Mi rna part i_2013

585 views

Published on

  • Be the first to comment

Mi rna part i_2013

  1. 1. Sample & Assay Technologies Meeting the challenges of miRNA research: microRNA Biogenesis, Function, and Analysis Jonathan Shaffer, Ph.D. Jonathan.Shaffer@qiagen.com microRNA Technologies, R&D Americas The products described in this webinar are intended for molecular biology applications. These products are not intended for the diagnosis, prevention or treatment of disease.
  2. 2. Sample & Assay Technologies Three part webinar series miRNA and its role in human disease Webinar 1 : Speaker: Webinar 2 : Speaker: Webinar 3 : Speaker: Meeting the challenges of miRNA research: An introduction to microRNA biogenesis, function, and analysis Jonathan Shaffer, Ph.D. Advanced microRNA expression analysis: From experimental design through data analysis Jonathan Shaffer, Ph.D. Profiling miRNA expression in Cells, FFPE, and serum: On the road to biomarker development Jonathan Shaffer, Ph.D. Webinar 1: Meeting the Challenges of miRNA Research 2
  3. 3. Sample & Assay Technologies Upcoming webinars April 2013 Sign up at http://www.SABiosciences.com/seminarlist.php Webinar 1: Meeting the Challenges of miRNA Research 3
  4. 4. Sample & Assay Technologies Meeting the Challenges of miRNA Research Agenda miRNA Background miRNA Genomics miRNA in Disease miRNA Isolation Technologies miRNA Quantification Technologies miRNA Profiling Technologies miRNA Functionalization Technologies Webinar 1: Meeting the Challenges of miRNA Research 4
  5. 5. Sample & Assay Technologies RNA interference: A natural phenomenon Discovery tool, potential diagnostic, potential therapeutic 25000 10000 Sequences (miRBase) 20000 8000 7000 15000 6000 5000 10000 4000 3000 5000 2000 References (Highwire + PubMed) 9000 1000 0 0 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 Year Changes in miRNA can be correlated with gene expression changes in development, differentiation, signal transduction, infection, aging, and disease. Webinar 1: Meeting the Challenges of miRNA Research 5
  6. 6. Sample & Assay Technologies Canonical pathway of miRNA biogenesis Transcribed by RNA Polymerase II as a long primary transcript (pri-miRNAs), which may contain more than one miRNA. In the nucleus, pri-miRNAs are processed to hairpin-like pre-miRNAs by RNAse III-like enzyme Drosha. Pre-miRNAs are then exported to the cytosol by Exportin 5. In the cytosol RNAse III-like Dicer processes these precursors to mature miRNAs. These miRNAs are incorporated in RISC. miRNAs with high homology to the target mRNA lead to mRNA cleavage. miRNAs with imperfect base pairing to the target mRNA lead to translational repression and/or mRNA degradation. Webinar 1: Meeting the Challenges of miRNA Research 6
  7. 7. Sample & Assay Technologies How do miRNAs interact with mRNAs? Basis of miRNA-mRNA interaction Seed region: nucleotides 2-8 in 5’ region of miRNA Most evolutionary conserved miRNA region Most frequently complementary to target 3’-UTRs Often sufficient to confer mRNA recognition Beyond the seed region 3’ end also contributes (extensive pairing is rare) Some cases: central 11-12 continuous base pairs Result of interaction Suppression of gene expression Rare cases: increase gene expression References Grimson, A., et al, Mol. Cell 2007, 27, 91-105 Image From Bartel, D.P., Cell 2009, 136, 215-233 Guo, H., et al, Nature 2010, 466, 835-840 Thomson, D.W., et al, Nucleic Acids Res 2011, 1-9 Webinar 1: Meeting the Challenges of miRNA Research 7
