Successfully reported this slideshow.
Istituto di Bioscienze e BioRisorse

Bioinformatica applicata a dati di genomica e trascrittomica delle piante

Dr. Domeni...
Istituto di Bioscienze e BioRisorse

Attività di Ricerca
• ESPRESSIONE GENICA DI MICRORNA IN DATI DI SEQUENZIAMENTO
• SEQU...
Studi di espressione di microRNA mediante next-generation sequencing
I MICRO RNA (MIRNA) SONO PICCOLE
MOLECOLE DI RNA REGO...
SEQUENZIAMENTO DEL GENOMA
CLOROPLASTICO DI CYNARA CARDUNCULUS
1. Sequenziamento ed assemblaggio
- Reads cloroplastiche (se...
OIDIO E FAMIGLIA GENICA MLO
L’oidio o “mal bianco” è una delle malattie più frequenti e dannose per diverse piante sia in ...
OIDIO E FAMIGLIA GENICA MLO
•

GENI DI SUSCETTIBILITÀ: RENDONO LE PIANTE COLTIVATE SUSCETTIBILI ALL’OIDIO. LA DISATTIVAZIO...
PICCOLI RNA INTERFERENTI DERIVATI DA VIRUS COME FATTORI DI PATOGENICITÀ IN INTERAZIONI POTATO
VIRUS Y - POMODORO
LA

RICER...
ANALYSIS DI RICERCA DI TARGET SUL TRASCRITTOMA DI
POMODORO (BLAST RNAHYBRID )CI HA PERMESSO
D’INDIVIDUARE GENI TARGET DELL...
http://eco.igv.cnr.it/igvdb/web

IL MEDITERRANEAN GERMPLASM DATABASE CONTIENE INFORMAZIONI DI “PASSAPORTO” RELATIVE AD 56 ...
10
BioGenRes
E’ un idea nata all’interno del dipartimento Scienze Bio-Agroalimentari, che ha come obbiettivo il
censimento al...
Istituto di Bioscienze e BioRisorse

