El Virus De La Gripe

15,751 views

Published on

2ª Version corregida y aumentada y con audio

Published in: Health & Medicine, Technology
3 Comments
11 Likes
Statistics
Notes
  • Hola! buenas tardes, soy medico, me gustaria utilizar su presentacion pero la opcion de bajar archivo esta inhabilitada por el autor, seria posible que me la enviara por favor...
    Gracias
    dranancyrangel@yahoo.com.mx
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • Hola,

    Soy Biologa y estoy interesada en descargarme la presentacion sobre la gripe H1N1, és posible poder descargarla??

    Buenas presentaciones.
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • Hola Rosileandrade

    No entiendo su comentario.

    Si usted quiere, puede insertar la presentación en un blog. Es muy sencillo, sólo tiene que copiar el código en lenguaje htlm en la opción llamada a la derecha de mi foto y luego pegarla en una nueva presentación de su blog.

    También puede copiar la dirección URL del renglón correspondiente de su navegador y pegarla en cualquier correo electrónico para acceder a la presentación
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
No Downloads
Views
Total views
15,751
On SlideShare
0
From Embeds
0
Number of Embeds
7,471
Actions
Shares
0
Downloads
0
Comments
3
Likes
11
Embeds 0
No embeds

No notes for slide
  • El Virus De La Gripe

    1. 1. El Virus de la Gripe y la Influenza M. en C. Rafael Govea Villaseñor CINVESTAV Versión 2.1
    2. 2. ¿Qué es la Influenza? Es una enfermedad respiratoria provocada por el Virus de la Gripe que afecta a aves y mamíferos, incluidos nosotros M. en C. Rafael Govea Villaseñor
    3. 3. ¿Qué es un virus? Es una partícula infecciosa obli-gadamente intracelular hecha de un ácido nucleico (cuyo mensaje es ¡Replícame! ) en-vuelto por ensambles protec-tores de proteínas y a veces de lípidos. No son entidades vivas, pues no crecen, ni tienen estructura celular y menos metabolismo. Pero pueden evolucionar M. en C. Rafael Govea Villaseñor VHH-8 Adenovirus VIH
    4. 4. ¿Qué es el Virus de la Gripe? Es un virus cu-bierto de membrana con genoma de ARN fragmentado en 8 cadenas (-) antisentido que codifica 10 genes y 11 proteínas M. en C. Rafael Govea Villaseñor
    5. 5. Virus de la Gripe Neuraminidasa N1, N2,… Hemaglutinina H1, H2 , H3… Proteína de Matriz M1 ARNv (8C, 10 genes, 11 proteínas) Proteína Canal M2 RNApol M. en C. Rafael Govea Villaseñor
    6. 6. ¿Cuántos Tipos hay de virus de la Gripe? 3 tipos De acuerdo a la antígenicidad de la nucleoproteína y proteína de matriz 1 A C B Perteneciente a la Familia de Ortomixovirus Aves y humanos Humanos y Cerdos Humanos M. en C. Rafael Govea Villaseñor
    7. 7. ¿Cuáles mamíferos se enferman de gripe? Cerdos Equinos Cetáceos Leones marinos Humanos M. en C. Rafael Govea Villaseñor
    8. 8. ¿Cuáles aves se enferman de gripe? Patos, 36 Gansos, 8 Cisnes, 3 Gaviotas, 9 Golondrinas, 9 Aves lacustres, 10 Gallinetas, 3 Petreles, 5 Cormoranes, 1 M. en C. Rafael Govea Villaseñor
    9. 9. ¿Cuál Tipo de virus es más peligroso? El Virus tipo A es responsable de casos estacionales y las pandemias (epidemias globales) El Virus tipo B es responsable de brotes limitados a lo largo del año El Virus tipo C es responsable de casos leves M. en C. Rafael Govea Villaseñor
