Meeting the challenges of miRNA research:
microRNA Biogenesis, Function, and Analysis

Jonathan M. Shaffer, Ph.D.
Jonathan...
Welcome to the three-part webinar series on
miRNA and its role in human disease

Webinar 1 :
Date:
Speaker:

Webinar 2 :
D...
Agenda

miRNA Background
miRNA Genomics
miRNA in Disease
miRNA Isolation Technologies
miRNA Quantification Technologies
mi...
RNA interference: A natural phenomenon
Discovery tool, potential diagnostic, potential therapeutic
25000

10000

Sequences...
Canonical pathway of microRNA (miRNA) biogenesis

Transcribed by RNA Polymerase II as
a long primary transcript (pri-miRNA...
How do miRNAs interact with mRNAs?
Basis of miRNA-mRNA interaction

Seed region: nucleotides 2-8 in 5’ region of miRNA
Mos...
How to determine miRNA-mRNA interactions
Algorithms for predicting miRNA-mRNA interaction

Target Prediction is based on:
...
How to determine miRNA-mRNA interactions
Experimental techniques

miRNA Target Screening

.

Gene expression analysis (inf...
Isolation

Quantification

Functionalization

miRNA Genomics
Generating Diversity in the miRNome

-9-

Sample & Assay Tech...
miRNA genomic structure

Intergenic miRNA genes: either monocistronic or polycistronic with a common promoter
Intronic miR...
Multiple loci can generate the same mature miRNA
Biogenesis creates incredible diversity
Stem Loop

CHR

Overlapping trans...
Post-transcriptional modification of miRNA
Generation of miRNA diversity by processing and ADAR editing
ADAR: adenosine de...
Isolation

Quantification

Functionalization

miRNA in Disease

- 13 -

Sample & Assay Technologies
Potential events that disrupt normal miRNA activity
Disruption of miRNA-mRNA interaction
Altered Transcription

microRNA G...
A look back 10 years
Unique miRNA signatures are found in human cancer

miRNAs located in genomic regions amplified in can...
Isolation

Quantification

Functionalization

miRNA Isolation Technologies

- 16 -

Sample & Assay Technologies
miRNeasy Kits: Mini, Micro
Flexible protocols: total RNA or enrichment of miRNA

High quality, pure RNA

.

Suitable for s...
miRNeasy FFPE Kit
Enables purification of high quality total RNA from archival samples

500 million FFPE tissues are archi...
miRNeasy Serum/Plasma Kit
Industry standard: Purification of miRNA from serum and plasma

For purification of circulating ...
Isolation

Quantification

Functionalization

miRNA Quantification
Technologies

- 20 -

Sample & Assay Technologies
Next generation miScript PCR System
miRNA Profiling Redefined

1.

miScript II RT Kit
HiFlex Buffer: Unparalleled flexibil...
miScript PCR System
miRNA Profiling and Quantification Re-defined

miScript II RT
HiFlex Buffer

HiSpec Buffer

What it al...
When should you use HiFlex Buffer or HiSpec Buffer?

HiFlex Buffer

HiSpec Buffer

Should be used to prepare cDNA for
the ...
miScript PCR System
Reverse Transcription & PCR
HiFlex Buffer

HiSpec Buffer

miScript II Reverse Transcription Procedure
...
miScript II RT: Exceptional Linearity
Linear over 6 logs of input RNA

HiFlex Buffer

HiSpec Buffer

40

40

miR-16

miR-1...
miScript II PCR: Exceptional Sensitivity
Detection of 10 copies to >106 copies of miRNA. e.g. miR-21

HiFlex Buffer

HiSpe...
miScript PCR System: Exceptional Specificity
Excellent discrimination between Let-7 family isoforms

HiFlex Buffer
Relativ...
Isolation

Quantification

Functionalization

miRNA Profiling
Technologies

- 28 -

Sample & Assay Technologies
miRNA expression profiling applications

Mechanisms of gene regulation
Developmental biology
Novel miRNA discovery
Studyin...
miRNome miScript miRNA PCR Arrays
Redefining miRNA expression profiling

miRNome Arrays

Benefits of miRNome Arrays

Human...
Focused miScript miRNA PCR Arrays
Redefining miRNA expression profiling

Benefits of Focused Arrays

Focused Arrays
miFind...
New! High Content (HC) miScript miRNA PCR Arrays
An economical alternative to whole miRNome expression profiling
miFinder ...
miScript miRNA PCR Arrays
Pathway-Focused: 84 miRNAs + 12 Controls

84 miRNAs

Cel-miR-39

SNORD61; SNORD68; SNORD72
SNORD...
miScript miRNA PCR Arrays
Available in 96-well, 384-well, and Rotor-Disc 100 Formats
96-well

384-well

384-well (4 x 96)
...
miScript miRNA PCR Arrays
Compatible with a wide range of instruments

96-Well: 7000, 7300, 7500, 7700, 7900HT, ViiA 7
FAS...
miScript miRNA PCR Arrays
QIAGEN PCR Array Service Core

Send your samples and receive results!