STUDI DI ESPRESSIONE DI MIRNA IN DATI DI SEQUENZIAMENTO

E SEQUENZIAMENTO DEL CLOROPL...
Upcoming SlideShare
Loading in …5
×

Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittomica delle piante

808 views

Published on

Bioinformatica applicata a dati di genomica e trascrittomica delle piante

  • Be the first to comment

  • Be the first to like this

Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittomica delle piante

  1. 1. Istituto di Bioscienze e BioRisorse Bioinformatica applicata a dati di genomica e trascrittomica delle piante Dr. Domenico Catalano 1
  2. 2. Istituto di Bioscienze e BioRisorse Attività di Ricerca • ESPRESSIONE GENICA DI MICRORNA IN DATI DI SEQUENZIAMENTO • SEQUENZIAMENTO DEL CLOROPLASTO DI CYNARA • DATABASE DI BIODIVERSITÀ : 1. MEDITERRANEAN GERMPLASM DATABASE 2. BIOGENRES • OIDIO E FAMIGLIA GENICA MLO • ANALISI DI GENOMI VIRALI AD RNA E RUOLO FUNZIONALE DEI VSIRNA • MIRNA DELLE PIANTE: UN POSSIBILE RUOLO NELLA REGOLAZIONE DEL METABOLISMO UMANO 2
  3. 3. Studi di espressione di microRNA mediante next-generation sequencing I MICRO RNA (MIRNA) SONO PICCOLE MOLECOLE DI RNA REGOLATORI. NELLE PIANTE SONO COINVOLTI IN PROCESSI FONDAMENTALI QUALI LO Sviluppo Stess abiotici SVILUPPO E RISPOSTA AGLI STRESS. Stress biotici 3 • Sequenziamento Illumina • Identificazione dei miRNA controllo s s 2 1.5 c Small RNAs s 2.5 c replicato 1 replicato2 c 1 • Clustering isoMir 0.5 • Conteggio e normalizzazione stress 0 replicato3
  4. 4. SEQUENZIAMENTO DEL GENOMA CLOROPLASTICO DI CYNARA CARDUNCULUS 1. Sequenziamento ed assemblaggio - Reads cloroplastiche (sequenziamento Illumina) del genoma totale di Cynara cardunculus tramite mappatura delle read sul reference Lactuca - Assembly de novo (CLC workbench) - contig ordinati rispetto al reference e chiusura gap tramite sequenziamento Sanger 2. Annotazione tramite DOGMA Plot: GeneomeVx (a). Reference: Lactuca sativa a 3. Multiallineamento dei genomi cp delle Asteraceae e studi di filogenia - Multiallineamento e plot: mVISTA (b) - Analisi di filogenia: PAUP*4.0 4. Sequenziamento ed analisi di 19 genomi cloroplastici di varietà e specie differenti - Sequenziamento Illumina di frammenti (long PCR) - Chiamata delle varianti (CLC genomics workbench) b gabriella.sonnante@ibbr.cnr.it
  5. 5. OIDIO E FAMIGLIA GENICA MLO L’oidio o “mal bianco” è una delle malattie più frequenti e dannose per diverse piante sia in condizioni controllate in serra che in pieno campo. E’ causata da funghi appartenenti alla divisione degli ascomiceti, colpisce circa 10.000 specie di angiosperme ed è causa di ingenti aggravi economici. • GENI MLO: SONO UNA FAMIGLIA GENICA DIFFUSA IN TUTTE LE PIANTE SUPERIORI • CODIFICANO PER PROTEINE DI MEMBRANA CON SETTE DOMINI TRANSMEMBRANA • I GENI MLO SONO COINVOLTI NELLA SUSCETTIBILITÀ ALL’OIDIO, SIA NELLE DICOTILEDONI CHE NELLE MONOCOTILEDONI • LA DISATTIVAZIONE DEI GENI MLO COINVOLTI NELL'INFEZIONE DA OIDIO PRODUCE PIANTE RESISTENTI • SIAMO INTERESSATI ALL’INDIVIDUAZIONE DI AMINOACIDI CHE PRODUCANO “LOSS OF FUNCTIONS” DELLA PROTEINA
  6. 6. OIDIO E FAMIGLIA GENICA MLO • GENI DI SUSCETTIBILITÀ: RENDONO LE PIANTE COLTIVATE SUSCETTIBILI ALL’OIDIO. LA DISATTIVAZIONE DEI GENI MLO FUNZIONALI ALL'INFEZIONE HA COME EFFETTO LA RESISTENZA ALL’OIDIO Step 1 Step 2 Step 3 INDIVIDUAZIONE DELLE FONTI ESTRAZIONE, INDIVIDUAZIONE INFORMATIVE DISPONIBILI DEGLI OMOLOGHI DI MLO IN STUDIO DELLA FAMIGLIA GENICA IN SPECIE. METODI MONO E DICOTILEDONI Step 4 CLADOGENETICI Ricerca ed estrazione dei geni MLO omologhi in specie coltivate, Procedure: • Scripting in Perl • Database relazionali Step 5 Step 4 INDIVIDUAZIONE DEI POTENZIALI ORTOLOGHI FUNZIONALI NELLE INDIVIDUAZIONE DI SPECIFICI AA CI HA PERMESSO DI DARE IL VIA A: • ESPERIMENTI DI MUTAGENESI SITO • DICOTILEDONI E MONOCOTILEDONI SPECIFICA PROGRAMMI DI MIGLIORAMENTO GENETICO 6 Rosacee, Cucurbitaceae, Solanaceae