    10. 10. ¿Quién se enferma de gripe aviar? Criadores de aves de corral, vendedores de aves vivas, compradores Vía aérea y contacto con deyecciones No se contagia al comer pollos, pero se sugiere una buena cocción (cocinar a >70 ºC) M. en C. Rafael Govea Villaseñor
    11. 11. ¿Quién se enferma de gripe porcina? Criadores de cerdos, vendedores de cerdos vivos, compradores A través de la Vía aérea y contacto directo con cerdos No se contagia al comer cerdos, pero se sugiere una buena cocción (cocinar a >70 ºC) M. en C. Rafael Govea Villaseñor
    12. 12. ¿Quién se enferma de gripe humana? Personal médico, familiares, compañeros, amigos, pasajeros que respiren el aire de un enfermo que tosió o estornudó y no se tapó la boca con el brazo A través de la Vía aérea o contacto con gotitas de aerosol extendidas por las manos sobre objetos como pasamanos, manijas, bocinas, teclados, ratones, mesas, manos sucias, etc. M. en C. Rafael Govea Villaseñor
    13. 13. ¿Cómo se clasifica el virus de la Gripe A? Según las glicoproteínas de superficie: H y N H1, H2, … H16 N1, N2, … N9 M. en C. Rafael Govea Villaseñor
    14. 14. ¿Cuál es la Reserva del Virus de la Gripe? Las aves, cerdos, humanos, caballos, focas,… que se contagian con sus propias cepas gripales o de otra especie M. en C. Rafael Govea Villaseñor
    15. 15. Ciclo Vital del Virus, adhesión Primero el virus se pega a la membrana de las células mediante un molécula receptora normal M. en C. Rafael Govea Villaseñor
    16. 16. ¿Cuál es la molécula receptora sobre la Membrana Celular? Glucoproteína El Ácido siálico de diversas glucoproteínas 1 3 2 4 5 6 M. en C. Rafael Govea Villaseñor
    17. 17. Ciclo Vital del Virus, fagocitosis 1. Luego el virus es envuelto en una bolsa membranosa, el Fagosoma 2. Una bomba del fagosoma acidifica el interior 4.- La proteasa rompe a la hemaglutinina viral, activándola 3.- El medio ácido activa a una Proteasa Pulmonar M. en C. Rafael Govea Villaseñor
    18. 18. Ciclo Vital del Virus, fusión La proteína canal M2 deja entrar iones H + al virus y dispara la fusión de membranas mediante un cambio conformacional de la Hemaglutinina activada M. en C. Rafael Govea Villaseñor
    19. 19. Ciclo Vital del Virus, entrada del ARNv Citoplasma Luego, los 8 fragmentos de ARN viral migran hacia el núcleo celular donde ocurre su replicación y su transcripción M. en C. Rafael Govea Villaseñor
    20. 20. EXPRESION GENICA en nuestras células (C. Eucarióticas) ADN ARN (Transcrito primario) ARNm PROTEINA Como saben, normalmente la información guardada en el ADN se transcribe en ARN que se procesa en ARNm y luego se traduce para fabricar las proteínas que realizan las funciones celulares M. en C. Rafael Govea Villaseñor
    21. 21. Ciclo Vital del Virus, expresión La ARN polimerasa sintetiza miles de ARN mensajeros y la célula fabrica millones de copias de las 11 proteínas virales La ARN replicasa sintetiza miles de copias de los 8 fragmentos de ARN virales M. en C. Rafael Govea Villaseñor
    22. 22. ¿Cómo está conformado el ADN? Diapo 1152 M. en C. Rafael Govea Villaseñor Como recuerdan, el ADN está hecho de 2 cadenas complementarias y antiparalelas de nucleótidos. La cadena sentido (+) almacena la información (copia de respaldo) para elaborar el ARNm y la cadena antisentido (-) se usa para fabricar miles de copias del ARN mensajero… GCATGTACGTAGCTAGCTAAG CGTACATGCATCGATCGATTC 5' 5' 3' 3' CADENA "SENTIDO" CADENA "ANTISENTIDO" + -