Total RNA Isolation: miRN...
miScript miRNA PCR Arrays
Rapid Workflow = Robust and Reproducible Performance
1st Time Array User

2 minutes

30
Mean CT:...
miScript miRNA PCR Arrays
Rapid Workflow = Robust and Reproducible Performance
Two Operators
1 hour
HiSpec Buffer

30

2 m...
miRNA expression profiling using FFPE samples
Normal Lung

40

36

32

32

28

28

24

24

CT Value

36

CT Value

Lung Tu...
miRNA expression profiling using FFPE samples (cont.)
2-∆CT: Tumor vs. Normal

- ∆CT

: Tumor Lung FFPE Tissue

1.E+ 04
1....
miRNA expression profiling using serum samples
Serum & Plasma 384HC
2-∆CT: Cancer vs. Normal

Fold-Regulation: Cancer vs. ...
miRNome expression profiling using HCT 116 cells
Scatter Plot

Volcano Plot

1.E+ 02

0.00001

0.0001

1.E+ 00
1.E-01

p V...
Isolation

Quantification

Functionalization

Limiting Samples
Body fluids
FFPE samples
LCM samples
Flow-sorted cells
Circ...
miScript PreAMP PCR Kit
Straightforward protocol, reproducible and robust amplification

Mean CT: O per ator 2

30

25

20...
miScript PreAMP: miRNA expression profiling from limiting FFPE samples
Excellent results with a fraction of the input
15
1...
miRNA expression profiling using limited serum samples
Using the Serum & Plasma 384HC
2-∆CT: Colorectal Cancer vs. Normal
...
Let miScript drive your miRNA expression profiling!

Sample
1 hour

2 minutes

2 hours

Results!

15 minutes

- 47 -

Samp...
Isolation

Quantification

Functionalization

miRNA Functionalization
Technologies

- 48 -

Sample & Assay Technologies
Manipulating miRNA function

- 49 -

Sample & Assay Technologies
miScript miRNA Mimics act just like endogenous miRNA

.

Features of miScript miRNA Mimics:
Double-stranded RNA oligonucle...
miScript miRNA Inhibitors block endogenous miRNA activity

.

Features of miScript miRNA Inhibitors:
Single-stranded, chem...
miScript miRNA Mimic & Inhibitor controls

Mimic
negative control

AllStars Negative Control siRNA
No homology to any mamm...
New product! RT2 Profiler miRNA Targets PCR Array
Benefits:
Assist miRNA functional analysis
Follow up on miRNA expression...
www.sabiosciences.com/mirna_pcr_array.php
miScript miRNA PCR Arrays

miRNA Overview
miScript PCR System
miScript miRNA PCR...
www.qiagen.com/GeneGlobe
Single Primer Assays

- 55 -

Sample & Assay Technologies
Your microRNA workflow, from sample to results!

miRNeasy FFPE Kit
miRNeasy Serum / Plasma Kit

miScript II RT Kit and Pre...
Upcoming webinars
Webinar 2 : microRNA expression analysis:
From experimental design
to data analysis
Date:

December 11, ...
Free or Discounted miScript miRNA PCR Arrays!

Technical Support Contact Information
M-F, 8am to 6pm EST (US)
Direct phone...
Questions?

Thank you!

Jonathan Shaffer
Jonathan.Shaffer@qiagen.com

For up-to-date licensing information and product-spe...
Upcoming SlideShare
Loading in …5
×

Mi rna series i-dec 2012

742 views

Published on

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
742
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
14
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Mi rna series i-dec 2012