  8. 8. Sample & Assay Technologies How to determine miRNA-mRNA interactions Algorithms for predicting miRNA-mRNA interaction Target Prediction is based on: Bioinformatics Seed region match Position in 3’ UTR Cross species conservation Central sequence homology Wet lab research Empirical evidence from microarrays Reporter systems Pitfalls of using prediction algorithms: Large number of candidate mRNAs for a given miRNA May not incorporate all miRNA targeting possibilities Different algorithms produce different target lists Potential for false positive rate of prediction Prediction Algorithm Website TargetScan http://www.targetscan.org/ Pictar http://pictar.mdc-berlin.de/ MicroCosm Targets http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/ DIANA http://diana.cslab.ece.ntua.gr/microT/ miRANDA http://www.microrna.org/microrna/home.do TarBase (experimentally supported) http://diana.cslab.ece.ntua.gr/tarbase/ Webinar 1: Meeting the Challenges of miRNA Research 8
  9. 9. Sample & Assay Technologies How to determine miRNA-mRNA interactions Experimental techniques miRNA Target Screening Gene expression analysis (inferred targets) RNA-seq Microarrays qPCR Immunoprecipitation (direct targets) HITS-CLIP PAR-CLIP Biotin tagged miRNA Gene-Specific Validation qPCR Luciferase reporter assays Western blot 5’ rapid identification of cDNA ends (5’ RLM-RACE) Other techniques Parallel analysis of RNA ends (modified 5’ RLM-RACE) Reverse transcription of targets Image From Chi, S.W., et al, Nature 2009, 13, 479-486 Webinar 1: Meeting the Challenges of miRNA Research 9
  10. 10. Sample & Assay Technologies miRNA Genomics: Generating miRNome Diversity Isolation Quantification and Profiling Functionalization Webinar 1: Meeting the Challenges of miRNA Research 10
  11. 11. Sample & Assay Technologies miRNA genomic structure Intergenic miRNA genes: either monocistronic or polycistronic with a common promoter Intronic miRNA genes: present in the introns of protein coding or noncoding genes, can also be in clusters, transcribed by the host gene promoter Exonic miRNAs genes: rare and often overlap an exon and an intron of a noncoding gene miRNAs can be transcribed from the negative strand within or near a protein coding gene Webinar 1: Meeting the Challenges of miRNA Research 11
  12. 12. Sample & Assay Technologies Multiple loci can generate the same mature miRNA Biogenesis creates incredible diversity Stem Loop CHR Overlapping transcripts CHR: Coordinates (GRCh37) 1302-1 12 intergenic 12: 113132839-113132981 [-] 1302-3 2 intergenic 2: 114340536-114340673 [-] 1302-7 8 intergenic 8: 142867603-142867674 [-] 1302-10 15 intergenic 15: 102500662-102500799 [-] 1302-11 19 intergenic 19: 71973-72110 [+] 1302-2 1 intronic Non protein coding 1: 30366-30503 [+] sense 1302-4 2 intronic Non protein coding 2: 208133999-208134148 [-] 1302-9 9 Non protein coding 9: 30144-30281 [+]; Sense 1302-5 20 intronic Protein coding/FAM65C; intron 4 1302-6 7 intronic Protein coding/HDAC9; intron 1 7: 18166843-18166932 [-] ; Antisense 1302-8 9 intronic Protein coding/ch9orf174 9: 100125836-100125963 [-]; Antisense 20: 49231173-49231322 [-]; Sense Mature-miR-1302: UUGGGACAUACUUAUGCUAAA www.mirbase.org Webinar 1: Meeting the Challenges of miRNA Research 12
  13. 13. Sample & Assay Technologies Post-transcriptional modification of miRNA Processing and ADAR editing ADAR: adenosine deaminase, RNA specific A-> I destabilizes dsRNA Deep sequencing of hsa-miR-21-5p A I ADAR Pri-miRNA DROSHA Processing Block A I Pre-miRNA Exportin ADAR ADAR Webinar 1: Meeting the Challenges of miRNA Research A I A I DICER Processing Block Change in miRNA seed 13
  14. 14. Sample & Assay Technologies miRNA in Disease Isolation Quantification and Profiling Functionalization Webinar 1: Meeting the Challenges of miRNA Research 14
  15. 15. Sample & Assay Technologies Potential events that disrupt normal miRNA activity Disruption of miRNA-mRNA interaction Altered Transcription Genomic Instability Methylation Histone Modification Transcription Factor Amplification/Deletion Translocation Insertional Mutagenesis Drosha Processing Dicer Processing Loss of miRNA Binding Site in target SNP or Mutation Alternative Splicing Loss/Change of 3’-UTR Webinar 1: Meeting the Challenges of miRNA Research 15
