New High Throughput Sequencing technologies    at the Norwegian Sequencing Centre               - and beyond           Lex...
Norwegian Sequencing Centre National technology core facility
Norwegian Sequencing Centre            Offering sequencing servicesGS FLX from Roche/454       HiSeq 2000 from Illumina
1) New instruments:Benchtop sequencers
High-throughput sequencing    Phase 1: more is better   2005 GS20        200 000 reads         100 bp        0.02 Gb/run  ...
High-throughput sequencing                  Phase 2: smaller is better                                    GS Junior from R...
High-throughput sequencing      Why benchtop sequencing instruments?                            GS Junior from Roche/454  ...
High-throughput sequencing              Why benchtop sequencing instruments?                                              ...
High-throughput sequencingBenchtop sequencing instruments at the NSC                                 ✖ ✔ ✔                ...
Sequencing technology
Sequencing technology                                         Reversible dye terminator                                   ...
Sequencing technology                         PyrosequencingPPi: pyrophosphate
Sequencing technology               Free proton current shift               sequencing-by-synthesis
Error profiles        Substitution errors        ACGTAGCTGATTTTAGGCTTAGCT        ACGTAGCTGCTTTTAGGCTTAGCT        Homopolym...
Applications                         Illumina   Illumina     Platform   454                            Ion Torrent        ...
Announced upgrades   HiSeq 2000          HiSeq 2500                      2x 250 bp reads   2x150 bp?      Rapid run mode 2...
Which instrument to choose?
Shameless self-promotion (1)flxlexblog.wordpress.com
Shameless self-promotion (1)      @lexnederbragt
2) New instruments:Pacific Biosciences RS
High-throughput sequencing                      Phase 3: single-moleculeC2 (current) chemistry:Average read length 2500 bp...
High-throughput sequencing                      REVI EW S                          Technology                      Pacific...
High-throughput sequencingS                                                                        TechnologyReal-time seq...
High-throughput sequencing                          Library preparationSMRTBelltemplateSMRTBelltemplateStandardSequencingS...
High-throughput sequencing        Read length
High-throughput sequencingSMRTBelltemplate                          Raw reads and subreadsStandardSequencing              ...
High-throughput sequencingSMRTBelltemplateSMRTBelltemplate                                Raw read qualityStandardSequenci...
Applications                        Illumina   Illumina      Platform   454                          Ion Torrent   PacBio ...
PacBio and base modifications
What use for PacBio?http://www.walker.co.uk/What-Use-Is-a-Moose-9780744578393.aspx
PacBio: usesStandardSequencing                        Short reads  high quality                                          ...
PacBio: usesSMRTBelltemplate                          Long reads  low qualityStandardSequencing                          ...
PacBio: uses  Can long PacBio reads    overcome repeatsduring de novo assembly?           http://nopsa.hiit.fi/pmg/viewer/...
PacBio: long read uses                  For de novo               For scaffoldinghttp://schatzlab.cshl.edu/presentations/2...
PacBio: long read uses             For de novo    Error correct with short readshttp://schatzlab.cshl.edu/presentations/2...
PacBio: long read uses                  For de novohttp://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
PacBio: long read uses      For de novo                         Koren et al, 2012
PacBio: long read uses      For de novo
PacBio: long read usesFor de novo - alternatives                     ALLPATHS_LG
Shameless self-promotion (2)flxlexblog.wordpress.com
3) Preliminary results:Pacific Biosciences RS
PacBio: first results                          Samples     Atlantic cod                             Fish Xhttp://en.wikipe...
PacBio: first resultsSMRTBelltemplate                                 LibrariesStandardSequencing                         ...
PacBio: first results                                                            Raw reads                          ZMWs  ...
SMRTBelltemplate                            PacBio: first resultsLength of longest subread for all raw reads  StandardSequ...
PacBio: first results                  Length of longest subread for all raw reads                               Per SMRTC...
PacBio: first resultsMapping to the cod genome     Long insert – single pass    Short insert – many passes
PacBio: first resultsMapping to the cod genome     Long insert – single pass      11.4 kbp subread
PacBio: first resultsMapping to the cod genome     Long insert – single pass      10.6 kbp subread
PacBio: first resultsMapping to the cod genome     Long insert – single pass      10.9 kbp subread
4) Beyond ‘second generation’ sequencing
High-throughput sequencingPhase 1: more is betterPhase 2: smaller is betterPhase 3: single-moleculePhase 4: the sky is the...
Nanopore sequencing
Oxford NanoporeAGBT conference, February 2012
Oxford Nanopore  AGBT conference, February 2012                             100 kbp reads                             Curr...
Oxford NanoporeAGBT conference, February 2012                        MinION      512 nanopores         150mb/hour        U...
Nanopore sequencing                     Seeing is believinghttp://uwgcm.org
Nanopore sequencingDemocratization of sequencing
Upcoming SlideShare
Loading in …5
×

