Mi rna assays 2012

308 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
308
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
5
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Mi rna assays 2012

  1. 1. From Cellular to Molecular – New Assays for miRNA Research Samuel J. Rulli, Jr. Ph.D. Samuel.Rulli@Qiagen.com Sample & Assay Technologies
  2. 2. From Cellular to Molecular – New Assays for miRNA Research Samuel J. Rulli, Jr. Ph.D. Samuel.Rulli@Qiagen.com Questions, Comments, Concerns? US Applications Support 888-503-3187 ̣ Questions, Comments, Concerns? Global Applications Support SABio@qiagen.com support@sabiosciences.com Sample & Assay Technologies
  3. 3. miRNA Analysis: From Cellular to Molecular Isolation miRNeasy miRNA Studies Target Identification Expression miScript miRNA PCR Arrays SureFIND Transcriptome PCR Arrays Function miRNA mimics & inhibitors Cignal Reporters -3- Sample & Assay Technologies
  4. 4. What Is Micro RNA? RISC Target mRNA 5’ CDS 3’ 3’ 5’ miRNA Seed region Endogenously expressed small functional RNAs (~ 21nt -24 nt) Regulate mRNA expression post-transcriptionally Involves the formation of RISC (RNA induced Silencing Complex) Translational Repression and or mRNA degradation Only partial sequence complementarity required A given miRNA can regulate multiple mRNAs A given mRNA can be regulated by multiple miRNAs Another layer of complexity for regulating gene expression Aberrant expression of miRNAs is associated with many diseases e.g. Many different Cancers -4- Sample & Assay Technologies
  5. 5. Canonical pathway of microRNA biogenesis Transcribed by RNA Polymerase II as a long primary transcript (pri-miRNAs), which may contain more than one miRNA. In the nucleus, Pri-miRNAs are processed to hairpin-like pre-miRNAs by RNAse III-like enzyme Drosha Pre-miRNAs are then exported to the Cytosol by Exportin 5 In the cytosol RNAse III-like Dicer processes these precursors to mature miRNAs These miRNAs are incorporated in RISC miRNAs with high homology to the target mRNA lead to mRNA cleavage miRNAs with imperfect base pairing to the target mRNA lead to translational repression and/or mRNA degradation -5- Sample & Assay Technologies
  6. 6. miRNA genomic structure Intergenic miRNA genes: either monocistronic or polycistronic with a common promoter Intronic miRNA genes: present in the introns of protein coding or noncoding genes, can also be in clusters, transcribed by the host gene promoter Exonic miRNAs genes: rare and often overlap an exon and an intron of a noncoding gene miRNAs can be transcribed from the negative strand within or near a protein coding gene -6- Sample & Assay Technologies
  7. 7. Multiple loci can generate the same mature miRNA But are under different regulatory control Stem Loop CHR Overlapping transcripts CHR: Coordinates (GRCh37) 1302-1 12 intergenic 12: 113132839-113132981 [-] 1302-3 2 intergenic 2: 114340536-114340673 [-] 1302-7 8 intergenic 8: 142867603-142867674 [-] 1302-10 15 intergenic 15: 102500662-102500799 [-] 1302-11 19 intergenic 19: 71973-72110 [+] 1302-2 1 intronic Non protein coding 1: 30366-30503 [+] sense 1302-4 2 intronic Non protein coding 2: 208133999-208134148 [-] 1302-9 9 Non protein coding 9: 30144-30281 [+]; Sense 1302-5 20 intronic Protein coding/FAM65C; intron4 1302-6 7 intronic Protein coding/HDAC9; intron 1 1302-8 9 intronic Protein coding/ch9orf174 20: 49231173-49231322 [-]; Sense 7: 18166843-18166932 [-] ; Antisense 9: 100125836-100125963 [-]; Antisense Mature-miR-1302: UUGGGACAUACUUAUGCUAAA www.mirbase.org -7- Sample & Assay Technologies