  16. 16. Sample & Assay Technologies Unique signatures in human cancer miRNAs located in genomic regions amplified in cancers (e.g. miR-17-92 cluster) can function as oncogenes, whereas miRNAs located in portions of chromosomes deleted in cancers (e.g. miR-15a-miR-16-1 cluster) can function as tumor suppressors. Abnormal expression of miRNAs has been found in both solid and hematopoietic tumors. miRNA expression fingerprints correlate with clinical and biological characteristics of tumors, including tissue type, differentiation, aggression and response to therapy. In the last 10 years, a substantial number of studies and reviews have associated the presence of various miRNAs with cell proliferation, resistance to apoptosis, invasiveness, and differentiation in cancer cells. Webinar 1: Meeting the Challenges of miRNA Research 16
  17. 17. Sample & Assay Technologies miRNA in cancer diagnosis Use of miRNA based classifier to identify tissue of origin for cancers of unknown primaries Utilizing a signature of altered miRNA expression to differentiate cancer tissue from normal tissue Profiling circulating blood or tumor derived exosomal miRNAs, surpassing the invasive procedures to aid in early detection of cancers miRNAs in Cancer Diagnosis Study SNPs in the miRNA genes, miRNA binding sites in the target mRNA genes or in the miRNA processing/machinery pathway genes to predict cancer predisposition Webinar 1: Meeting the Challenges of miRNA Research Distinguishing tumor subtypes using a panel of miRNAs that show differential expression within one cancer type Paranjape et al. (2009) Gut. 58: 1546-1554. 17
  18. 18. Sample & Assay Technologies miRNA Isolation Technologies Isolation Quantification and Profiling Functionalization Webinar 1: Meeting the Challenges of miRNA Research 18
  19. 19. Sample & Assay Technologies miRNeasy Kits: Mini, Micro Flexible protocols: total RNA or enrichment of miRNA High quality, pure RNA . Suitable for sensitive downstream applications Rapid procedure . Streamlined protocol for lowthroughput or 96-well formats Automated on QIAcube Effective purification of total RNA From a broad range of cells & tissues Efficient enrichment of microRNAs . miRNA enriched fraction & total RNA separately Co-purification of miRNA & total RNA Webinar 1: Meeting the Challenges of miRNA Research 19
  20. 20. Sample & Assay Technologies miRNeasy FFPE Kit High quality total RNA from archival samples 500 million FFPE tissues are archived! Tissue banks, pathology labs, biomedical research labs Current Isolation Methods: Compromised quality and yield Heavily fragmented Cross-linking by formaldehyde interferes with RT Current procedures may not purify all usable RNA, may increase fragmentation, are often ineffective in breaking up cross-links miRNeasy FFPE Kit: High quality, pure total RNA . Novel method prevents cross-linked RNA from blocking downstream applications Optimized lysis buffer with proteinase K RNeasy MinElute for small elution volume Webinar 1: Meeting the Challenges of miRNA Research 20
  21. 21. Sample & Assay Technologies miRNeasy Serum/Plasma Kit Purification from serum, plasma, and other fluids For purification of circulating RNA from animal and human plasma and serum Includes synthetic RNA control assay for normalization Clarified plasma or serum Minimal elution volume (14 µl) High-purity RNA suitable for all downstream applications miScript RT: up to 10 µl eluate for cDNA synthesis One RT enough for 6, 384-well plates Easy, robust procedures Plasma QIAzol Bind Serum Wash Elute Manual or Automated on QIACube Automatable protocol Webinar 1: Meeting the Challenges of miRNA Research 21