  7. 7. PICCOLI RNA INTERFERENTI DERIVATI DA VIRUS COME FATTORI DI PATOGENICITÀ IN INTERAZIONI POTATO VIRUS Y - POMODORO LA RICERCA SI CONCENTRA SULLE INTERAZIONI VIRUS-OSPITE, IN PARTICOLARE DURANTE L'INFEZIONE PVY-POMODORO. SIAMO INTERESSATI A CAPIRE I MECCANISMI CHE SI BASANO SULL’RNA E COME I VIRUS GLI UTILIZZANO PER INDURRE DEI CAMBIAMENTI NELL'ESPRESSIONE GENICA DELL’OSPITE, DANDO LUOGO TRA ALTRO AD UNA SINTOMATOLOGIA SPECIFICA. • • • STRAIN VIRALI DEL POTATO VIRUS Y INDUCONO SINTOMATOLOGIE DIFFERENTI IN POMODORO I DUE ISOLATI MOSTRANO ELEVATISSIMA SIMILARITÀ (AA 97% NT 91 %) SONO VIRUS AD RNA+ A SINGOLA ELICA La nostra ipotesi è che i diversi sintomi osservati siano dovuti a meccanismi di interferenza ad RNA mediata da piccoli RNA prodotti in fase di replicazione del virus SVILUPPO DI UN ALGORTMO PER L’ANALISI DEI GENOMI VIRALI E LA SELEZIONE DI SON41 GAGCTTATATCGAATCGTAGCTAGTAGATCGGAGCTTATATCGA PVYCto GAGCTTATATCGAATCGTAGCTAGTGGATCGGAGCTTATATCGA ………………….. TTATATCGAATCGTAGCTAGTG ………………….….TATATCGAATCGTAGCTAGTGG ……………………... ATATCGAATCGTAGCTAGTGGA …………………….……TATCGAATCGTAGCTAGTGGAT VSIRNA CARATTERISTICI PER I DUE ISOLATI
  8. 8. ANALYSIS DI RICERCA DI TARGET SUL TRASCRITTOMA DI POMODORO (BLAST RNAHYBRID )CI HA PERMESSO D’INDIVIDUARE GENI TARGET DELL’ISOLATO PVYCTO RANDFOLD È STATO IMPIEGATO PER IDENTIFICARE STRUTTURE SECONDARIE IN REGIONI LIMITROFE AI VSIRNAS IDENTIFICATI NELL’ANALISI IN SILICO. E’ STATO POSSIBILE INDIVIDUARE REGIONI DEL GENOMA VIRALE CON STRUTTURE SECONDARIE T-LIKE O MIRNA-LIKE POTENZIALMENTE FUNZIONALI. POSSIBILI "PUNTI CALDI" DI ACCUMULO VSIRNAS. A) GENOMA PVY, FRECCE: HOT-SPOT SPECIFICI PER PVYCTO, B) FBP2 E ANAC74, SONO FATTORI DI TRASCRIZIONE COINVOLTI RISPETTIVAMENTE NELLO SVILUPPO FIORALE E FOGLIARE IN PIANTE DI POMODORO. QUESTI GENI SONO STATI SCELTI PER GLI ANALISI DI ESPRESSIONE. ENTRAMBI GENI PRESENTANO UNA RIDUZIONE DEI LIVELLI DI ACCUMULO DELL’MRNA IN PIANTE INFETTE DA PVYC-TO IN CONFRONTO A PVY-SON41. LA QUANTITÀ RELATIVA (RQ) DEL MRNA BERSAGLIO È STATO ANALIZZATO MEDIANTE RT-QPCR, E LA LORO ESPRESSIONE È STATA NORMALIZZATA CON L’UBIQUITINA3. OGNI COLONNA RAPPRESENTA I VALORI MEDI DI TRE REPLICHE BIOLOGICHE.
  9. 9. http://eco.igv.cnr.it/igvdb/web IL MEDITERRANEAN GERMPLASM DATABASE CONTIENE INFORMAZIONI DI “PASSAPORTO” RELATIVE AD 56 MILA ACCESSIONI DI GERMOPLASMA APPARTENENTI A 700 SPECIE. IL DATABASE INTEGRA DATI RELATIVI AD ACCESSIONI DI GRAMINACEAE DUPLICATI PRESSO L’USDA (US DEPARTIMENT OF AGRICURTURE ). LA PUBBLICAZIONE DEI DATI RELATIVI AD SPECIE VEGETALI DI INTERESSE AGRICOLO È UNO DEI REQUISITI RICHIESTI PER L’ADESIONE AL TRATTATO INTERNAZIONALE FAO PER LE RISORSE GENETICHE.
  10. 10. 10
  11. 11. BioGenRes E’ un idea nata all’interno del dipartimento Scienze Bio-Agroalimentari, che ha come obbiettivo il censimento all’interno del CNR, delle risorse genetiche disponibili 14 Mila micro 43 Mila animali 106 Mila piante BioGenRes contiene al momento vi sono 11 Istituti e 41 collezioni censite Interfaccia di Ricerca 11
  12. 12. Istituto di Bioscienze e BioRisorse STUDI DI ESPRESSIONE DI MIRNA IN DATI DI SEQUENZIAMENTO E SEQUENZIAMENTO DEL CLOROPLASTO DOMENICO DE PAOLA, PASQUALE LUCA CURCI, GABRIELLA SONNANTE IBBR-BARI DATABASE BIODIVERSITÀ: MEDITERRANEAN GERMPLASM DATABASE E BIOGENRES FLAVIO LICCIULLI, CNR- ITB-BARI, FLAVIA PIZZI CNR-IBBA-MILANO ANTONIO LOGRIECO, ANTONELLA SUSCA CNR-ISPA-BARI ANTONIO TURI, GG VENDRAMIN CNR – IBBR-BARI OIDIO E GENI MLO STEFANO PAVAN UNIBA (DIPARTIMENTO DI SCIENZE DEL SUOLO, DELLA PIANTA E DEGLI ALIMENTI) MICHELA APPIANO WAGENINGEN UR PLANT BREEDING, WAGENINGEN UNIVERSITY & RESEARCH CENTRE, WAGENINGEN GISELLA SCHIAVULLI CNR – IBBR-BARI RNA VIRUS E VIRNA FABRIZIO CILLO, CNR – IVV-BARI TANIA TECCE UNIBA Grazie per il cortese interesse MARIELLA FINETTI SIALER CNR –IBBR-BARI 12

×