  8. 8. A growing picture of miRNA dysregulation in cancer pathways In the last 5 years, a substantial number of studies have associated various miRNAs with cell proliferation, resistance to apoptosis, differentiation, immunity and cancer initiation, progression and metastasis. . . For example: . Deletions of miRNA-regulated genes have been detected in more than 65% of chronic lymphocytic leukemia cases, in 50% of mantle-cell lymphomas, in 16% to 40% of multiple myelomas, and in 60% of prostate cancers. Other miRNA abnormalities have been reported in a wide variety of Human neoplasms, including other hematologic malignancies such as promyelocytic leukemia Benign tumors such as leiomyoma and pituitary adenoma Multiple types of carcinomas, including pancreatic, esophageal, thyroid, lung, and breast Neuroblastomas and glioblastomas -8- Sample & Assay Technologies
  9. 9. Why Analyze miRNA? Easy to profile entire miRNome with only ~1000 miRNAs . Complexity of miRNA/mRNA interaction makes them exciting and unknown epigenetic mechanism of gene regulation . miRNA regulated genes are involved in a variety of biological processes Cancer Development Immunology Aging Heart Diseases Neurological Diseases Diabetes . miRNAs are promising biomarkers for early disease detection and prognosis -9- Sample & Assay Technologies
  10. 10. miRNA Analysis: From Cellular to Molecular Isolation miRNeasy miRNA Studies Target Identification Expression miScript miRNA PCR Arrays and PCR Assays SureFIND Transcriptome PCR Arrays Function miRNA mimics & inhibitors Cignal Reporters - 10 - Sample & Assay Technologies
  11. 11. miRNeasy Purification of miRNAs miRNA purification Cells and tissues miRNeasy Mini Kit Cells and tissues (small amounts) miRNeasy Micro Kit Cells and tissues, 96-well format miRNeasy 96 Kit Formalin-fixed, paraffin-embedded tissues miRNeasy FFPE Kit Plasma and serum miRNeasy Serum/Plasma Kit Almost any sample source can yield high quality miRNA for miRNA profiling - 11 - Sample & Assay Technologies
  12. 12. miRNA isolation is simple from any sample - 12 - Sample & Assay Technologies
  13. 13. miRNA isolation is simple from any sample Sufficient for miScript miRNA PCR Arrays - 13 - Sample & Assay Technologies
  14. 14. miRNA isolation is simple from any sample Maximize limited sample amounts to measure miRNA and mRNA by PCR arrays or individual qPCR Assays - 14 - Sample & Assay Technologies
  15. 15. miRNA Analysis: From Cellular to Molecular Isolation miRNeasy miRNA Studies Target Identification Expression miScript miRNA PCR Arrays and PCR Assays SureFIND Transcriptome PCR Arrays Function miRNA mimics & inhibitors Cignal Reporters - 15 - Sample & Assay Technologies
  16. 16. How to Monitor miRNA Expression Levels Northern Blot Very low throughput Very time consuming and complex Specificity issue Microarrays Profile More Sequences Poor Sensitivity & Dynamic Range, Complicated Protocol Expensive equipment Real-Time RT-PCR (qPCR) Simpler Protocol Better Sensitivity, Specificity & Reproducibility No investment in equipment Profile up to 384 miRNA in a single run (miRNome needs 3x 384 plates) . . . - 16 - Sample & Assay Technologies