  22. 22. Sample & Assay Technologies miRNA Quantification Technologies Isolation Quantification and Profiling Functionalization Webinar 1: Meeting the Challenges of miRNA Research 22
  23. 23. Sample & Assay Technologies miScript PCR System Fully integrated, complete miRNA quantification system 1. miScript II RT Kit HiFlex Buffer: Unparalleled flexibility for miRNA and mRNA quantification from a single cDNA preparation HiSpec Buffer: Unmatched specificity for mature miRNA profiling 2. miScript miRNA PCR Arrays miRNome Pathway-focused 3. miScript PreAMP Kit Optional step for small or precious samples Full miRNome profiling from as little as 1 ng RNA 4. Assays miScript Primer Assays miScript Precursor Assays QuantiTect Primer Assays 5. miScript SYBR Green PCR Kit QuantiTect SYBR Green PCR Master Mix Universal Primer 6. miScript miRNA PCR Array data analysis software Straightforward, free data analysis Webinar 1: Meeting the Challenges of miRNA Research 23
  24. 24. Sample & Assay Technologies miScript II RT Kit A complete miRNA quantification solution miScript II RT Kit Mature miRNA quantification and profiling? Biogenesis studies? HiFlex Buffer HiSpec Buffer Flexible detection of all RNA molecules Patent-Pending technology for the specific detection of mature miRNAs Note: Only HiSpec Buffer is recommended for use with miScript miRNA PCR Arrays Webinar 1: Meeting the Challenges of miRNA Research 24
  25. 25. Sample & Assay Technologies HiFlex Buffer or HiSpec Buffer: Which buffer should you choose? HiFlex Buffer HiSpec Buffer Experiments that demand quantification of both mature miRNAs & mRNAs. Experiments designed exclusively for mature miRNA quantification. Long RNAs, such as mRNAs, are not converted into cDNA. HiSpec is the optimized buffer for mature miRNA profiling with miScript miRNA PCR Arrays. 30 25 25 Mean CT 35 30 20 15 20 15 Webinar 1: Meeting the Challenges of miRNA Research miR-25 miR-21 miR-16 Let-7a MAPK1 CDK1 PPIA GAPDH miR-25 miR-21 0 miR-16 0 Let-7a 5 MAPK1 5 CDK1 10 PPIA 10 GAPDH Mean C T 35 25
  26. 26. Sample & Assay Technologies miScript II RT Kit Reverse transcription theory HiFlex Buffer HiSpec Buffer miScript II Reverse Transcription Procedure Mix RNA, 5x miScript HiFlex or HiSpec Buffer, RNase-free water, 10x Nucleics Mix, and miScript Reverse Transcriptase Mix Use the cDNA to set up real-time PCR reactions Incubate at 37°C for 60 min Incubate at 95°C for 5 min Webinar 1: Meeting the Challenges of miRNA Research 26
  27. 27. Sample & Assay Technologies miScript II RT: Exceptional Linearity Linear over 6 logs of input RNA HiFlex Buffer HiSpec Buffer 40 40 miR-16 miR-16 miR-20a 35 miR-21 Linear (miR-16) Linear (miR-20a) miR-21 Linear (miR-16) Linear (miR-20a) 30 Linear (miR-21) Mean CT Mean CT 30 miR-20a 35 25 Linear (miR-21) 25 20 20 15 15 10 10 -2 -1 0 1 2 3 4 Log (ng) of RNA in cDNA synthesis using the HiFlex Buffer -2 -1 0 1 2 3 4 Log (ng) of RNA in cDNA synthesis using the HiSpec Buffer Webinar 1: Meeting the Challenges of miRNA Research 27
  28. 28. Sample & Assay Technologies miScript II PCR: Exceptional Sensitivity Detection of 10 copies to >106 copies of miRNA HiFlex Buffer HiSpec Buffer 32 32 miR-21 Linear (miR-21) miR-21 Linear (miR-21) 28 Mean CT Mean CT 28 24 24 20 20 16 16 12 12 1 2 3 4 5 6 Log copy number of miRNA using the HiFlex Buffer 1 2 3 4 5 6 Log copy number of miRNA using the HiSpec Buffer Webinar 1: Meeting the Challenges of miRNA Research 28
  29. 29. Sample & Assay Technologies miScript PCR System: Exceptional Specificity Excellent discrimination between closely related miRNA family members HiFlex Buffer Relative detection (as % of perfect match) cDNA used in PCR Let-7b Let-7c miR-98 Let-7d Let-7e Let-7a Let-7f Let-7g Let-7i Let-7b 100.0 1.8 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Let-7c 0.5 100.0 0.0 0.0 1.0 0.1 0.0 0.0 0.0 miR-98 0.0 0.2 100.0 0.1 0.0 0.1 0.0 0.0 0.1 Let-7d 0.1 0.0 0.0 100.0 0.0 0.4 0.0 0.0 0.0 Let-7e 0.1 0.0 0.0 0.0 100.0 0.2 0.0 0.0 0.0 Let-7a 0.1 0.6 0.0 0.5 3.9 100.0 0.1 0.0 0.0 Let-7f 0.6 0.1 0.0 0.1 0.0 1.1 100.0 0.1 0.1 Let-7g 0.6 0.2 0.0 0.1 0.0 0.0 0.0 100.0 0.2 Let-7i 0.1 0.0 0.0 0.0 0.0 0.0 0.0 0.1 100.0 miScript Primer Assay Used Webinar 1: Meeting the Challenges of miRNA Research 29