    23. 23. SINTESIS DE ARN M. en C. Rafael Govea Villaseñor Como puede verse aquí abajo: Pero el virus de la gripe no tiene ADN, sino ARN (-) CGTACATGCATCGATCGATTC 5' GCATGTACGTAGCTAGCTAAG 5' 3' 3' GCAUGUACGUAGCUAGCUAAG 5' 3' CADENA "SENTIDO" ARN m + + -
    24. 24. Flujo de la Información Genética Viral ARNv (-) RNApol Miles de ARNm Ribosomas Proteínas Virales 3’ 5’ 3’ 5’ Replicasa Duplex Intermediarios 3’ 5’ 3’ 5’ ARNv (-) Replicasa M. en C. Rafael Govea Villaseñor Como los 8 fragmentos de ARN viral son cadenas (-) se usan directamen-te para hacer ARNm y los ribosomas elaboran las 11 proteínas virales. Y la replicación de los 8 ARNv se logra mediante un intermediario de ARN de doble cadena (duplex) que tiene un ARN (+) y luego sobre éste se fabrican las 8 cadenas virales (-)
    25. 25. Ciclo Vital del Virus, ensamble 1 Y la Neuraminidasa corta los ácidos Siálicos de las glucoproteínas celulares. Así los nuevos virus no se atascarán en la célula infectada y quedarán libres para afectar a otras miles M. en C. Rafael Govea Villaseñor Luego las proteínas virales H, N y M2 se insertan en la membrana celular
    26. 26. Ciclo Vital del Virus, ensamble final y gemación Los 8 fragmentos de ARN viral se encapsulan con la proteína de Matriz M1 y la Gemación ocurre cubriendo al virus de membrana celular robada M. en C. Rafael Govea Villaseñor
    27. 27. Filogenia del Virus de la Gripe M. en C. Rafael Govea Villaseñor La comparación de los genomas secuenciados de los virus de la gripe ha permitido conocer su historia evolutiva Humanos Aves americanas Cerdo americano Cerdo Euro-asiático
    28. 28. ¿Cómo surgen las nuevas cepas? Por Recombinación Virus aviar o porcino HxN1 Hiperpatógeno, pero incapaz de contagio de persona a persona Virus Humano H1N1 Capaz de contagio persona a persona Virus recombinante Hx N1 patógeno y capaz de pasar de una persona a otra
    29. 29. Origen de las cepas de Gripe Pandémicas M. en C. Rafael Govea Villaseñor Como el genoma del virus de la gripe está hecho de 8 fragmentos de ARN. Si hay infección simultánea de 2 cepas distintas, entonces se forman virus recombinados Horimoto & Kawaoka (2001) Clin.Microbio. Rev . 14(1):129-49
    30. 30. Recombinación en Cerdos y Transmisión a humanos M. en C. Rafael Govea Villaseñor Los cerdos pueden infectarse simultáneamente con virus aviares, propios y humanos y allí recombinarse como en el nuevo virus AH1N1
    31. 31. Las infecciones con virus porcinos recombinados permiten su evolución M. en C. Rafael Govea Villaseñor Cada persona infectada con el virus recombinado, enferma pero no transmite en virus. El virus “muere” al fallecer el paciente o es destruido por el sistema inmune al sanar , hasta que un virus muta y puede infectar a otra persona propagándose con éxito Transmisión eficiente
    32. 32. Procedencia de los Fragmentos de ARN del nuevo virus AH1N1 M. en C. Rafael Govea Villaseñor 1 2 3 4 5 6 7 8 PB2, aviar, norteaméricano PB1, humano, virus H3N2/93 PA, aviar norteaméricano HA, porcino, AH1N1/1918 NP, porcino, norteaméricano NA, porcino, eurasiático M, porcino, eurasiático NS, porcino, norteaméricano
