Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

02b rvi2, rvi4, rvi11 snp markers and surprises-m. jänsch-20130221

948 views

Published on

  • Be the first to comment

  • Be the first to like this

02b rvi2, rvi4, rvi11 snp markers and surprises-m. jänsch-20130221

  1. 1. Rvi2, Rvi4, Rvi11: SNP markers and surprises Melanie Jänsch, Juliane Weger, Giovanni Broggini, Vincent Bus, Sue Gardiner, Heather Bassett and Andrea Patocchi
  2. 2. Objectives 1. Identification of 5 single nucleotide polymorphisms (SNPs) within an interval of 1 cM 2. Check for level of polymorphism of SNPs in 8 founders 3. Focus of this talk: apple scab resistance genes Rvi 11 (Vbj), Rvi 2 (Vh2) and Rvi 4 (Vh4) (Bus et al., 2011)
  3. 3. repeat Method – SNP development or reject region BLAST available flanking markers on GD sequence Primer Design + PCR SEQ and SNP analysis SNP found SNP confirmation of map position with subset of resistant , susceptible and recombinant individuals closest to the gene SNP polymorphism test with 8 founders SNP identified and validated ok ok ok ok reject region reject region
  4. 4. SNP polymorphism example - Rvi4 (Vh4) 250 260 270 280 290 300 310 320 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| 2249_TNL1 CGTGTTTCTGAAATGCTTCAGCTAAATCTCCGTCCTGCTTCCTGACATGCGAAGGATCAACGTGATAGAATATTGGCAMA Gala_TNL1 CGTGTTTATGAAATGCTTCGGCAAAATCTCCGTCCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Braeburn_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Cox_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Delicious_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA F2_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Golden_TNL1 CGTGTTTATGAAATGCTTCGGCAAAATCTCCGTCCTGCTTCTTGACATGCGAAGGATCAACGTGATAGAATATTGGCAAA Granny_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Jonathan_TNL1 CGTGTTCCCGAAATGCTTCAGCTAAATCTCCGTTCTGATTCCTGACATGCGAAGGATCAACGTGATAGAATATTGGCAAA McIntosh_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| 2249_TNL1 ACATG---CCCCAGTTTGCCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACCTCCT Gala_TNL1 ACATGTCGCTCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Braeburn_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Cox_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Delicious_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT F2_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Golden_TNL1 ACATGTCGCTCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Granny_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Jonathan_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT McIntosh_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Parents and 8 founders included 2nd choice SNPs 1st choice SNPs
  5. 5. FVbj3 Z13_SCAR CH02c06 SNP_region_20(8) B8 CH05e03 Rvi11 SNP_region_34(9) CH03d01 0.1 0.1 2.0 0.7 0.7 0.8 3.8 Rvi11 Rvi11 (Vbj) • Plant material: GD x A722-7, 145 plants • 55 regions tested • In 2 regions SNPs identified • Vbj SNPs mapped between 0.7 and 3 cM • 17 SNPs found in total (Gygax et al., 2004)
  6. 6. Rvi2 (Vh2) • Plant material: GD x X2250, 146 plants • 44 regions tested • In 8 regions SNPs identified • Vh2 SNPs mapped between 0.7 and 2.8 cM • 61 SNPS found in total (Bus et al., 2005) CH02b10 CH2-Z13SCAR SNP_region_53(8) SNP_region_41(1) CH05e03 SNP_region_20.4(1) CH-Vbj2 SNP_region_21(15) SNP_region_23(5) Rvi2 SNP_region_27(21) L19SCAR SNP_region_34.3(6) SNP_region_36(4) CH03d01 0.7 0.7 0.7 0.7 1.4 Rvi2
  7. 7. Rvi4 (Vh4) Hi22d06 SNP_region_TNL1(20) SNP_region_3(2) SNP_region_10(1) SNP_region_Vr2_3(3) Rvi4 SNP_region_ARGH37(1) CH02c02a Hi02a07 SCAR-S22 2.1 0.4 1.3 Rvi4 • Plant material: Gala x X2249, 242 plants • 30 regions tested • In 5 regions SNPs identified • Vh4 SNPs mapped at 0 cM • 27 SNPs found in total (Bus et al., 2005)
  8. 8. Rvi2 vs. Rvi11 CH02b10 Z13_SCAR SNP_region_53(8) SNP_region_41(1) CH05e03 SNP_region_20(1) CH-Vbj2 SNP_region_21(15) SNP_region_23(5) Rvi2 SNP_region_27(21) L19SCAR SNP_region_34(6) SNP_region_36(4) CH03d01 0.7 0.7 0.7 0.7 1.4 Rvi2 Z13_SCAR CH02c06 SNP_region_20(8) B8 CH05e03 Rvi11 SNP_region_34(9) FVbj3 CH03d01 0.1 0.1 2.0 0.7 0.7 0.8 3.8 Rvi11 • Indication that Rvi2 and Rvi11 may derive from the same region • Allelic? • Phenotype of the two genes is similar (SC vs. SN) • Difference due to difference level of enhancement of the resistance cascade? (Bus et al., 2011)
  9. 9. Rvi4 vs. Rvi15 • Indication that Rvi4 and Rvi15 may derive from the same region • Allelic? • Phenotype of the two genes is the same (PPP) • Rvi4 symptoms visible after 3-4 days, Rvi15 after 7 days • Difference due to difference level of enhancement of the resistance cascade? 005 Hi22d06 SNP_region_TNL1(20) SNP_region_3(2) SNP_region_10(1) SNP_region_Vr2_3(3) Rvi4 SNP_region_ARGH37(1) CH02c02a Hi02a07 S22_SCAR 2.1 0.4 1.3 Rvi4 CH02f06 ARGH37 Rvi15 ARGH17 CH02c02a 2.9 1.2 0.3 1.7 Rvi15 (Bus et al., 2011)
  10. 10. Conclusion • SNP markers for resistance genes most used in breeding will be soon available. • This will simplify marker assisted selection (MAS) and will allow a reduction of its costs . • The precise mapping of the genes increases the precision of MAS and indicates the possible allelism of: – Rvi2 and Rvi11 – Rvi4 and Rvi15

×