  30. 30. Sample & Assay Technologies miRNA Profiling Technologies Isolation Quantification and Profiling Functionalization Webinar 1: Meeting the Challenges of miRNA Research 30
  31. 31. Sample & Assay Technologies miRNA expression profiling applications Mechanisms of gene regulation Developmental biology Novel miRNA discovery Studying miRNA–mRNA and miRNA–protein interactions Integrative analyses of miRNAs in the context of gene regulatory networks Biomarkers Tissue-based miRNA biomarkers Tissues of unknown origin Circulating biomarkers Forensics From Pritchard, C.C., et al, Nature Rev. Genet 2012, 13, 358-369 Webinar 1: Meeting the Challenges of miRNA Research 31
  32. 32. Sample & Assay Technologies miRNome miScript miRNA PCR Arrays Leading coverage and validated assays miRNome Arrays Human Mouse Rat Dog Rhesus macaque Species Assays (miRBase V16) Human 940 Rat 653 Dog 277 Rhesus macaque 469 (V18) 100% validated assays Each assay is bench validated Each array is quality controlled Leading miRNome coverage Customizable 1066 Mouse Benefits of miRNome Arrays miRBase V17 and V18 assays are available! Contact us if you are interest in a different species! Webinar 1: Meeting the Challenges of miRNA Research 32
  33. 33. Sample & Assay Technologies Focused miScript miRNA PCR Arrays Biologically relevant, intelligently designed Focused Arrays miFinder Cancer PathwayFinder Brain Cancer Breast Cancer Ovarian Cancer Liver miFinder – New! Apoptosis Cell Differentiation & Development Immunopathology Inflammatory Response & Autoimmunity Diabetes Neurological Development & Disease T-Cell & B-Cell Activation Prostate Cancer Cardiovascular Disease Serum & Plasma Benefits of Focused Arrays 100% validated assays Each assay is bench validated Each array is quality controlled Biological relevant and up-to-date Customizable Contact us if you are interest in a different species! Webinar 1: Meeting the Challenges of miRNA Research 33
  34. 34. Sample & Assay Technologies High Content (HC) miScript miRNA PCR Arrays Targeted miRNome profiling miFinder 384HC Serum & Plasma 384HC Cancer PathwayFinder 384HC Liver miFinder 384HC – New! Webinar 1: Meeting the Challenges of miRNA Research 34
  35. 35. Sample & Assay Technologies Anatomy of a miScript miRNA PCR Array 96-well Format: 84 miRNA + 12 controls 84 miRNAs Cel-miR-39 SNORD61; SNORD68; SNORD72 SNORD95; SNORD96A; RNU6-2 miRTC PPC Spike in Control miScript PCR Controls for Normalization RT Control PCR Control Cel-miR-39 Alternative data normalization using exogenously spiked Syn-cel-miR-39 miScript miRNA Mimic miScript PCR Controls Data normalization using the ∆∆CT method of relative quantification miRNA reverse-transcription control (miRTC) Assessment of reverse transcription performance Positive PCR control (PPC) Assessment of PCR performance Webinar 1: Meeting the Challenges of miRNA Research 35
  36. 36. Sample & Assay Technologies miScript miRNA PCR Arrays Formats built to fit your experiment and cycler 96-well 384-well 384-well (4 x 96) Rotor-Disc 100 Webinar 1: Meeting the Challenges of miRNA Research 36
  37. 37. Sample & Assay Technologies miScript miRNA PCR Arrays Compatible with a wide range of instruments 96-Well: 7000, 7300, 7500, 7700, 7900HT, ViiA 7 FAST 96-Well: 7500, 7900HT, Step One Plus, ViiA 7 FAST 384-Well: 7900HT, ViiA 7 iCycler, MyiQ, MyiQ2, iQ5, CFX96, CFX384 Opticon, Opticon 2, Chromo 4 Mastercycler ep realplex 2/2S/4/4S LightCycler 480 Mx3000p, Mx3005p, Mx4000p TP-800 RotorGene Q Webinar 1: Meeting the Challenges of miRNA Research 37