  17. 17. miScript miRNA PCR Array System miRNeasy miRNA Isolation Kit . miScript miRNA 1st Strand cDNA Synthesis Kit Preferentially reverse transcribe mature miRNA Built-in external RNA control One-step reaction miScript miRNA PCR Arrays and qPCR Primers Human, mouse, rat: Search miRNA Primers: http://www.sabiosciences.com/mirna_pcr_assay.php . . -or- PCR Arrays: Pathways and Genomes Cancer Cell Differentiation & Development Immunopathology Inflammation miFinder Whole Genome (miRNome) – Sanger miRBase V14.0 Serum (or plasma) Brain Cancer miRNA Neurological Development & Disease Optimized miScript SYBR® Green Master Mix miScript miRNA Data Analysis Excel Template & Web Portal . . - 17 - Sample & Assay Technologies
  18. 18. miScript miRNA PCR Arrays cDNA Synthesis (miScript II RT KIT) 1 hours . Load Plates (Preferably with 8-Channel Pipettors) 2 minutes . Run 40 cycle qPCR Program 2 hours . Upload and Analyze Data 15 minutes . - 18 - Sample & Assay Technologies
  19. 19. Universal miRNA RT-PCR used by miScript miRNA PCR Arrays and Assays Same cDNA preparation can assay ANY miRNA now or in the future (think miRBase 24) miRNA Poly(A) Polymerase AAAAAAAA NNTTTTTTTT Universal RT Primer site Reverse Transcriptase TTTTTTTT Real-Time PCR miRNA-Specific Primer TTTTTTTT Universal Primer - 19 - Sample & Assay Technologies
  20. 20. Performance: Universal RT Advantages Benefit of universal RT reaction Simpler setup, without primer interaction issues Less sample necessary for analyses Equal RT reaction for each miRNA, to ensure reproducible expression analysis . Comprehensive miRNA coverage cDNA can be saved for new analyses when additional miRNA sequences are discovered . Similar potential specificity, & additional flexibility for future discveries - 20 - Sample & Assay Technologies
  21. 21. miScript miRNA PCR Arrays cDNA Synthesis (miScript II RT KIT) 1 hours . Load Plates (Preferably with 8-Channel Pipettors) 2 minutes . Run 40 cycle qPCR Program 2 hours . Upload and Analyze Data 15 minutes . - 21 - Sample & Assay Technologies
  22. 22. miScript miRNA PCR Arrays Pathway-Focused: 84 miRNAs + 12 Controls 84 miRNAs Cel-miR-39 SNORD61; SNORD68; SNORD72 SNORD95; SNORD96A; RNU6-2 miRTC PPC Spike in Control miScript PCR Controls for Normalization RT Control PCR Control Cel-miR-39 Alternative data normalization using exogenously spiked Syn-cel-miR-39 miScript miRNA Mimic miScript PCR Controls Data normalization using the ∆∆CT method of relative quantification miRNA reverse-transcription control (miRTC) Assessment of reverse transcription performance Positive PCR control (PPC) Assessment of PCR performance - 22 - Sample & Assay Technologies
  23. 23. miScript miRNA PCR Arrays Available in 96-well, 384-well, and Rotor-Disc 100 Formats 96-well 384-well 384-well (4 x 96) Rotor-Disc 100 - 23 - Sample & Assay Technologies
  24. 24. miScript miRNA PCR Arrays Redefining miRNA expression profiling Complete miRNome Arrays Pathway and Disease -Focused Arrays Human, Mouse, Rat: miFinder (Dog and Rhesus macaque) miFinder 384 HC (high content) Human Mouse Rat Dog New! Rhesus macaque Species Cancer PathwayFinder Brain Cancer Breast Cancer Cancer PathwayFinder Ovarian Cancer Prostate Cancer Assays Immunopathology T cell & B cell Activation Inflammatory Response & Autoimmunity Neurological Development & Disease (miRBase V16) Human 1066 Mouse 940 Rat 653 Dog 277 Rhesus macaque 469 (V18) Cell Differentiation & Development (Stem Cell) Serum & Plasma Fully customizable! - 24 - Sample & Assay Technologies