  1. 1. Meeting the challenges of miRNA research: microRNA Biogenesis, Function, and Analysis Jonathan M. Shaffer, Ph.D. Jonathan.Shaffer@qiagen.com microRNA Technologies, R&D Americas The products described in this webinar are intended for molecular biology applications. These products are not intended for the diagnosis, prevention or treatment of disease. Sample & Assay Technologies
  2. 2. Welcome to the three-part webinar series on miRNA and its role in human disease Webinar 1 : Date: Speaker: Webinar 2 : Date: Speaker: Webinar 3 : Date: Speaker: Meeting the challenges of miRNA research: An introduction to microRNA biogenesis, function, and analysis December 4, 2012 Jonathan Shaffer, Ph.D. Advanced microRNA expression analysis: From experimental design through data analysis December 11, 2012 Jonathan Shaffer, Ph.D. Profiling miRNA expression in Cells, FFPE, and serum: On the road to biomarker development December 18, 2012 Eric Lader, Ph.D. -2- Sample & Assay Technologies
  3. 3. Agenda miRNA Background miRNA Genomics miRNA in Disease miRNA Isolation Technologies miRNA Quantification Technologies miRNA Profiling Technologies miRNA Functionalization Technologies New product released! -3- Sample & Assay Technologies
  4. 4. RNA interference: A natural phenomenon Discovery tool, potential diagnostic, potential therapeutic 25000 10000 Sequences (m iRBase) 20000 8000 7000 15000 6000 5000 10000 4000 3000 5000 2000 Refer ences (Highwir e + PubMed) 9000 1000 0 0 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 Year Virtually every publication includes characterization by quantification. May 26, 2003 Changes in miRNA can be correlated with gene expression changes in development, differentiation, signal transduction, infection, aging, and disease. -4- Sample & Assay Technologies
  5. 5. Canonical pathway of microRNA (miRNA) biogenesis Transcribed by RNA Polymerase II as a long primary transcript (pri-miRNAs), which may contain more than one miRNA. In the nucleus, pri-miRNAs are processed to hairpin-like pre-miRNAs by RNAse III-like enzyme Drosha. Pre-miRNAs are then exported to the cytosol by Exportin 5. In the cytosol RNAse III-like Dicer processes these precursors to mature miRNAs. These miRNAs are incorporated in RISC. miRNAs with high homology to the target mRNA lead to mRNA cleavage. miRNAs with imperfect base pairing to the target mRNA lead to translational repression and/or mRNA degradation. -5- Sample & Assay Technologies
  6. 6. How do miRNAs interact with mRNAs? Basis of miRNA-mRNA interaction Seed region: nucleotides 2-8 in 5’ region of miRNA Most evolutionary conserved miRNA region Most frequently complementary to target 3’-UTRs Often sufficient to confer mRNA recognition Beyond the seed region 3’ end also contributes (extensive pairing is rare) Some cases: central 11-12 continuous base pairs Result of interaction Suppression of gene expression Rare cases: increase gene expression References Grimson, A., et al, Mol. Cell 2007, 27, 91-105 Image From Bartel, D.P., Cell 2009, 136, 215-233 Guo, H., et al, Nature 2010, 466, 835-840 Thomson, D.W., et al, Nucleic Acids Res 2011, 1-9 -6- Sample & Assay Technologies
  7. 7. How to determine miRNA-mRNA interactions Algorithms for predicting miRNA-mRNA interaction Target Prediction is based on: Bioinformatics . Pitfalls of using prediction algorithms: Large number of candidate mRNAs for a given miRNA May not incorporate all miRNA targeting possibilities Different algorithms produce different target lists Potential for false positive rate of prediction . Seed region match Position in 3’ UTR Cross species conservation Central sequence homology Wet lab research Empirical evidence from microarrays Reporter systems Prediction Algorithm Website TargetScan http://www.targetscan.org/ Pictar http://pictar.mdc-berlin.de/ MicroCosm Targets http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/ DIANA http://diana.cslab.ece.ntua.gr/microT/ miRANDA http://www.microrna.org/microrna/home.do TarBase (experimentally supported) http://diana.cslab.ece.ntua.gr/tarbase/ -7- Sample & Assay Technologies
  8. 8. How to determine miRNA-mRNA interactions Experimental techniques miRNA Target Screening . Gene expression analysis (inferred targets) RNA-seq Microarrays qPCR Immunoprecipitation (direct targets) HITS-CLIP PAR-CLIP Biotin tagged miRNA Gene-Specific Validation . qPCR Luciferase reporter assays Western blot 5’ rapid identification of cDNA ends (5’ RLM-RACE) Other techniques . Parallel analysis of RNA ends (modified 5’ RLM-RACE) Reverse transcription of targets Image From Chi, S.W., et al, Nature 2009, 13, 479-486 -8- Sample & Assay Technologies
