+    Universidade Católica de Brasília               RNA-seq          Prof. Dr. Gabriel da Rocha Fernandes                ...
+                                                              2    Transcritoma    n Conjunto             de todas as mo...
+                                                           3    Métodos de estudo                   n Expressed   Sequen...
+                                                             4    Métodos de estudo                  n Microarray.      ...
+                                5    Next Generation Sequencing
+                             6    Custo do sequenciamento
+                                               7    RNA-seq              n Ultra   larga escala.              n Não   n...
+                                                                 8    Protocolo    n Protocolo              para montage...
+                                                           9    Genoma referência vs. Montagem    de novo    n Mapeament...
+                                                                    10    O que sai do sequenciador?    n Formato    pad...
+              11    Montagem
+                                                                               12    Mapeamento e quantificação    n As ...
+                                                               13    Interpretando a contagem dos    genes    n No      ...
+                                                               13    Interpretando a contagem dos    genes    n No      ...
+                                                                          13    Interpretando a contagem dos    genes    ...
+                                                                           13    Interpretando a contagem dos    genes   ...
+                                                                           13    Interpretando a contagem dos    genes   ...
+                                                                 14    Identificando genes    diferencialmente expressos....
+                                                                       15    Identificando genes    diferencialmente expr...
+                                                                               16    Sou pobre, não vou usar replicata.  ...
+                                     17    Replicata técnica vs. Replicata    biológica    n Técnica: explica           ...
+                                                                       18    Fontes de variação    Variância de Poisson  ...
+                          19    Fontes de variação    Variância de Poisson
+                                        20    Fontes de variação    Variação Técnica Não-Poisson    n Associadoà incapac...
+                                            21    Fontes de variação    Variação Biológica    n Ocorre   naturalmente na...
+                                                                  22    Filosofando...    n Mais   replicatas vs. Mais r...
Upcoming SlideShare
Loading in …5
×

Laboratório de Biotecnologia - Rna seq

419 views

Published on

Published in: Education
1 Comment
1 Like
Statistics
Notes
No Downloads
Views
Total views
419
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
0
Comments
1
Likes
1
Embeds 0
No embeds

