 4 627 ف Q وا ا) 32 %ع
  22. 22. HAGenetics.org اع %#Z اwdC3 ا) 4 627 ف Q وا ا) 32 %ع
  23. 23. HAGenetics.org اع %#Z اwdC3 ا) 4 627 ف Q وا ا) 32 %ع
  24. 24. HAGenetics.org 3ت S@( اwdC3 ا) 4 627 ف Q وا ا) 32 %ع
  25. 25. HAGenetics.org 3ت S@( اwdC3 ا) 4 627 ف Q وا ا) 32 %ع
  26. 26. HAGenetics.org T? ا)] 0 G[2H-(C رؤ? 2 ا)@%? A( دو CDA?0+K( ا ا)'ة 3ت 1(É3d و ت#d ة;.Ö ءv# • إ 4ورة N ا وا);ول 3ت S@(d 0ر c( ا إ)'ق دون 89 ا) 1#ت .-, ل%b'( • ا ا)+ 0ق ادث %=TGd_9 3ت SE89 3ت .,-.fE • ا) 02 3ت ا) 1 JD;_A? 0ار H2X ا %3 ا Hc?8?n( اwH2^N ا89A@Gs ءv# • إ #02#Q اA@Gs,-. 3ت ا) 1 ص%b`d ت#G( ا ة;.Ö1B • AB'( ا 3; .g^( 3ت ا) 1 لb? وإ ا)`رج CD ءH- ا) 1 à9I • ا) 2%ا .- دات ^s,-. ل%b'( اCD?%@( اA19BAG-u 2`;م X 3ت • ا) 1
  27. 27. HAGenetics.org g@.H2X ا )' 8 0اً @s

×