  9. 9. Isolation Quantification Functionalization miRNA Genomics Generating Diversity in the miRNome -9- Sample & Assay Technologies
  10. 10. miRNA genomic structure Intergenic miRNA genes: either monocistronic or polycistronic with a common promoter Intronic miRNA genes: present in the introns of protein coding or noncoding genes, can also be in clusters, transcribed by the host gene promoter Exonic miRNAs genes: rare and often overlap an exon and an intron of a noncoding gene miRNAs can be transcribed from the negative strand within or near a protein coding gene - 10 - Sample & Assay Technologies
  11. 11. Multiple loci can generate the same mature miRNA Biogenesis creates incredible diversity Stem Loop CHR Overlapping transcripts CHR: Coordinates (GRCh37) 1302-1 12 intergenic 12: 113132839-113132981 [-] 1302-3 2 intergenic 2: 114340536-114340673 [-] 1302-7 8 intergenic 8: 142867603-142867674 [-] 1302-10 15 intergenic 15: 102500662-102500799 [-] 1302-11 19 intergenic 19: 71973-72110 [+] 1302-2 1 intronic Non protein coding 1: 30366-30503 [+] sense 1302-4 2 intronic Non protein coding 2: 208133999-208134148 [-] 1302-9 9 Non protein coding 9: 30144-30281 [+]; Sense 1302-5 20 intronic Protein coding/FAM65C; intron 4 1302-6 7 intronic Protein coding/HDAC9; intron 1 7: 18166843-18166932 [-] ; Antisense 1302-8 9 intronic Protein coding/ch9orf174 9: 100125836-100125963 [-]; Antisense 20: 49231173-49231322 [-]; Sense Mature-miR-1302: UUGGGACAUACUUAUGCUAAA www.mirbase.org - 11 - Sample & Assay Technologies
  12. 12. Post-transcriptional modification of miRNA Generation of miRNA diversity by processing and ADAR editing ADAR: adenosine deaminase, RNA specific A-> I destabilizes dsRNA Deep sequencing of hsa-miR-21-5p A I ADAR Pri-miRNA DROSHA Processing Block A I Pre-miRNA Exportin ADAR ADAR www.mirbase.org - 12 - A I A I DICER Processing Block Change in miRNA seed Kawahara, et. al (2007) Science. 315 (5815):1137-40 Sample & Assay Technologies
  13. 13. Isolation Quantification Functionalization miRNA in Disease - 13 - Sample & Assay Technologies
  14. 14. Potential events that disrupt normal miRNA activity Disruption of miRNA-mRNA interaction Altered Transcription microRNA Gene Pri-miRNA Methylation Histone Modification Genomic Instability Amplification/Deletion Translocation Drosha-DGCR8 Transcription Factor Insertional Mutagenesis Pre-miRNA Drosha Processing Exportin DICER-TRBP Dicer Processing mature miRNA Ago Loss of miRNA Binding Site in target SNP or Mutation miRNP Alternative Splicing Target Transcript - 14 - Loss/Change of 3’-UTR Sample & Assay Technologies
  15. 15. A look back 10 years Unique miRNA signatures are found in human cancer miRNAs located in genomic regions amplified in cancers (e.g. miR-17-92 cluster) can function as oncogenes, whereas miRNAs located in portions of chromosomes deleted in cancers (e.g. miR-15a-miR-16-1 cluster) can function as tumor suppressors. Abnormal expression of miRNAs has been found in both solid and hematopoietic tumors. miRNA expression fingerprints correlate with clinical and biological characteristics of tumors, including tissue type, differentiation, aggression and response to therapy. In the last 10 years, a substantial number of studies and reviews have associated the presence of various miRNAs with cell proliferation, resistance to apoptosis, invasiveness, and differentiation in cancer cells. - 15 - Sample & Assay Technologies
  16. 16. Isolation Quantification Functionalization miRNA Isolation Technologies - 16 - Sample & Assay Technologies
  17. 17. miRNeasy Kits: Mini, Micro Flexible protocols: total RNA or enrichment of miRNA High quality, pure RNA . Suitable for sensitive downstream applications Rapid procedure . Streamlined protocol for lowthroughput or 96-well formats Automated on QIAcube Effective purification of total RNA From a broad range of cells & tissues Efficient enrichment of microRNAs . miRNA enriched fraction & total RNA separately Co-purification of miRNA & total RNA - 17 - Sample & Assay Technologies
  18. 18. miRNeasy FFPE Kit Enables purification of high quality total RNA from archival samples 500 million FFPE tissues are archived! Tissue banks, pathology labs, biomedical research labs Current Isolation Methods: Compromised quality and yield Heavily fragmented Cross-linking by formaldehyde interferes with RT Current procedures may not purify all usable RNA, may increase fragmentation, are often ineffective in breaking up cross-links miRNeasy FFPE Kit: High quality, pure total RNA . Novel method prevents cross-linked RNA from blocking downstream applications Optimized lysis buffer with proteinase K RNeasy MinElute for small elution volume - 18 - Sample & Assay Technologies