Updated: New High Throughput Sequencing technologies at the Norwegian Sequencing Centre - and beyond

3,374 views

Published on

Un update of the previous talk with the same title. A talk I gave at the Computational Life Science initiative (University of Oslo) about new High Throughput Sequencing instruments at the Norwegian Sequencing Centre. I also mentioned future upgrades, and the upcoming nanopore sequencing platform of Oxford nanopore.

Published in: Technology, Business
  • Be the first to comment

Updated: New High Throughput Sequencing technologies at the Norwegian Sequencing Centre - and beyond

  1. 1. New High Throughput Sequencing technologies at the Norwegian Sequencing Centre - and beyond Lex Nederbragt, NSC and CEES lex.nederbragt@bio.uio.no
  2. 2. Norwegian Sequencing Centre National technology core facility
  3. 3. Norwegian Sequencing Centre Offering sequencing servicesGS FLX from Roche/454 HiSeq 2000 from Illumina
  4. 4. 1) New instruments:Benchtop sequencers
  5. 5. High-throughput sequencing Phase 1: more is better 2005 GS20 200 000 reads 100 bp 0.02 Gb/run 2011 GS FLX+ 1.2 million reads 750 bp 0.7 Gb/run 2006 GA 28 million reads 25 bp 0.7 Gb/run 2011 HiSeq 2000 3 billion reads 2x100 bp 600 Gb/run
  6. 6. High-throughput sequencing Phase 2: smaller is better GS Junior from Roche/454 0.04 GB/run 400 bp reads0.7 GB/run700 bp reads MiSeq from Illumina 2 GB/run 2x150 bp reads600 GB/run2x100 bp reads PGM from Ion Torrent/ Life Technologies 0.01, 0.1 or 1 GB/run 100 or 200 bp reads
  7. 7. High-throughput sequencing Why benchtop sequencing instruments? GS Junior from Roche/454 10 hours23 hours MiSeq from Illumina 27 hours10 days PGM from Ion Torrent/ Life Technologies 3 hours
  8. 8. High-throughput sequencing Why benchtop sequencing instruments? Diagnostics Affordable price per instrument Small projects Fast turn around timehttp://pennystockalerts.com/ http://www.highqualitylinkbuildingservice.com/http://www.vetlearn.com/ http://vanillajava.blogspot.com
  9. 9. High-throughput sequencingBenchtop sequencing instruments at the NSC ✖ ✔ ✔ ✔ ✔
  10. 10. Sequencing technology
  11. 11. Sequencing technology Reversible dye terminator sequencing-by-synthesis Reversible terminatorsMetzker 2010 Nat Rev Genet.11(1):31-46
  12. 12. Sequencing technology PyrosequencingPPi: pyrophosphate
  13. 13. Sequencing technology Free proton current shift sequencing-by-synthesis
  14. 14. Error profiles Substitution errors ACGTAGCTGATTTTAGGCTTAGCT ACGTAGCTGCTTTTAGGCTTAGCT Homopolymer errors ACGTAGCTGATTTTAGGCTTAGCT ACGTAGCTGATTT-AGGCTTAGCT
  15. 15. Applications Illumina Illumina Platform 454 Ion Torrent HiSeq MiSeqresequencing - +++ ++ +++ de novo +++ + + ++metagenomics +++ ++ + ++ mRNA ++ +++ ++ + miRNA - +++ +++ - ChIP - +++ ++ - DNA meth - +++ + -
  16. 16. Announced upgrades HiSeq 2000 HiSeq 2500 2x 250 bp reads 2x150 bp? Rapid run mode 27 hrs 8.5 Gbp 2x150 bp, 90 Gbp 750 bp reads?400 bp reads Proton from Ion Torrent Fall 2012: 10 Gb on Proton I chip, 400 bp 2013: 4 x more wells on Proton II chip
  17. 17. Which instrument to choose?
  18. 18. Shameless self-promotion (1)flxlexblog.wordpress.com
  19. 19. Shameless self-promotion (1) @lexnederbragt
  20. 20. 2) New instruments:Pacific Biosciences RS