    33. 33. Pandemias más importantes Gripe española de 1918: AH1N1 (mortalidad del 2.5%, 40 millones) Gripe asiática de 1957: AH2N2 (mortalidad de 1.5 millones) Gripe Hong Kong de 1968: AH3N2 (mortalidad de 1 millón) Futura Gripe Aviar de 20??: AH5N1 (mortalidad de 72%) M. en C. Rafael Govea Villaseñor Nueva Gripe de 2009: AH1N1 Mortalidad de ¿0 a 7%?
    34. 34. Síntomas de la Gripe humana <ul><li>fiebre (por lo general alta) </li></ul><ul><li>dolor de cabeza intenso </li></ul><ul><li>cansancio extremo </li></ul><ul><li>tos seca </li></ul><ul><li>dolor de garganta </li></ul><ul><li>Secreción o congestión nasal </li></ul><ul><li>dolores musculares o articulares </li></ul>M. en C. Rafael Govea Villaseñor También pueden presentarse síntomas estomacales, como náusea, vómito y diarrea, pero son más comunes en los niños que en los adultos Si se presentan 3 o más de éstos síntomas hay que ir a una clínica u hospital para evaluación médica
    35. 35. Signos de Alarma de la Gripe humana <ul><li>Dificultad para respirar </li></ul><ul><li>dolor del pecho </li></ul><ul><li>Flemas con sangre </li></ul><ul><li>Confusión o somnolencia </li></ul>M. en C. Rafael Govea Villaseñor Si se presenta alguno de estos signos hay que ir de urgencia a una clínica u hospital para tratamiento médico inmediato
    36. 36. Complicaciones de la Gripe humana <ul><ul><li>Neumonía bacteriana </li></ul></ul><ul><ul><li>Deshidratación </li></ul></ul><ul><li>y el empeoramiento de enfermedades crónicas, tales como: </li></ul><ul><ul><li>la insuficiencia cardiaca congestiva </li></ul></ul><ul><ul><li>el asma y </li></ul></ul><ul><ul><li>la diabetes </li></ul></ul><ul><li>Los niños pueden contraer: </li></ul><ul><ul><li>sinusitis e </li></ul></ul><ul><ul><li>infección de oídos. </li></ul></ul>M. en C. Rafael Govea Villaseñor
    37. 37. Casos en humanos Neumonitis gripal 5 días después M. en C. Rafael Govea Villaseñor
    38. 38. Métodos de detección en pacientes M. en C. Rafael Govea Villaseñor <ul><li>Usando secreciones respiratorias se puede detectar el virus por medio de: </li></ul><ul><ul><li>Cultivo viral en línea celular de mamífero (riñón canino Madin-Darby) o en embriones de pollo. Tardada </li></ul></ul><ul><ul><li>Determinación con anticuerpos contra la nucleoproteína A. Rápida </li></ul></ul><ul><ul><li>Detección por inmunofluorescencia del tipo y subtipo. Varias horas </li></ul></ul><ul><ul><li>Determinación molecular por RT-PCR para determinar el tipo y subtipos. En total 1 día. </li></ul></ul>
    39. 39. ¿El virus de la Gripe es un peligro para México? No en lo inmediato (antes de abril de 2009) Pero la evolución del Virus seguirá su curso La cuestión no es sí va a ocurrir o no, sino cuándo y dónde Ocurrió ahora, aquí en México y es de origen porcino
    40. 40. Países afectados México, USA, Canadá, España, Reino Unido Francia, Alemania, Nueva Zelanda, Israel, el Salvador, Costa Rica, Colombia Y los que se acumulen en la semana Estamos en el inicio de una pandemia (fase 5 según la OMS y es altamente probable que se declare la fase 6) M. en C. Rafael Govea Villaseñor