  19. 19. miRNeasy Serum/Plasma Kit Industry standard: Purification of miRNA from serum and plasma For purification of circulating RNA from animal and human plasma and serum Includes synthetic RNA control assay for normalization Clarified plasma or serum Minimal elution volume (14 µl) High-purity RNA suitable for all downstream applications miScript RT: up to 10 µl eluate for cDNA synthesis One RT enough for 6, 384-well plates Easy, robust procedures Plasma QIAzol Bind Serum Wash Elute Manual or Automated on QIAcube Automatable protocol - 19 - Sample & Assay Technologies
  20. 20. Isolation Quantification Functionalization miRNA Quantification Technologies - 20 - Sample & Assay Technologies
  21. 21. Next generation miScript PCR System miRNA Profiling Redefined 1. miScript II RT Kit HiFlex Buffer: Unparalleled flexibility for quantify miRNA and mRNA quantification from a single cDNA preparation HiSpec Buffer: Unmatched specificity for mature miRNA profiling 2. miScript miRNA PCR Arrays miRNome Pathway-focused 3. miScript PreAMP Kit: New! Optional step for small or precious samples Full miRNome profiling from as little as 1 ng RNA 4. Assays miScript Primer Assays miScript Precursor Assays QuantiTect Primer Assays 5. miScript SYBR Green PCR Kit QuantiTect SYBR Green PCR MM Universal Primer 6. miScript miRNA PCR Array data analysis software Straightforward, free data analysis - 21 - Sample & Assay Technologies
  22. 22. miScript PCR System miRNA Profiling and Quantification Re-defined miScript II RT HiFlex Buffer HiSpec Buffer What it allows What it allows Specific detection of Mature miRNAs Flexible detection of all RNA molecules - Mature miRNAs - Precursor miRNAs - mRNAs - Other non coding RNAs When to use it When to use it When mRNAs/precursors/other long non coding RNAs quantified in parallel with mature miRNAs Only mature miRNA detection is desired - Single miScript Primer Assays - miScript miRNA PCR Arrays - miRNome miScript miRNA PCR Arrays HiSpec chemistry is analogous to the RT2 miRNA First Strand cDNA Synthesis Kit chemistry - 22 - Sample & Assay Technologies
  23. 23. When should you use HiFlex Buffer or HiSpec Buffer? HiFlex Buffer HiSpec Buffer Should be used to prepare cDNA for the quantification of both mature microRNAs & mRNAs using appropriate primer assays. Should be used to prepare cDNA for mature miRNA quantification. Long RNAs, such as mRNAs, are not converted into cDNA. HiSpec is the optimized and exclusive buffer for mature miRNA profiling with miScript miRNA PCR Arrays. 30 25 25 Mean CT 35 30 20 15 20 15 - 23 - miR-25 miR-21 miR-16 Let-7a MAPK1 CDK1 PPIA GAPDH miR-25 miR-21 0 miR-16 0 Let-7a 5 MAPK1 5 CDK1 10 PPIA 10 GAPDH M ean C T 35 Sample & Assay Technologies
  24. 24. miScript PCR System Reverse Transcription & PCR HiFlex Buffer HiSpec Buffer miScript II Reverse Transcription Procedure Mix RNA, 5x miScript HiFlex or HiSpec Buffer, RNase-free water, 10x Nucleics Mix, and miScript Reverse Transcriptase Mix Use the cDNA to set up real-time PCR reactions Incubate at 37°C for 60 min - 24 - Incubate at 95°C for 5 min Sample & Assay Technologies
  25. 25. miScript II RT: Exceptional Linearity Linear over 6 logs of input RNA HiFlex Buffer HiSpec Buffer 40 40 miR-16 miR-16 miR-20a 35 Linear (miR-20a) miR-21 Linear (miR-16) Linear (miR-20a) 30 Linear (miR-21) Mean CT Mean CT 30 miR-20a 35 miR-21 Linear (miR-16) 25 Linear (miR-21) 25 20 20 15 15 10 10 -2 -1 0 1 2 3 4 -2 Log (ng) of RNA in cDNA synthesis using the HiFlex Buffer -1 0 1 2 3 4 Log (ng) of RNA in cDNA synthesis using the HiSpec Buffer - 25 - Sample & Assay Technologies
  26. 26. miScript II PCR: Exceptional Sensitivity Detection of 10 copies to >106 copies of miRNA. e.g. miR-21 HiFlex Buffer HiSpec Buffer 32 32 miR-21 Linear (miR-21) miR-21 Linear (miR-21) 28 Mean CT Mean CT 28 24 24 20 20 16 16 12 12 1 2 3 4 5 6 1 Log copy num ber of m iRNA using the HiFlex Buffer 2 3 4 5 6 Log copy num ber of miRNA using the HiSpec Buffer - 26 - Sample & Assay Technologies
  27. 27. miScript PCR System: Exceptional Specificity Excellent discrimination between Let-7 family isoforms HiFlex Buffer Relative detection (as % of perfect match) miScript Primer Assay Used cDNA used in PCR Let-7b Let-7c miR-98 Let-7d Let-7e Let-7a Let-7f Let-7g Let-7i Let-7b 100.0 1.8 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Let-7c 0.5 100.0 0.0 0.0 1.0 0.1 0.0 0.0 0.0 miR-98 0.0 0.2 100.0 0.1 0.0 0.1 0.0 0.0 0.1 Let-7d 0.1 0.0 0.0 100.0 0.0 0.4 0.0 0.0 0.0 Let-7e 0.1 0.0 0.0 0.0 100.0 0.2 0.0 0.0 0.0 Let-7a 0.1 0.6 0.0 0.5 3.9 100.0 0.1 0.0 0.0 Let-7f 0.6 0.1 0.0 0.1 0.0 1.1 100.0 0.1 0.1 Let-7g 0.6 0.2 0.0 0.1 0.0 0.0 0.0 100.0 0.2 Let-7i 0.1 0.0 0.0 0.0 0.0 0.0 0.0 0.1 100.0 - 27 - Sample & Assay Technologies