No notes for slide

Laboratório de Biotecnologia - Rna seq

  1. 1. + Universidade Católica de Brasília RNA-seq Prof. Dr. Gabriel da Rocha Fernandes Universidade Católica de Brasília gabrielf@ucb.br - fernandes.gabriel@gmail.com
  2. 2. + 2 Transcritoma n Conjunto de todas as moléculas de RNA encontradas em uma população celular: n mRNA n tRNA n rRNA n miRNA n Total de transcritos encontrados em um organismo, tipo celular, condição... n Reflete os genes que estão sendo expressos em um determinado momento. n Snapshot da função celular.
  3. 3. + 3 Métodos de estudo n Expressed Sequence Tags. n Sequenciado por método de Sanger. n Clonagem dos fragmentos usando vetores. n Não funciona em procariotos. n Low throughput.
  4. 4. + 4 Métodos de estudo n Microarray. n Arranjos com os genes em locais determinados. n Comparação de amostras par a par. n Hibridização.
  5. 5. + 5 Next Generation Sequencing
  6. 6. + 6 Custo do sequenciamento
  7. 7. + 7 RNA-seq n Ultra larga escala. n Não necessita de clonagem. n Baixo custo. n Valores absolutos. n Análise multi amostras. n Grande cobertura.
  8. 8. + 8 Protocolo n Protocolo para montagem da biblioteca pode varias de acordo com a tecnologia e com o objetivo: n Remoção de rRNA. n Amplificação por PCR. n Conversão a cDNA. n Single read ou pair end.
  9. 9. + 9 Genoma referência vs. Montagem de novo n Mapeamento dos reads a um genoma referência. n Quantificação da expressão. n Identificação de variantes de splicing. n Montagem de novo do transcritoma. n Caracterização dos genes expressos. n Identificação de isoformas. n Ausência de genoma referência.
  10. 10. + 10 O que sai do sequenciador? n Formato padrão para análises é o FastQ. n @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCAC + !”*((((***+))%%%++)(%%%%).1***-+*”))**55CCF»»»CCCCCCC65 n Primeira linha: identificador da sequência. n Nome da sequência. n Informação sobre filtros. n Terceira linha: qualidade da chamada da base (em código).
  11. 11. + 11 Montagem
  12. 12. + 12 Mapeamento e quantificação n As sequências produzidas são mapeadas a um genôma referência. n Alinhou em apenas uma região = ótimo. n Alinhou em mais que uma região = dilema. n O uso de replicatas é FUNDAMENTAL! Repl. 1 Repl. 2 Repl. 3 Gene A 5 3 12 Gene B 16 25 35 Gene C 10 15 3 Gene D 750 500 500 Gene E 1504 1005 1030
  13. 13. + 13 Interpretando a contagem dos genes n No exemplo da tabela, o Gene E tem duas vezes mais reads que o Gene D:
  14. 14. + 13 Interpretando a contagem dos genes n No exemplo da tabela, o Gene E tem duas vezes mais reads que o Gene D: n Gene E é expresso duas vezes mais que o Gene D.
  15. 15. + 13 Interpretando a contagem dos genes n No exemplo da tabela, o Gene E tem duas vezes mais reads que o Gene D: n Gene E é expresso duas vezes mais que o Gene D. n Ambos os genes se expressam na mesma intensidade, mas o Gene E é duas vezes maior que o Gene D.
  16. 16. + 13 Interpretando a contagem dos genes n No exemplo da tabela, o Gene E tem duas vezes mais reads que o Gene D: n Gene E é expresso duas vezes mais que o Gene D. n Ambos os genes se expressam na mesma intensidade, mas o Gene E é duas vezes maior que o Gene D. n Ambos os genes tem o mesmo tamanho e se expressam na mesma intensidade, mas o Gene D tem um parálogo no genoma ao qual metade dos seus reads foram mapeados.
  17. 17. + 13 Interpretando a contagem dos genes n No exemplo da tabela, o Gene E tem duas vezes mais reads que o Gene D: n Gene E é expresso duas vezes mais que o Gene D. n Ambos os genes se expressam na mesma intensidade, mas o Gene E é duas vezes maior que o Gene D. n Ambos os genes tem o mesmo tamanho e se expressam na mesma intensidade, mas o Gene D tem um parálogo no genoma ao qual metade dos seus reads foram mapeados. n A causa é os três ao mesmo tempo.
  18. 18. + 14 Identificando genes diferencialmente expressos. n Comparar diferentes condições: controle com testes. n Célula normal com célula tumoral. n Planta sem e com estresse hídrico. n Animal sem e com parasita... n Genesem duas condições diferentes VÃO apresentar quantidades de reads diferentes. n Essa variação pode ser diferença biológica entre as duas condições, ou ruído experimental. n Aplicação de testes estatísticos.
  19. 19. + 15 Identificando genes diferencialmente expressos. n Para identificar uma diferença estatisticamente significantes, é necessário que a diferença de expressão entre as duas condições seja maior que a imprecisão do nível de expressão sob uma determinada condição.
  20. 20. + 16 Sou pobre, não vou usar replicata. n Lição de vida: n Um Gene H, em uma célula normal extraída do Zé Moreno, tem 5 reads. n Omesmo Gene H, em célula tumoral extraída do mesmo Zé Moreno, tem 10 reads. n Uoua! O Gene H é duas vezes mais expresso na célula tumoral! n Ganheiuns trocados e fiz transcritoma da célula normal de mais 2 pacientes. De brinde, ganhei o sequenciamento do Zé moreno de novo. n OGene H teve 12 reads na célula do Zé Moreno, 17 reads na Maria Tolé, e 22 reads na célula do Tião Torresmo. n Moral da história: quanto mais medições fizer, mais vai ter certeza dos níveis de expressão dos genes.
  21. 21. + 17 Replicata técnica vs. Replicata biológica n Técnica: explica a variação encontrada que pode ter sido causada por critérios técnicos: preparação da biblioteca, qualidade do sequênciamento, cobertura do gene... n Biológica: explica a variação encontrada que pode ter sido causada pela variabilidade de expressão que não está associada à mudança nas condições do experimento.
  22. 22. + 18 Fontes de variação Variância de Poisson n É a incerteza existente em qualquer medição em que algo é amostrado e contado. n Como é baseado no valor da contagem em si, não é específico do experimento. n Essa variância está relacionada a quantidade total de reads. n Porexemplo, a diferença na expressão de um gene medido com 1 read versus 2 reads é inerentemente menos seguro do que as diferenças na expressão de um gene medido com 100 reads versus 200 reads, apesar de ambas as diferenças serem, nominalmente, uma mudança 2X.
  23. 23. + 19 Fontes de variação Variância de Poisson
  24. 24. + 20 Fontes de variação Variação Técnica Não-Poisson n Associadoà incapacidade da técnica não conseguir medir a expressão perfeitamente. n Visto em replicatas técnicas. n Causas: n Seleção de miRNA. n Depleção de rRNA. n Amplificação por PCR. n Armazenamento. n RNA-later. n Moral da história: Manipule sua amostra o mínimo possível.
  25. 25. + 21 Fontes de variação Variação Biológica n Ocorre naturalmente nas amostras. n A expressão naturalmente flutua em células sob a mesma condição. n Causas da variações biológicas podem ser diferenças genéticas, de maquinaria celular, ou de resposta a variação do ambiente. n Variaçãobiológica também sofre a influência das outras duas variações vistas.
  26. 26. + 22 Filosofando... n Mais replicatas vs. Mais reads. n Como lidar com batch-effects? n Preciso validar com RT-PCR? n Eu considero como diferencialmente expresso genes com p- value < 0.01. n Calcular FDR (False discovery rate) n Leia artigos que tenham usado benchmarks. n Converse com o bioinformata que vai fazer as análises.

×