  38. 38. Sample & Assay Technologies miScript miRNA PCR Arrays QIAGEN PCR Array Service Core Send your samples and receive results! Total RNA Isolation: miRNeasy Kits Reverse Transcription: miScript II RT Kit qPCR: miScript miRNA PCR Arrays Data analysis included! Webinar 1: Meeting the Challenges of miRNA Research 38
  39. 39. miScript miRNA PCR Arrays Rapid Workflow = Robust, Reproducible Performance 1st Time Array User 1 hour HiSpec Buffer 2 minutes 30 Mean CT: Biological Replicate 2 Sample & Assay Technologies 25 20 y = 1.0075x + 0.2891 2 hours 2 R = 0.989 15 15 20 25 30 Mean CT: Biological Replicate 1 15 minutes Webinar 1: Meeting the Challenges of miRNA Research Total HeLa S3 (miRNeasy) Pellet 1: Frozen June 2010 Pellet 2: Frozen April 2011 HiSpec Buffered cDNA miScript real-time PCR miFinder miScript miRNA PCR Array 39
  40. 40. miScript miRNA PCR Arrays Rapid Workflow = Robust, Reproducible Performance Two Operators 1 hour HiSpec Buffer 30 25 2 minutes CT: Operator 2 Sample & Assay Technologies 20 15 2 hours y = 0.9994x - 0.1945 2 R = 0.9959 10 10 15 20 25 30 CT: Operator 1 15 minutes Webinar 1: Meeting the Challenges of miRNA Research Total HeLa S3 (miRNeasy) HiSpec Buffered cDNA miScript real-time PCR miFinder miScript miRNA PCR Array Rotor-Gene Q 40
  41. 41. Sample & Assay Technologies Focused miRNA expression profiling FFPE samples Normal Lung 40 36 32 32 28 28 CT Value 36 CT Value Lung Tumor 40 24 20 24 20 16 16 12 FFPE Isolation 1 FFPE Isolation 2 8 12 FFPE Isolation 1 FFPE Isolation 2 8 FFPE Isolation 3 FFPE Isolation 3 4 4 1 7 13 19 25 31 37 43 49 55 61 67 73 1 7 13 19 25 31 37 43 49 55 61 67 73 One 5 µm FFPE section used per FFPE isolation Each isolation is from a different section On average, each isolation provided enough total RNA for: – Two full human miRNome profiles – Ten pathway-focused PCR arrays RT: 125 ng total RNA, HiSpec Buffer qPCR: Human miFinder miScript miRNA PCR Array (0.5 ng cDNA per well) Webinar 1: Meeting the Challenges of miRNA Research 41
  42. 42. Focused miRNA expression profiling (cont.) Sample & Assay Technologies FFPE samples 2-∆CT: Tumor vs. Normal 2 -∆CT : Tumor Lung FFPE Tissue 1.E+04 1.E+03 1.E+02 1.E+01 1.E+00 1.E-01 1.E-02 1.E-03 1.E-04 1.E+04 1.E+03 1.E+02 1.E+01 1.E+00 -∆CT 1.E-01 1.E-02 1.E-03 1.E-04 2 : Normal Lung FFPE Tissue Significant differences exist between the mature miRNA expression levels of the two tissue types ± 2-fold [red lines] used as a cutoff for significance Webinar 1: Meeting the Challenges of miRNA Research 42
  43. 43. Sample & Assay Technologies High Content (HC) miRNA expression profiling Serum sample 2-∆CT: Cancer vs. Normal Fold-Regulation: Cancer vs. Normal 20 1.E-01 1.E-02 1.E-03 2 -∆CT : Lung Cancer Serum 1.E+00 1.E-04 1.E+01 1.E+00 1.E-01 1.E-02 1.E-03 1.E-04 2 Fold-Regulation: Cancer vs. Normal 1.E+01 15 10 5 0 -5 -10 -∆CT : Normal Serum Workflow 200 µl serum 14 µl total RNA miRNA PCR Array 1.5 µl total RNA, HiSpec Buffer Serum & Plasma 384HC miScript Significant differences exist between the mature miRNA expression levels of the two tissue types ± 3-fold [red lines] used as a cutoff for significance Webinar 1: Meeting the Challenges of miRNA Research 43
  44. 44. Sample & Assay Technologies miRNome miRNA expression profiling HCT 116 colorectal cancer cells Scatter Plot Volcano Plot 1.E+02 0.00001 0.0001 1.E+00 1.E-01 p Value 2 -∆CT : Treated 1.E+01 1.E-02 1.E-03 0.001 0.01 1.E-04 0.1 1.E-05 1.E+02 1.E+01 1.E+00 1.E-01 1.E-02 1.E-03 1.E-04 1.E-05 2 1 -8 -∆CT : Untreated -6 -4 -2 0 2 4 6 8 Log2 (Fold-Regulation) 5-aza-2’-dC irreversibly inhibits DNA methyltransferase driven DNA methylation reactions by incorporating into DNA and covalently binding to the active site of the DNMT. Scatter Plot: Significant differences exist in the mature miRNA expression levels of the two samples that were tested 104 miRNAs were strongly up-regulated in 5-aza-2’-dC treated cells, while 30 were strongly downregulated in 5-aza-2’-dC treated HCT 116 cells. Volcano Plot: When a p Value of 0.05 is applied, the expression up-regulation of 89 of the 104 miRNAs is significant, and the expression down-regulation of 21 of the 30 miRNAs is significant Webinar 1: Meeting the Challenges of miRNA Research 44