  28. 28. Isolation Quantification Functionalization miRNA Profiling Technologies - 28 - Sample & Assay Technologies
  29. 29. miRNA expression profiling applications Mechanisms of gene regulation Developmental biology Novel miRNA discovery Studying miRNA–mRNA and miRNA–protein interactions Integrative analyses of miRNAs in the context of gene regulatory networks Biomarkers Tissue-based miRNA biomarkers Tissues of unknown origin Circulating biomarkers Forensics From Pritchard, C.C., et al, Nature Rev. Genet 2012, 13, 358-369 - 29 - Sample & Assay Technologies
  30. 30. miRNome miScript miRNA PCR Arrays Redefining miRNA expression profiling miRNome Arrays Benefits of miRNome Arrays Human Mouse Rat Dog Rhesus macaque Species 100% validated assays Each assay is bench validated Each array is quality controlled Leading miRNome coverage Assays (miRBase V16) Human Mouse 940 Rat 653 Dog 277 Rhesus macaque Customizable 1066 469 (V18) miRBase V17 and V18 assays are available! Contact us if you are interest in a different species! - 30 - Sample & Assay Technologies
  31. 31. Focused miScript miRNA PCR Arrays Redefining miRNA expression profiling Benefits of Focused Arrays Focused Arrays miFinder Cancer PathwayFinder Brain Cancer Breast Cancer Ovarian Cancer Apoptosis – New! Cell Differentiation & Development Immunopathology Inflammatory Response & Autoimmunity Diabetes – New! Neurological Development & Disease T-Cell & B-Cell Activation – New! Prostate Cancer – New! Cardiovascular Disease – New! Serum & Plasma 100% validated assays Each assay is bench validated Each array is quality controlled Biological relevant and up-to-date Customizable Contact us if you are interest in a different species! - 31 - Sample & Assay Technologies
  32. 32. New! High Content (HC) miScript miRNA PCR Arrays An economical alternative to whole miRNome expression profiling miFinder 384HC Profiles the expression of the 372 most abundantly expressed and best characterized miRNAs in miRBase. Serum & Plasma 384HC Profiles the expression of 372 miRNAs detectable in serum and plasma using the miScript PCR System. Content is derived from in-house miRNome (miRBase V18) profiling of more than 100 normal and disease serum and plasma samples. New! Cancer PathwayFinder 384HC - 32 - Sample & Assay Technologies
  33. 33. miScript miRNA PCR Arrays Pathway-Focused: 84 miRNAs + 12 Controls 84 miRNAs Cel-miR-39 SNORD61; SNORD68; SNORD72 SNORD95; SNORD96A; RNU6-2 miRTC PPC Spike in Control miScript PCR Controls for Normalization RT Control PCR Control Cel-miR-39 Alternative data normalization using exogenously spiked Syn-cel-miR-39 miScript miRNA Mimic miScript PCR Controls Data normalization using the ∆∆CT method of relative quantification miRNA reverse-transcription control (miRTC) Assessment of reverse transcription performance Positive PCR control (PPC) Assessment of PCR performance - 33 - Sample & Assay Technologies
  34. 34. miScript miRNA PCR Arrays Available in 96-well, 384-well, and Rotor-Disc 100 Formats 96-well 384-well 384-well (4 x 96) Rotor-Disc 100 - 34 - Sample & Assay Technologies
  35. 35. miScript miRNA PCR Arrays Compatible with a wide range of instruments 96-Well: 7000, 7300, 7500, 7700, 7900HT, ViiA 7 FAST 96-Well: 7500, 7900HT, Step One Plus, ViiA 7 FAST 384-Well: 7900HT, ViiA 7 iCycler, MyiQ, MyiQ2, iQ5, CFX96, CFX384 Opticon, Opticon 2, Chromo 4 Mastercycler ep realplex 2/2S/4/4S LightCycler 480 Mx3000p, Mx3005p, Mx4000p TP-800 RotorGene Q - 35 - Sample & Assay Technologies
  36. 36. miScript miRNA PCR Arrays QIAGEN PCR Array Service Core Send your samples and receive results! Total RNA Isolation: miRNeasy Kits Reverse Transcription: miScript II RT Kit qPCR: miScript miRNA PCR Arrays Data analysis included! - 36 - Sample & Assay Technologies
  37. 37. miScript miRNA PCR Arrays Rapid Workflow = Robust and Reproducible Performance 1st Time Array User 2 minutes 30 Mean CT: Biological Replicate 2 1 hour HiSpec Buffer 25 20 y = 1.0075x + 0.2891 2 hours 2 R = 0.989 15 15 20 25 30 Mean CT: Biological Replicate 1 15 minutes - 37 - Total HeLa S3 (miRNeasy) Pellet 1: Frozen June 2010 Pellet 2: Frozen April 2011 HiSpec Buffered cDNA miScript real-time PCR miFinder miScript miRNA PCR Array Sample & Assay Technologies
  38. 38. miScript miRNA PCR Arrays Rapid Workflow = Robust and Reproducible Performance Two Operators 1 hour HiSpec Buffer 30 2 minutes CT: O per ator 2 25 20 15 2 hours y = 0.9994x - 0.1945 2 R = 0.9959 10 10 15 20 25 30 CT: O per ator 1 15 minutes - 38 - Total HeLa S3 (miRNeasy) HiSpec Buffered cDNA miScript real-time PCR miFinder miScript miRNA PCR Array Rotor-Gene Q Sample & Assay Technologies
