Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Bioinfo - Grad - Aula 3


Published on

  • Be the first to comment

  • Be the first to like this

Bioinfo - Grad - Aula 3

  1. 1. + Bioinformática Alinhamentos de sequências Gabriel da Rocha Fernandes Universidade Católica de Brasília -
  3. 3. + Alinhamentos nSimples X Múltiplo n Local X Global n Heurístico X Ótimo 3 Score = 276 bits (139), Expect = 3e-78 Identities = 139/139 (100%) Strand = Plus / Plus Query: 326 aggtgtaaaaccgtttgaatgcacttattgttataaaggattcactcgaaattctgatct 385 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 560 aggtgtaaaaccgtttgaatgcacttattgttataaaggattcactcgaaattctgatct 619 Query: 386 tcataagcacatcgacgctgttcacaaaggtctcaagcctttcggatgtgaagtatgcca 445 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 620 tcataagcacatcgacgctgttcacaaaggtctcaagcctttcggatgtgaagtatgcca 679 Query: 446 gcgaaacttctctcagaaa 464 ||||||||||||||||||| Sbjct: 680 gcgaaacttctctcagaaa 698
  4. 4. + Alinhamento simples n Aquele realizado entre seqüências de DNA ou proteínas, desde que duas a duas 4 Score = 652 bits (329), Expect = 0.0 Identities = 240/240 (100%) Strand = Plus / Plus Query: 1 ctttcaagatgaacgaaccaactggtgtcgggccaacatttgctgatgcatgcgatgatg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 136 ctttcaagatgaacgaaccaactggtgtcgggccaacatttgctgatgcatgcgatgatg 195 Query: 61 gcgaacttatcagcatttgttgtctttgtggtaaaacgttttcaagtcagagtcttctac 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 196 gcgaacttatcagcatttgttgtctttgtggtaaaacgttttcaagtcagagtcttctac 255 Query: 121 acaaacattttgaattgatgcatgaaggtacggaaatagatactgaacagtatgatctaa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 256 acaaacattttgaattgatgcatgaaggtacggaaatagatactgaacagtatgatctaa 315 Query: 181 gtggatttgccgctatggggaatgaacaaggtcgtaaaagtaatggtgaagaagatgcaa 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 316 gtggatttgccgctatggggaatgaacaaggtcgtaaaagtaatggtgaagaagatgcaa 375
  6. 6. + Alinhamento global e local nGlobal: as seqs são alinhadas de ponta a ponta nLocal: pedaços das seqs é que são comparados 6
  7. 7. + Alinhamentos ótimos e heurísticos nheurística -- do dicionário Houaiss nmétodo de investigação baseado na aproximação progressiva de um dado problema nAlinhamento ótimo: produz o melhor resultado computacionalmente possível nAlinhamento heurístico: produz um resultado o mais próximo possível do resultado ótimo, mas, principalmente, produz um resultado de maneira muito veloz 7
  8. 8. + Ferramentas de alinhamento 8
  9. 9. + Elementos do alinhamento 9
  10. 10. + Matrizes de substituição 10 A C G T A 1 -2 -2 -2 C -2 1 -2 -2 G -2 -2 1 -2 T -2 -2 -2 1 A C G T A 1 -2 -1 -2 C -2 1 -2 -1 G -1 -2 1 -2 T -2 -1 -2 1
  11. 11. + Matrizes de substituição 11
  12. 12. + BLAST nBasic Local Alignment Search Tool nFerramenta de alinhamento mais utilizada no mundo nTodo pesquisador em biologia molecular já usou alguma vez (ou centenas de vezes) nDiz-se que o trabalho original onde a ferramenta foi publicada é o mais citado da história das ciências biológicas nÉ um algoritmo de alinhamento simples, heurístico e local nAlinha um seqüência de entrada contra uma base de dados desejada 12
  13. 13. + Programas do BLAST 13 Formato da Seqüência de Entrada Banco de dados Formato da seqüência que é comparado Programa BLAST adequado Nucleotídeos Nucleotídeos Nucleotídeos BLASTn Proteínas Proteínas Proteínas BLASTp Nucleotídeos Proteínas Proteínas BLASTx Proteínas Nucleotídeos Proteínas TBLASTn Nucleotídeos Nucleotídeos Proteínas TBLASTtx
  14. 14. + Alinhamento multiplo 14 conservation profile conserved residues secondary structure
  15. 15. + Filogenia a partir do alinhamento nMatriz de distância entre as proteínas alinhadas nClustal: 1 - (resíduos idênticos/resíduos alinhados) 15 - .17 - .59 .60 - .59 .59 .13 - .77 .77 .75 .75 - .81 .82 .73 .74 .80 - .87 .86 .86 .88 .93 .90 - Hbb_human Hbb_horse Hba_human Hba_horse Myg_phyca Glb5_petma Lgb2_lupla 1 2 3 4 5 6 7 1 2 3 4 5 6 7