  45. 45. Sample & Assay Technologies Limiting Samples Body fluids FFPE samples LCM samples Flow-sorted cells Circulating tumor cells Fine needle biopsies Isolation Quantification and Profiling Functionalization Webinar 1: Meeting the Challenges of miRNA Research 45
  46. 46. miScript PreAMP PCR Kit Straightforward, robust, and reproducible 30 Mean CT: Operator 2 Sample & Assay Technologies 25 20 y = 0.9973x + 0.2058 2 R = 0.9913 15 15 20 25 30 Mean CT: Operator 1 Universal reference RNA Two operators Experienced operator First time operator miScript real-time PCR miFinder miScript miRNA PCR Array Webinar 1: Meeting the Challenges of miRNA Research 46
  47. 47. miScript PreAMP: Excellent result, a fraction of the input Sample & Assay Technologies Limiting FFPE sample 15 13 11 ∆CT: PreAMP 9 7 5 3 1 -1 y = 0.9934x - 0.1457 -3 2 R = 0.9606 -5 -5 -3 -1 1 3 5 7 9 11 13 15 ∆CT: No PreAMP Workflow No PreAMP: 250 ng total RNA, HiSpec Buffer Human miRNome miScript miRNA PCR Array (Plate 1) PreAMP: 10 ng total RNA, HiSpec Buffer one-tenth of cDNA, miScript PreAMP preamplified cDNA used for Human miRNome miScript miRNA PCR Array (Plate 1) Excellent correlation, PreAMP vs. No PreAMP Preamplified cDNA provides enough material for more than 2 full human miScript miRNome profiles. Input was only 1 ng of cDNA! Webinar 1: Meeting the Challenges of miRNA Research 47
  48. 48. Sample & Assay Technologies miScript PreAMP: Excellent result, a fraction of the input Limiting serum sample 2-∆CT: Colorectal Cancer vs. Normal 32 : Colorectal Cancer Serum 1.E+03 28 1.E+02 1.E+01 24 y = 0.9728x + 0.7671 -∆CT 1.E+00 20 2 CT Mean: 3 RNA Isolations from Serum Reproducibility 2 R = 0.9757 1.E-01 32 CT: Individual RNA Isolation from Serum 2 -∆CT 1.E+03 28 1.E+02 24 1.E+01 20 1.E+00 16 1.E-01 16 : Normal Serum Workflow 5 µl serum 14 µl total RNA 2 µl total RNA, HiSpec Buffer one-tenth of cDNA, miScript PreAMP preamplified cDNA (0.07 µl SE) used for Human Serum & Plasma 384HC miScript miRNA PCR Array Conclusion: Starting with only 5 µl of serum, significant differences were detected when colorectal cancer serum was compared to normal serum Webinar 1: Meeting the Challenges of miRNA Research 48
  49. 49. Sample & Assay Technologies Let miScript drive your miRNA studies! Sample 1 hour 2 minutes 2 hours Results! 15 minutes Webinar 1: Meeting the Challenges of miRNA Research 49
  50. 50. Sample & Assay Technologies miRNA Functionalization Technologies Isolation Quantification and Profiling Functionalization Webinar 1: Meeting the Challenges of miRNA Research 50
  51. 51. Sample & Assay Technologies Manipulating miRNA function Webinar 1: Meeting the Challenges of miRNA Research 51
  52. 52. Sample & Assay Technologies miScript miRNA Mimics Mock endogenous miRNA activity Features of miScript miRNA Mimics: Double-stranded RNA oligonucleotide Functional sequence is the same as the natural mature miRNA Transfection results in inhibition comparable to the endogenous miRNA Stable in culture for up to 72 hours Webinar 1: Meeting the Challenges of miRNA Research 52
  53. 53. Sample & Assay Technologies miScript miRNA Inhibitors Block endogenous miRNA activity Features of miScript miRNA Inhibitors: Single-stranded, chemically modified RNA oligonucleotide Designed and modified to ensure efficient inhibition of endogenous miRNA Transfection of inhibitor counteracts miRNA-induced silencing Effective for at least 96 hours following transfection Webinar 1: Meeting the Challenges of miRNA Research 53