  39. 39. miRNA expression profiling using FFPE samples Normal Lung 40 36 32 32 28 28 24 24 CT Value 36 CT Value Lung Tumor 40 20 20 16 16 12 12 FFPE Isolation 1 FFPE Isolation 2 8 FFPE Isolation 1 FFPE Isolation 2 8 FFPE Isolation 3 FFPE Isolation 3 4 4 1 1 7 13 19 25 31 37 43 49 55 61 67 73 7 13 19 25 31 37 43 49 55 61 67 73 One 5 µM FFPE section used per FFPE isolation Each isolation is from a different section On average, each isolation provided enough total RNA for: – Two full human miRNome profiles – Ten pathway-focused PCR arrays RT: 125 ng total RNA, HiSpec Buffer qPCR: Human miFinder miScript miRNA PCR Array (0.5 ng cDNA per well) - 39 - Sample & Assay Technologies
  40. 40. miRNA expression profiling using FFPE samples (cont.) 2-∆CT: Tumor vs. Normal - ∆CT : Tumor Lung FFPE Tissue 1.E+ 04 1.E+ 03 1.E+ 02 1.E+ 01 1.E+ 00 1.E-01 1.E-02 2 1.E-03 1.E-04 1.E+ 04 1.E+ 03 1.E+ 02 1.E+ 01 1.E+ 00 1.E-01 1.E-02 1.E-03 1.E-04 2 - ∆CT : Nor m al Lung FFPE Tissue Significant differences exist between the mature miRNA expression levels of the two tissue types ± 2-fold [red lines] used as a cutoff for significance - 40 - Sample & Assay Technologies
  41. 41. miRNA expression profiling using serum samples Serum & Plasma 384HC 2-∆CT: Cancer vs. Normal Fold-Regulation: Cancer vs. Normal 20 Fold-Regulation: Cancer vs. Nor m al 1.E+ 00 1.E-01 1.E-02 1.E-03 2 - ∆CT : Lung Cancer Ser um 1.E+ 01 1.E-04 1.E+ 01 1.E+ 00 1.E-01 1.E-02 1.E-03 1.E-04 2 15 10 5 0 -5 -10 - ∆CT : Nor mal Ser um Workflow 200 µl serum 14 µl total RNA miRNA PCR Array 1.5 µl total RNA, HiSpec Buffer Serum & Plasma 384HC miScript Significant differences exist between the mature miRNA expression levels of the two tissue types ± 3-fold [red lines] used as a cutoff for significance - 41 - Sample & Assay Technologies
  42. 42. miRNome expression profiling using HCT 116 cells Scatter Plot Volcano Plot 1.E+ 02 0.00001 0.0001 1.E+ 00 1.E-01 p Value 2 - ∆CT : Tr eated 1.E+ 01 1.E-02 1.E-03 0.001 0.01 1.E-04 0.1 1.E-05 1.E+ 02 1.E+ 01 1.E+ 00 1.E-01 1.E-02 1.E-03 1.E-04 1.E-05 2 1 -8 - ∆CT : Untr eated -6 -4 -2 0 2 4 6 8 Log 2 (Fold-Regulation) 5-aza-2’-dC irreversibly inhibits DNA methyltransferase driven DNA methylation reactions by incorporating into DNA and covalently binding to the active site of the DNMT. Scatter Plot: Significant differences exist in the mature miRNA expression levels of the two samples that were tested 104 miRNAs were strongly up-regulated in 5-aza-2’-dC treated cells, while 30 were strongly downregulated in 5-aza-2’-dC treated HCT 116 cells. Volcano Plot: When a p Value of 0.05 is applied, the expression up-regulation of 89 of the 104 miRNAs is significant, and the expression down-regulation of 21 of the 30 miRNAs is significant - 42 - Sample & Assay Technologies
  43. 43. Isolation Quantification Functionalization Limiting Samples Body fluids FFPE samples LCM samples Flow-sorted cells Circulating tumor cells Fine needle biopsies - 43 - Sample & Assay Technologies
  44. 44. miScript PreAMP PCR Kit Straightforward protocol, reproducible and robust amplification Mean CT: O per ator 2 30 25 20 y = 0.9973x + 0.2058 2 R = 0.9913 15 15 20 25 30 Mean CT: O per ator 1 Universal reference RNA Two operators Experienced operator First time operator miScript real-time PCR miFinder miScript miRNA PCR Array - 44 - Sample & Assay Technologies
  45. 45. miScript PreAMP: miRNA expression profiling from limiting FFPE samples Excellent results with a fraction of the input 15 13 11 ∆CT: PreAMP 9 7 5 3 1 -1 y = 0.9934x - 0.1457 -3 2 R = 0.9606 -5 -5 -3 -1 1 3 5 7 9 11 13 15 ∆CT: No Pr eAMP Workflow No PreAMP: 250 ng total RNA, HiSpec Buffer Human miRNome miScript miRNA PCR Array (Plate 1) PreAMP: 10 ng total RNA, HiSpec Buffer one-tenth of cDNA, miScript PreAMP preamplified cDNA used for Human miRNome miScript miRNA PCR Array (Plate 1) Excellent correlation, PreAMP vs. No PreAMP Preamplified cDNA provides enough material for more than 2 full human miScript miRNome profiles. Input was only 1 ng of cDNA! - 45 - Sample & Assay Technologies
  46. 46. miRNA expression profiling using limited serum samples Using the Serum & Plasma 384HC 2-∆CT: Colorectal Cancer vs. Normal Reproducibility : Color ectal Cancer Ser um 1.E+ 03 28 24 y = 0.9728x + 0.7671 2 R = 0.9757 CT: Individual RNA Isolation fr om Ser um 2 1.E+ 03 32 1.E+ 02 28 1.E+ 01 24 1.E+ 00 1.E-01 20 1.E+ 00 1.E-01 16 16 1.E+ 01 - ∆CT 20 1.E+ 02 2 CT Mean: 3 RNA Isolations fr om Ser um 32 - ∆CT : Nor m al Ser um Workflow 5 µl serum 14 µl total RNA 2 µl total RNA, HiSpec Buffer one-tenth of cDNA, miScript PreAMP preamplified cDNA (0.07 µl SE) used for Human Serum & Plasma 384HC miScript miRNA PCR Array Conclusion: Starting with only 5 µl of serum, significant differences were detected when colorectal cancer serum was compared to normal serum - 46 - Sample & Assay Technologies
