Biocemol 15

3,911 views

Published on

Curso de Biología Celular y Molecular, Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Micaela Bastidas de Apurímac.

Published in: Health & Medicine
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
3,911
On SlideShare
0
From Embeds
0
Number of Embeds
5
Actions
Shares
0
Downloads
60
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Biocemol 15

  1. 1. UNIVERSIDAD NACIONAL MICAELA BASTIDAS DE APURIMAC CARRERA PROFESIONAL DE MEDICINA VETERINARIA Y ZOOTECNIA EL CONTROL DE LA EXPRESIÓN GENÉTICA MSc. NILTON CESAR GOMEZ URVIOLA
  2. 2. Los controles que actúan sobre la expresión de genes (es decir, la capacidad de un gen para producir una proteína biológicamente activa) son mucho más complejos en eucariotas que en procariotas. Una diferencia importante es la presencia en eucariotas de la membrana nuclear, lo que impide la realización simultánea transcripción y traducción que se produce en procariotas.
  3. 3. ¿CÓMO CONTROLAR LA EXPRESIÓN GÉNICA? Las células regulan la expresión de sus genes mediante diferentes procesos, pero la forma más eficiente y usual es por medio del control transcripcional, por el cual la célula puede aumentar y disminuir la cantidad de ARN transcripto. Existen tres tipos de controles: 1.Controles transcripcionales 2.Controles postranscripcionales 3.Controles postraduccionales
  4. 4. CONTROLES TRANSCRIPCIONALES Por medio de la regulación del inicio de la transcripción se puede elegir qué genes “encender” (activar) o “apagar” (inhibir) en un momento determinado, así como también regular la cantidad de ARNm producido.
  5. 5. CONTROLES POSTRANSCRIPCIONALES Tenemos diferentes tipos: Mecanismos de corte y empalme (del inglés, Splicing). Edición del ARN Transporte del ARNm al citoplasma. Iniciación de la síntesis proteica. Estabilidad del ARNm Eliminación de ARNm con errores. ARN de interferencia.
  6. 6. CONTROLES POSTRADUCCIONALES Una vez sintetizadas, las proteínas pueden ser modificadas mediante la unión de distintas moléculas (grupos fosfato, adenilatos, azúcares, etcétera). Estos agregados permiten regular la acción proteica de manera muy rápida porque no dependen del proceso de síntesis. Existen además ciertas proteínas que contienen segmentos que, bajo ciertas condiciones, se activan y se separan de la molécula, que puede cambiar su actividad. Otro mecanismo de regulación es la degradación de proteínas.
  7. 7. NIVELES DE REGULACIÓN DE LA EXPRESIÓN GENÉTICA EN EUCARIOTAS Transcripcional Postranscripcional Traduccional Postraduccional
  8. 8. FACTORES DE TRANSCRIPCIÓN Sistema de regulación de genes – Procariotas • Señales del ambiente – Temperatura – Concentración de nutrientes – Eucariotas • Regulación genética – Factores de transcripción
  9. 9. La síntesis de un ARNm dado, se produce cuando el gen respectivo, mejor dicho su promotor y las secuencias reguladoras, se activan por proteínas especiales, llamadas FACTORES DE TRANSCRIPCIÓN. Los factores de transcripción se clasifican en basales y específicos. Los primeros interactúan con el promotor del gen y los segundos con el regulador. Además, los específicos se subdividen en activadores y represores, según interactúen con la secuencia amplificadora o con la inhibidora del regulador.
  10. 10. ESTRUCTURA GENERAL DE LOS GENES
  11. 11. DETALLE DE LA ESTRUCTURA DE UN GEN EUCARIOTA ESQUEMATIZACION DEL GEN Región  regula‐ Región estructural toria Promotor Región estructural Región codificante 5´UTR 3´UTR caat tata  exon intron exon intron exon Sitio de inicio de  la trascripción  (nucleotido+1) Ultimas  tres  bases TGA  ó TAA  ó TAG  que  codificarán  para  uno  de  los  3  posibles  codones  Primeras tres bases  (ATG) que  codificarán  de terminación o STOP. para el codón de iniciación
  12. 12. PRODUCTO DE LA TRANSCRIPCIÓN DE ADN A ARN Región estructural Promotor 5´UTR  3´UTR untranslated region Región codificante untranslated region caat tata  exon intron exon intron exon Sitio de inicio de  la trascripción  (nucleotido+1) exon intron exon intron exon Remoción de  intrones  (splicing) TRANSCRIPTO MADURO: • Adición de caperuza en  G exon exon exon AAAAAAA extremo 5´ • Adición de cola de adeninas  Adición de caperuza en  Adición de cola de adeninas  (cola  (cola de poli A) extremo 5´ (agregado de una G  de poli A), aguas arriba, en la  y metilación de los 3 primeros  secuencia 3´UTR, existe una señal  • Remoción de intrones de poliadenilación nucleótidos)
  13. 13. PARTE DEL TRANSCRIPTO QUE FINALMENTE SERÁ TRADUCIDA POR EL RIBOSOMA: MARCO DE LECTURA STOP AUG exon exon exon 1 2 3 4 5 6 7 8 9 10 1112 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 El polipéptido tendrá tantos aminoácidos como tripletes desde el AUG (inclusive) hasta el codón STOP sin incluir éste ultimo. En el caso de este ejemplo tendrá 30 AA. Proteína Extremo Amino              Extremo Carboxilo              (N‐terminal) (C‐terminal) 1º AA: Metionina
  14. 14. DIRECCIONALIDAD DEL ADN Al esquematizar una sola de las hebras de ADN, SIEMPRE se escribe su secuencia en sentido 5´→3´ 5´ CCATGGTCTATGACTGGTCCATGCTAGCTGAGCTCGT 3´ Promotor +1 Región estructural Aguas arriba (‐) Aguas abajo (+) Sitio de inicio de la trascripción:   nucleotido +1
  15. 15. Francois Jacob Jacques Monod El modelo operón de la regulación de los genes procariotas fue propuesto en 1961 por Francois Jacob y Jacques Monod
  16. 16. Un Operón es grupo de genes estructurales cuya expresión está regulada por elementos de control o genes (promotor y operador) y genes reguladores.
  17. 17. Los operones se clasifican de acuerdo al mecanismo de control, en los siguientes: Inducibles: ejm. operón lactosa Reprimibles: ejm. operón triptófano
  18. 18. Un operón consiste en: Un operador: controla el acceso de la ARN polimerasa al promotor Un promotor: donde la ARN polimerasa reconoce el sitio de inicio de la transcripción Un gen regulador: controla el tiempo y velocidad de transcripción de otros genes Un gen estructural: codifican las enzimas relacionadas o las proteínas estructurales

×