Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Upcoming SlideShare
Umgang mit Halal Speisen
Download to read offline and view in fullscreen.



Download to read offline

Floquet bio

Download to read offline

Related Audiobooks

Free with a 30 day trial from Scribd

See all
  • Be the first to like this

Floquet bio

  1. 1. L’albinisme del Floquet de NeuIntroduccióEl Floquet de Neu va ser capturat lany 1966 a Guinea Equatorial quan nomésera un petit goril·la daproximadament 2 anys dedat. El seu cabell era blanc, laseva pell rosada i sense pigues i tenia els ulls blaus. Quan va arribar al Zoo deBarcelona se li va fer un examen dermatològic i biòpsies de la seva pell, on esva trobar que presentava les característiques pròpies de lalbinisme oculocutanitipus IA (OCA1A).OMIM ® - Online Mendelian Inheritance in Man (Malalties MendelianesHumanes).A la base de dades OMIM hem trobat sis gens mandelians responsables del’albinisme: OCA2 OCA1B OCA1A OCA3 OA1 OCA41: #203200. ALBINISM, OCULOCUTANEOUS, TYPE II; OCA2 GeneTests, Links ALBINISM, BROWN OCULOCUTANEOUS, INCLUDED; BOCA, INCLUDED Gene map locus 16q24.3, 15q11.2-q12 #606952. ALBINISM, OCULOCUTANEOUS, TYPE IB; OCA1B GeneTests, Links2: ALBINISM, OCULOCUTANEOUS, TYPE I, TEMPERATURE-SENSITIVE, INCLUDED Gene map locus 11q14-q21 #203100. ALBINISM, OCULOCUTANEOUS, TYPE IA; OCA1A GeneTests, Links3: Gene map locus 11q14-q21 #203290. ALBINISM, OCULOCUTANEOUS, TYPE III; OCA3 GeneTests, Links4: Gene map locus 9p23
  2. 2. 300650. ALBINISM, OCULAR, WITH LATE-ONSET SENSORINEURAL Links5: DEAFNESS; OASD Gene map locus Xp22.3 #300500. ALBINISM, OCULAR, TYPE I; OA1 GeneTests, Links6: Gene map locus Xp22.3 #606574. ALBINISM, OCULOCUTANEOUS, TYPE IV; GeneTests, Links7: OCA4 Gene map locus 5p13.3 a. Quin és el gen responsable d’aquesta malaltia? b. En quin cromossoma es troba? c. És d’herència autosòmica o lligada al sexe? d. Quants canvis de nucleòtid hi ha entre els dos goril·les? e. Quans canvis d’aminoàcids hi ha entre els dos goril·les? f. Per què hi ha sempre menys canvis d’aminoàcids que de nucleòtids? g. El Floquet té alguna mutació en la regió codificant d’aquest gen que expliqui per què l’enzim no és actiu en la seva pell? h. Com expliques que el Floquet de Neu sigui albí doncs?a) El gen responsable és l’OCA1A.b) Es troba en el cromossoma 11.c) En el cas del floquet de neu, parlem d’herència autosòmics. Tot i això algunstipus d’albinisme van lligats al sexe.d) El gen del floquet de neu és idèntic que el gen d’un gorila normal.Sorprenentment, la informació genètica és igual. Per això podem concloure quela diferència està en algun regulador del genoma del Floquet de Neu quebloqueja la transcripció.
  3. 3. Exemple:AGAAACATCTTCGATTTGAGTGCCCCAGAGAAGGACAAATTTTTTGCCTACCTCACTTTA 420Floquet_genAGAAACATCTTCGATTTGAGTGCCCCAGAGAAGGACAAATTTTTTGCCTACCTCACTTTA 420************************************************************Gorilla_gorilla_genGCAAAGCATACCATCAGCTCAGACTACGTCATCCCCATAGGGACCTATGGCCAAATGAAA 480Floquet_genGCAAAGCATACCATCAGCTCAGACTACGTCATCCCCATAGGGACCTATGGCCAAATGAAA 480************************************************************Gorilla_gorilla_genAATGGATCAACACCCATGTTTAACGACATCAATATTTATGACCTCTTTGTCTGGATGCAT 540Floquet_genAATGGATCAACACCCATGTTTAACGACATCAATATTTATGACCTCTTTGTCTGGATGCAT 540************************************************************Gorilla_gorilla_genTATTATGTGTCAATGGATGCACTGCTTGGGGGATCTGAAATCTGGAGAGACATTGATTTT 600Floquet_genTATTATGTGTCAATGGATGCACTGCTTGGGGGATCTGAAATCTGGAGAGACATTGATTTT 600************************************************************e) No hi ha canvis en els aminoàcids.f) Perquè com que l’últim nucleòtid és menys important que els altres es potproduir un canvi en aquest i no afectar l’aminoàcid.g) El Floquet no té cap mutació en la regió codificant, sinó queté algunproblema amb la síntesi de la proteïna que li provoca l’albinisme.h) Perquè en el moment de nèixer es va rpoduir una mutació que va probocarque no pogues sintetitzar adequadament la proteïna que regula l’albinise.


Total views


On Slideshare


From embeds


Number of embeds