  47. 47. Let miScript drive your miRNA expression profiling! Sample 1 hour 2 minutes 2 hours Results! 15 minutes - 47 - Sample & Assay Technologies
  48. 48. Isolation Quantification Functionalization miRNA Functionalization Technologies - 48 - Sample & Assay Technologies
  49. 49. Manipulating miRNA function - 49 - Sample & Assay Technologies
  50. 50. miScript miRNA Mimics act just like endogenous miRNA . Features of miScript miRNA Mimics: Double-stranded RNA oligonucleotide Functional sequence is the same as the natural mature miRNA Transfection results in inhibition comparable to the endogenous miRNA Stable in culture for up to 72 hours - 50 - Sample & Assay Technologies
  51. 51. miScript miRNA Inhibitors block endogenous miRNA activity . Features of miScript miRNA Inhibitors: Single-stranded, chemically modified RNA oligonucleotide Designed and modified to ensure efficient inhibition of endogenous miRNA Transfection of inhibitor counteracts miRNA-induced silencing Effective for at least 96 hours following transfection - 51 - Sample & Assay Technologies
  52. 52. miScript miRNA Mimic & Inhibitor controls Mimic negative control AllStars Negative Control siRNA No homology to any mammalian gene. Validated for non-effects in microarray and phenotype assays. Validated for RISC entry Mimic positive control Syn-hsa-miR-1 mimic Not expressed under most culture conditions, only expressed in muscle cells To check for optimal conditions by using miScript PCR miR-1 Inhibitor negative control miScript Inhibitor Negative Control Target the sequence of miScript mimic negative control Inhibitor positive control Anti-hsa-miR-1 inhibitor To check for optimal conditions in combination with Syn-hsa-miR-1 mimic Transfection control AllStars Hs Cell Death Control siRNA Cell death = successful transfection To run in every experiment - 52 - Sample & Assay Technologies
  53. 53. New product! RT2 Profiler miRNA Targets PCR Array Benefits: Assist miRNA functional analysis Follow up on miRNA expression profiling analyses Species currently covered: Human, mouse, and rat Features: Profiles expression of 84 verified & bioinformatically predicted target genes Target genes specific for a miRNA & others in same seed sequence family Free data analysis suite Available in 2, 12 or 24 plate packs Compatible with any real time qPCR instrument currently in your lab Note: Uses RT2 qPCR Reagent Kits - 53 - 53 Sample & Assay Technologies
  54. 54. www.sabiosciences.com/mirna_pcr_array.php miScript miRNA PCR Arrays miRNA Overview miScript PCR System miScript miRNA PCR Arrays Products for functional studies miRNA purification options - 54 - Sample & Assay Technologies
  55. 55. www.qiagen.com/GeneGlobe Single Primer Assays - 55 - Sample & Assay Technologies
  56. 56. Your microRNA workflow, from sample to results! miRNeasy FFPE Kit miRNeasy Serum / Plasma Kit miScript II RT Kit and PreAMP Kit HiPerFect Transfection Reagent miScript SYBR Green PCR Kit Attractene Transfection Reagent miScript miRNA PCR Arrays * miScript miRNA Mimics miScript miRNA Data Analysis Tool miRNeasy 96 Kit Profiling miRNeasy Mini Kit, miRNeasy Micro Kit miScript miRNA Inhibitors PAXgene Tissue miRNA Kit miScript Primer Assay Custom miScript miRNA Mimics PAXgene Blood miRNA Kit miScript Precursor Assay miScript Target Protector Supplementary protocol for miRNA from Plasma and Serum miScript PCR Starter Kit miScript miRNA Inhibitor 96 and 384 Plates and Sets * System is compatible with any real-time instrument QIAcube QIAgility - 56 - Rotor-Gene Q Sample & Assay Technologies
  57. 57. Upcoming webinars Webinar 2 : microRNA expression analysis: From experimental design to data analysis Date: December 11, 2012, 9:30 am EST Speaker: Jonathan Shaffer, Ph.D. Webinar 3: Profiling miRNA expression: on the road to biomarker development Date: December 18, 2012, 9:30 am EST Speaker: Eric Lader, Ph.D. For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at www.qiagen.com or can be requested from QIAGEN Technical Services or your local distributor - 57 - Sample & Assay Technologies
  58. 58. Free or Discounted miScript miRNA PCR Arrays! Technical Support Contact Information M-F, 8am to 6pm EST (US) Direct phone: 888-503-3187 Email: support@sabiosciences.com Let miScript drive your miRNA studies! - 58 - Sample & Assay Technologies
  59. 59. Questions? Thank you! Jonathan Shaffer Jonathan.Shaffer@qiagen.com For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at www.qiagen.com or can be requested from QIAGEN Technical Services or your local distributor - 59 - Sample & Assay Technologies

×