  21. 21. High-throughput sequencing Phase 3: single-moleculeC2 (current) chemistry:Average read length 2500 bp36 000 reads90 MB per ‘run’
  22. 22. High-throughput sequencing REVI EW S Technology Pacific Biosciences — Real-time sequencing a Phospholinked hexaphosphate nucleotides G A b 1 nm 00Zero-mode waveguide Limit of detection zone Glass Fluorescence pulse Intensity Epifluorescence detection T Figure 4 | Real-time sequencing. P acific Biosciences’ four-colour r a | The zero-mode waveguide (ZMW) design reduces the observatio fluorescently labelled molecules that enter the detection layer for a the dilemma that DNA polymerases perform optimally when fluore
  23. 23. High-throughput sequencingS TechnologyReal-time sequencing Phospholinked hexaphosphate nucleotides G A T C b Limit of detection zone Fluorescence pulse Intensitye detection Time Nature Reviews | Genetics Figure 4 | Real-time sequencing. Pacific Biosciences’ four-colour real-time sequencing method is shown.
  24. 24. High-throughput sequencing Library preparationSMRTBelltemplateSMRTBelltemplateStandardSequencingStandardSequencing Generates& pass& each& one& on& molecule& Insert& Large& Sizes& Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& sequenced&CircularConsensusSequencingCircularConsensusSequencing Insert& Small& Sizes& Small& Insert& Sizes& mul8ple& Generates& passes& each& on& molecule& Generates& mul8ple& sequenced& passes& each& on& molecule& sequenced&
  25. 25. High-throughput sequencing Read length
  26. 26. High-throughput sequencingSMRTBelltemplate Raw reads and subreadsStandardSequencing Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& ‘Subreads’CircularConsensusSequencing Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced&
  27. 27. High-throughput sequencingSMRTBelltemplateSMRTBelltemplate Raw read qualityStandardSequencing Generates& pass& each& one& on& molecule& Large& Insert& Sizes&StandardSequencing sequenced& 85-87% accuracyCircularConsensusSequencing Large& Insert& Sizes& Random pass& each& Generates& one& sequenced& errors (!) on& molecule&CircularConsensusSequencing Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced& Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced& 4 to 5 passes: accuracies in the high 90s % 5 passes yields average Q30 (1:1000 chance of error)
  28. 28. Applications Illumina Illumina Platform 454 Ion Torrent PacBio HiSeq MiSeq*resequencing - +++ ++ - + de novo +++ + + +++ +++metagenomics +++ ++ + +++ +/- mRNA ++ +++ ++ ++ ++ miRNA - +++ +++ - - ChIP - +++ ++ - - DNA meth - +++ + - !!!SNP validation + - - - ++
  29. 29. PacBio and base modifications
  30. 30. What use for PacBio?http://www.walker.co.uk/What-Use-Is-a-Moose-9780744578393.aspx
  31. 31. PacBio: usesStandardSequencing Short reads  high quality Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced&CircularConsensusSequencing Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced& SNP validation Short tandem repeats!
  32. 32. PacBio: usesSMRTBelltemplate Long reads  low qualityStandardSequencing Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& 85-87% accuracyCircularConsensusSequencing Uses? Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced&
  33. 33. PacBio: uses Can long PacBio reads overcome repeatsduring de novo assembly? http://nopsa.hiit.fi/pmg/viewer/photo.php?id=14134
