Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Scalable up genomic analysis with ADAM


Published on

Talk on scalable genomics at NIBR.

Published in: Engineering
  • Be the first to comment

Scalable up genomic analysis with ADAM

  1. 1. Scaling up genomic analysis with ADAM Frank Austin Nothaft, UC Berkeley AMPLab, @fnothaft 10/27/2014
  2. 2. What is ADAM? • An open source, high performance, distributed platform for genomic analysis • ADAM defines a: 1. Data schema and layout on disk* 2. A Scala API 3. A command line interface * Via Avro and Parquet
  3. 3. What’s the big picture? ADAM:! Core API + CLIs bdg-formats:! Data schemas RNAdam:! RNA analysis on ADAM avocado:! Distributed local assembler xASSEMBLEx:! GraphX-based de novo assembler bdg-services:! ADAM clusters PacMin:! String graph assembler
  4. 4. Implementation Overview • 34k LOC (96% Scala) • Apache 2 licensed OSS • 23 contributors across 10 institutions • Pushing for production 1.0 release towards end of year
  5. 5. Key Observations • Current genomics pipelines are I/O limited • Most genomics algorithms can be formulated as a data or graph parallel computation • These algorithms are heavy on iteration/pipelining • Data access pattern is write once, read many times • High coverage, whole genome will become main sequencing target (for human genetics)
  6. 6. Principles for Scalable Design in ADAM • Parallel FS and data representation (HDFS + Parquet) combined with in-memory computing eliminates disk bandwidth bottleneck • Spark allows efficient implementation of iterative/ pipelined Map-Reduce • Minimize data movement: send code to data
  7. 7. • An in-memory data parallel computing framework • Optimized for iterative jobs —> unlike Hadoop • Data maintained in memory unless inter-node movement needed (e.g., on repartitioning) • Presents a functional programing API, along with support for iterative programming via REPL • Used at scale on clusters with >2k nodes, 4TB datasets
  8. 8. Why Spark? • Current leading map-reduce framework: • First in-memory map-reduce platform • Used at scale in industry, supported in major distros (Cloudera, HortonWorks, MapR) • The API: • Fully functional API • Main API in Scala, also support Java, Python, R • Manages node/job failures via lineage, data locality/job assignment • Downstream tools (GraphX, MLLib)
  9. 9. Data Format • Avro schema encoded by Parquet • Schema can be updated without breaking backwards compatibility • Read schema looks a lot like BAM, but renormalized • Actively removing tags • Variant schema is strictly biallelic, a “cell in the matrix” record AlignmentRecord { union { null, Contig } contig = null; union { null, long } start = null; union { null, long } end = null; union { null, int } mapq = null; union { null, string } readName = null; union { null, string } sequence = null; union { null, string } mateReference = null; union { null, long } mateAlignmentStart = null; union { null, string } cigar = null; union { null, string } qual = null; union { null, string } recordGroupName = null; union { int, null } basesTrimmedFromStart = 0; union { int, null } basesTrimmedFromEnd = 0; union { boolean, null } readPaired = false; union { boolean, null } properPair = false; union { boolean, null } readMapped = false; union { boolean, null } mateMapped = false; union { boolean, null } firstOfPair = false; union { boolean, null } secondOfPair = false; union { boolean, null } failedVendorQualityChecks = false; union { boolean, null } duplicateRead = false; union { boolean, null } readNegativeStrand = false; union { boolean, null } mateNegativeStrand = false; union { boolean, null } primaryAlignment = false; union { boolean, null } secondaryAlignment = false; union { boolean, null } supplementaryAlignment = false; union { null, string } mismatchingPositions = null; union { null, string } origQual = null; union { null, string } attributes = null; union { null, string } recordGroupSequencingCenter = null; union { null, string } recordGroupDescription = null; union { null, long } recordGroupRunDateEpoch = null; union { null, string } recordGroupFlowOrder = null; union { null, string } recordGroupKeySequence = null; union { null, string } recordGroupLibrary = null; union { null, int } recordGroupPredictedMedianInsertSize = null; union { null, string } recordGroupPlatform = null; union { null, string } recordGroupPlatformUnit = null; union { null, string } recordGroupSample = null; union { null, Contig} mateContig = null; }
  10. 10. Parquet • ASF Incubator project, based on Google Dremel • • High performance columnar store with support for projections and push-down predicates • 3 layers of parallelism: • File/row group • Column chunk • Page Image from Parquet format definition:
  11. 11. Filtering • Parquet provides pushdown predication • Evaluate filter on a subset of columns • Only read full set of projected columns for passing records • Full primary/secondary indexing support in Parquet 2.0 • Very efficient if reading a small set of columns: • On disk, contig ID/start/end consume < 2% of space Image from Parquet format definition:
  12. 12. Compression • Parquet compresses at the column level: • RLE for repetitive columns • Dictionary encoding for quantized columns • ADAM uses a fully denormalized schema • Repetitive columns are RLE’d out • Delta encoding (Parquet 2.0) will aid with quality scores • ADAM is 5-25% smaller than compressed BAM
  13. 13. Parquet/Spark Integration • 1 row group in Parquet maps to 1 partition in Spark • We interact with Parquet via input/output formats • These apply projections and predicates, handle (de)compression • Spark builds and executes a computation DAG, manages data locality, errors/retries, etc. Parquet RG 1 RG 2 RG n … Spark Parquet Input Format Partition 2 … Parquet Output Format Parquet Partition 1 Partition n RG 1 RG 2 RG n …
  14. 14. Long-read assembly with PacMin
  15. 15. The State of Analysis • Conventional short-read alignment based pipelines are really good at calling SNPs • But, we’re still pretty bad at calling INDELs, and SVs • And are slow: 2 weeks to sequence, 1 week to analyze. Not fast enough for clinical use. • If we move away from short reads, do we have other options?
  16. 16. Opportunities • New read technologies are available • Provide much longer reads (250bp vs. >10kbp) • Different error model… (15% INDEL errors, vs. 2% SNP errors) • Generally, lower sequence specific bias Left: PacBio homepage, Right: Wired,
  17. 17. If long reads are available… • We can use conventional methods: Carneiro et al, Genome Biology 2012
  18. 18. But! • Why not make raw assemblies out of the reads? Find overlapping reads Find consensus sequence for all pairs of reads (i,j): i j =? …ACACTGCGACTCATCGACTC… • Problems: 1. Overlapping is O(n 2 ) and single evaluation is expensive anyways 2. Typical algorithms find a single consensus sequence; what if we’ve got polymorphisms?
  19. 19. Fast Overlapping with MinHashing • Wonderful realization by Berlin et al1: overlapping is similar to document similarity problem • Use MinHashing to approximate similarity: 1: Berlin et al, bioRxiv 2014 Per document/read, compute signature:! ! 1. Cut into shingles 2. Apply random hashes to shingles 3. Take min over all random hashes Hash into buckets:! ! Signatures of length l can be hashed into b buckets, so we expect to compare all elements with similarity ≥ (1/b)^(b/l) Compare:! ! For two documents with signatures of length l, Jaccard similarity is estimated by (# equal hashes) / l ! • Easy to implement in Spark: map, groupBy, map, filter
  20. 20. Overlaps to Assemblies • Finding pairwise overlaps gives us a directed graph between reads (lots of edges!)
  21. 21. Transitive Reduction • We can find a consensus between clique members • Or, we can reduce down: • Via two iterations of Pregel!
  22. 22. Actually Making Calls • From here, we need to call copy number per edge • Probably via Newton-Raphson based on coverage; we’re not sure yet. • Then, per position in each edge, call alleles: Notes:! Equation is from Li, Bioinformatics 2011 g = genotype state m = ploidy 휖 = probability allele was erroneously observed k = number of reads observed l = number of reads observed matching “reference” allele TBD: equation assumes biallelic observations at site and reference allele; we won’t have either of those conveniences…
  23. 23. An aside: Monoallelic Genotyping • Traditional probabilistic models for variant calling assume independence at each site • However, this throws away a lot of information • Can consider a different formulation of the problem: • Build a graph of the alleles • Find the allelic copy numbers that maximize likelihood
  24. 24. Allelic Graph
  25. 25. Allelic Graph ACACTCG C A TCTCA G C TCCACACT • Edges of graph define conditional probabilities • E.g., if ACACTCG is covered by 30 reads, and C is covered by 1 read, P(C | ACACTCG) is low • Can efficiently marginalize probabilities over graph using Eliminate algorithm1, exactly solve for argmax 1. Jordan, “Probabilistic Graphical Models.”
  26. 26. Output • Current assemblers emit FASTA contigs • In layperson’s speak: long strings • We’ll emit “multigs”, which we’ll map back to reference graph • Multig = multi-allelic (polymorphic) contig • Working with UCSC, who’ve done some really neat work1 deriving formalisms & building software for mapping between sequence graphs, and GA4GH ref. variation team 1. Paten et al, “Mapping to a Reference Genome Structure”, arXiv 2014.
  27. 27. Acknowledgements • UC Berkeley: Matt Massie, André Schumacher, Jey Kottalam, Christos Kozanitis, Adam Bloniarz! • Mt. Sinai: Arun Ahuja, Neal Sidhwaney, Michael Linderman, Jeff Hammerbacher! • GenomeBridge: Timothy Danford, Carl Yeksigian! • Cloudera: Uri Laserson! • Microsoft Research: Jeremy Elson, Ravi Pandya! • And many other open source contributors: 23 contributors to ADAM/BDG from >10 institutions