  54. 54. Sample & Assay Technologies miScript miRNA Mimics and Inhibitors Controls Mimic negative control AllStars Negative Control siRNA No homology to any mammalian gene. Validated for non-effects in microarray and phenotype assays. Validated for RISC entry Mimic positive control Syn-hsa-miR-1 mimic Not expressed under most culture conditions, only expressed in muscle cells To check for optimal conditions by using miScript PCR miR-1 Inhibitor negative control miScript Inhibitor Negative Control Target the sequence of miScript mimic negative control Inhibitor positive control Anti-hsa-miR-1 inhibitor To check for optimal conditions in combination with Syn-hsa-miR-1 mimic Transfection control AllStars Hs Cell Death Control siRNA Cell death = successful transfection To run in every experiment Webinar 1: Meeting the Challenges of miRNA Research 54
  55. 55. Sample & Assay Technologies RT2 Profiler miRNA Targets PCR Array What genes are regulated by your miRNA of interest? Benefits: Assist miRNA functional analysis Follow up on miRNA expression profiling analyses Species currently covered: Human, mouse, and rat Features: Profiles expression of 84 verified & bioinformatically predicted target genes Target genes specific for a miRNA & others in same seed sequence family Free data analysis suite Available in 2, 12 or 24 plate packs Compatible with any real time qPCR instrument currently in your lab Note: Uses RT2 qPCR Reagent Kits Webinar 1: Meeting the Challenges of miRNA Research 55
  56. 56. Sample & Assay Technologies Where can I find miScript miRNA PCR Arrays? www.sabiosciences.com/mirna_pcr_array.php miRNA Overview miScript PCR System miScript miRNA PCR Arrays Products for functional studies miRNA purification options Webinar 1: Meeting the Challenges of miRNA Research 56
  57. 57. Sample & Assay Technologies Where can I find miScript Primer Assays? www.qiagen.com/GeneGlobe Webinar 1: Meeting the Challenges of miRNA Research 57
  58. 58. Sample & Assay Technologies QIAGEN’s miRNA portfolio Your miRNA workflow, from sample to results! Quantification and profiling miRNeasy Mini Kit, miRNeasy Micro Kit miRNeasy 96 Kit miRNeasy FFPE Kit miRNeasy Serum/Plasma Kit Profiling Isolation Functionalization miScript II RT Kit and PreAMP Kit HiPerFect Transfection Reagent miScript SYBR Green PCR Kit Attractene Transfection Reagent miScript miRNA PCR Arrays miScript miRNA Mimics miScript miRNA Data Analysis Tool miScript miRNA Inhibitors PAXgene Tissue miRNA Kit miScript Primer Assay Custom miScript miRNA Mimics PAXgene Blood miRNA Kit miScript Precursor Assay miScript Target Protector Supplementary protocol for miRNA from Plasma and Serum miScript PCR Starter Kit miScript miRNA Inhibitor 96 and 384 Plates and Sets QIAGEN Service Core QIAcube Webinar 1: Meeting the Challenges of miRNA Research QIAgility Rotor-Gene Q 58
  59. 59. Sample & Assay Technologies Upcoming Webinars Experimental Setup and miRNA Profiling Webinars Webinar 2 : microRNA expression analysis: From experimental design to data analysis Speaker: Jonathan Shaffer, Ph.D. Webinar 3: Profiling miRNA expression: on the road to biomarker development Speaker: Jonathan Shaffer, Ph.D. Webinar 1: Meeting the Challenges of miRNA Research 59
  60. 60. Sample & Assay Technologies Thank you for attending Technical Support Contact Information Monday through Friday 8:00AM to 6:00PM EST Direct Phone: 888-503-3187 E-Mail: support@sabiosciences.com http://www.sabiosciences.com/promotion/miscriptdemo.php Webinar 1: Meeting the Challenges of miRNA Research 60
  61. 61. Sample & Assay Technologies Questions? Thank you for attending today’s webinar! Jonathan Shaffer, Ph.D. Jonathan.Shaffer@qiagen.com microRNA Technologies, R&D Americas Webinar 1: Meeting the Challenges of miRNA Research 61

×