    41. 41. ¿Hay Medicamentos eficaces vs VGH? Si Inhibidores de la Neuraminidasa: Oseltamivir (Tamiflu) y zanamivir (Ralenza) M. en C. Rafael Govea Villaseñor Pero no hay que automedicarse, pues dosis inadecuadas, no serán efectivas y provocarán la muerte del infectado y la evolución de virus resistentes
    42. 42. ¿Hay Medicamentos eficaces vs el virus de la gripe? Si Pero, el nuevo virus AH1N1 es resistente a la amantadina y la rimantidina M. en C. Rafael Govea Villaseñor ¡Ojo! Los medicamentos antigripales, que se venden sin receta, no contienen antivirales, sino una mezcla “engañadora” para reducir el dolor, la fiebre y los malestares. No curan
    43. 43. ¿Hay Vacunas eficaces vs el nuevo virus de la Gripe AH1N1? No Aún no se elabora y las vacunas existentes difícilmente ayudarán pues es un nuevo virus con proteínas H y N mutadas M. en C. Rafael Govea Villaseñor
    44. 44. ¿Qué podemos hacer? Como el virus de la gripe es un virus cubierto basta con agua y jabón o alcohol para eliminarlo M. en C. Rafael Govea Villaseñor Por eso hay que lavarse las manos con frecuencia y limpiar manijas, teclados, bocinas y todo lo que pueda ser tocado con manos contaminadas
    45. 45. ¿Qué podemos hacer? No escupir al suelo M. en C. Rafael Govea Villaseñor Pues si usamos las manos regaremos los virus por todos lados: manijas, ratones, teclados, pasamanos, bocinas, ojos, bocas y todo lo que pueda ser tocado con manos contaminadas Hay que taparse la boca al toser o estornudar con el brazo
    46. 46. ¿Qué podemos hacer? M. en C. Rafael Govea Villaseñor Lavarnos las manos muchas veces a lo largo del día
    47. 47. ¿Qué podemos hacer? M. en C. Rafael Govea Villaseñor No tocar los ojos, nariz y boca con las manos , a menos que estén recién lavadas o higienizadas con alcohol al 70% o en gel.
    48. 48. Medidas preventivas si hay síntomas <ul><li>Acudir a unidades médicas en cuanto se presenten síntomas compatibles con la influenza </li></ul><ul><li>Usar Tapa-bocas </li></ul><ul><li>No compartir cubiertos </li></ul><ul><li>Quedarse en casa durante la infección (u hospital) tomando los antivirales recetados </li></ul><ul><li>Cubrirse con el brazo al toser o estornudar </li></ul><ul><li>Lavarse las manos con frecuencia </li></ul><ul><li>Limpiar objetos como pasamanos, perillas, teclados </li></ul>M. en C. Rafael Govea Villaseñor
    49. 49. ¡Hay que convivir con el nuevo virus! <ul><li>Debemos detectar a todas las personas con fiebre y malestar antes de que entren a la escuela o trabajo. Llevarlas de inmediato a las unidas médicas para su evaluación y tratamiento. </li></ul><ul><li>Si alguien presenta síntomas en su trabajo o escuela, hay que enviarlas pronto a evaluación y monitorear a las personas de su entorno </li></ul>M. en C. Rafael Govea Villaseñor El nuevo virus NO es mortal si la gripe se diagnostica rápido y se toman los antivirales a tiempo
    50. 50. ¡Hay que convivir con el nuevo virus! <ul><li>No escupir </li></ul><ul><li>Taparnos la boca con el brazo al toser o estornudar </li></ul><ul><li>No tocarnos los ojos, nariz y boca con las manos, a menos que hayan sido higienizadas o lavadas </li></ul><ul><li>Mantener limpias las superficies que tocamos con las manos </li></ul>M. en C. Rafael Govea Villaseñor Debemos cambiar nuestros hábitos de Higiene
    51. 51. M. en C. Rafael Govea Villaseñor

    ×