  34. 34. PacBio: long read uses For de novo For scaffoldinghttp://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
  35. 35. PacBio: long read uses For de novo  Error correct with short readshttp://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
  36. 36. PacBio: long read uses For de novohttp://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
  37. 37. PacBio: long read uses For de novo Koren et al, 2012
  38. 38. PacBio: long read uses For de novo
  39. 39. PacBio: long read usesFor de novo - alternatives ALLPATHS_LG
  40. 40. Shameless self-promotion (2)flxlexblog.wordpress.com
  41. 41. 3) Preliminary results:Pacific Biosciences RS
  42. 42. PacBio: first results Samples Atlantic cod Fish Xhttp://en.wikipedia.org http://www.drawinghowtodraw.com/
  43. 43. PacBio: first resultsSMRTBelltemplate LibrariesStandardSequencing Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& 4kb and 17b insert sizesCircularConsensusSequencing Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced&
  44. 44. PacBio: first results Raw reads ZMWs Mean readlength30,000 4,00025,000 3,500 3,00020,000 2,50015,000 2,00010,000 1,500 1,000 5,000 500 0 0 cod 4kb cod 17kb Fish X 4kbFish X 4kb Fish X Fish X cod 4kb cod 17kb Fish X 4kb Fish X 4kb Fish X Fish X 17kb 17kb 17kb 17kb Longest read 25,000 20,000 15,000 10,000 5,000 0 cod 4kb cod 17kb Fish X 4kb Fish X 4kb Fish X 17kb Fish X 17kb
  45. 45. SMRTBelltemplate PacBio: first resultsLength of longest subread for all raw reads StandardSequencing Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& CircularConsensusSequencing Average length 16,000 Largest Small& Insert& Sizes& 14,000 Generates& mul8ple& passes& each& on& molecule& 12,000 sequenced& 10,000 8,000 6,000 4,000 2,000 0 cod 4kb cod 17kb Fish X 4kb Fish X 4kb Fish X 17kb Fish X 17kb
  46. 46. PacBio: first results Length of longest subread for all raw reads Per SMRTCell longest subread length density distribution Fish X Salmon Atlantic Atlantic Cod 4kb libraries Cod 3e−04 17kb libraries 2e−04Density 1e−04 0e+00 0 2000 4000 6000 8000 10000 Maximum subread length
  47. 47. PacBio: first resultsMapping to the cod genome Long insert – single pass Short insert – many passes
  48. 48. PacBio: first resultsMapping to the cod genome Long insert – single pass 11.4 kbp subread
  49. 49. PacBio: first resultsMapping to the cod genome Long insert – single pass 10.6 kbp subread
  50. 50. PacBio: first resultsMapping to the cod genome Long insert – single pass 10.9 kbp subread
  51. 51. 4) Beyond ‘second generation’ sequencing
  52. 52. High-throughput sequencingPhase 1: more is betterPhase 2: smaller is betterPhase 3: single-moleculePhase 4: the sky is the limit?
  53. 53. Nanopore sequencing
  54. 54. Oxford NanoporeAGBT conference, February 2012
  55. 55. Oxford Nanopore AGBT conference, February 2012 100 kbp reads Currently at 4% error 1% error at releaseGridION 2000 nanopores/node tens of Gb data per 24 hour Run until… 20 nodes 1 human genome in 15 minutes
  56. 56. Oxford NanoporeAGBT conference, February 2012 MinION 512 nanopores 150mb/hour Up to 6 hours $900
  57. 57. Nanopore sequencing Seeing is believinghttp://uwgcm.org
  58. 58. Nanopore sequencingDemocratization of sequencing

×