  25. 25. miScript miRNA PCR Arrays cDNA Synthesis (miScript II RT KIT) 1 hours . Load Plates (Preferably with 8-Channel Pipettors) 2 minutes . Run 40 cycle qPCR Program 2 hours . Upload and Analyze Data 15 minutes . - 25 - Sample & Assay Technologies
  26. 26. miScript miRNA PCR Arrays Compatible with a wide range of instruments 96-Well: 7000, 7300, 7500, 7700, 7900HT, ViiA 7 FAST 96-Well: 7500, 7900HT, Step One Plus, ViiA 7 FAST 384-Well: 7900HT, ViiA 7 iCycler, MyiQ, MyiQ2, iQ5, CFX96, CFX384 Opticon, Opticon 2, Chromo 4 Mastercycler ep realplex 2/2S/4/4S LightCycler 480 Mx3000p, Mx3005p, Mx4000p TP-800 RotorGene Q - 26 - Sample & Assay Technologies
  27. 27. miScript miRNA PCR Arrays cDNA Synthesis (miScript II RT KIT) 1 hours . Load Plates (Preferably with 8-Channel Pipettors) 2 minutes . Run 40 cycle qPCR Program 2 hours . Upload and Analyze Data 15 minutes . - 27 - Sample & Assay Technologies
  28. 28. Web Portal Location http://pcrdataanalysis.sabiosciences.com/mirna/arrayanalysis.php - 28 - Sample & Assay Technologies
  29. 29. Analyze Results Average ∆Ct Fold Change - 29 - Fold Regulation Sample & Assay Technologies
  30. 30. Visualization of Data Heat Map - 30 - Sample & Assay Technologies
  31. 31. Visualization of Data Scatter Plot - 31 - Sample & Assay Technologies
  32. 32. Visualization of Data Volcano Plot - 32 - Sample & Assay Technologies
  33. 33. Visualization of Data Clustergram Clustergram - 33 - Sample & Assay Technologies
  34. 34. Application Examples Cancer Identify miRNA biomarkers Development & Differentiation Regulation of Cell Type by miRNAs Genome-Wide Discovery Profile downstream miRNA expression - 34 - Sample & Assay Technologies
  35. 35. Application Data: Which Cancer-related miRNAs are expressed in a specific tumor? Human miScript CancerFinder miRNA PCR Array: Identified miRNA dysregulated in a Colon Tumor. - 35 - Sample & Assay Technologies
  36. 36. Application Data: Cell Differentiation & Development 26 Brain-Specific miRNA 20 Muscle-Specific miRNA Human Cell Differentiation & Development miScript miRNA PCR Array: Identifies 26 Brain- and 20 Muscle-Specific miRNAs - 36 - Sample & Assay Technologies
  37. 37. Application Data: Genome-Wide Screening 40 Ct Adeno-p53 35 30 203 551a 25 34a 940 20 15 15 20 25 30 35 40 Ct Control Human miScript miRNome PCR Array: Identifies Known and Novel miRNA Targets of the p53 Signaling Pathway - 37 - Sample & Assay Technologies
  38. 38. miRNA expression profiling using FFPE samples 40 One 5 µM FFPE section used per FFPE isolation RT: 125 ng total RNA, HiSpec Buffer qPCR: Human miFinder miScript miRNA PCR Array – 0.5 ng cDNA per well, Human miFinder PCR Array ∆CT (miRTC – PPC) is used to assess reverse transcription efficiency 32 28 CT Value RT and qPCR Normal Lung 36 Each isolation is from a different section On average, each isolation provided enough total RNA for: – Two full human miRNome profiles – Ten pathway-focused PCR arrays 24 20 16 12 FFPE Isolation 1 FFPE Isolation 2 8 FFPE Isolation 3 20 ∆CT < 7 indicates no inhibition of reverse-transcription 18 16 1 40 32 10 28 CT Value 12 7 13 19 25 31 37 43 49 55 61 67 73 Lung Tumor 36 14 8 6 24 20 63 T: 61 T: 52 T: 43 T: T: 41 32 T: T: T: T: N :2 N :1 23 8 21 0 12 12 -2 2 -3 16 -1 4 N :1 ∆CT (miRTC - PPC) 4 FFPE Isolation 1 FFPE Isolation 2 FFPE Isolation 3 4 1 Sample 7 13 19 25 31 37 43 49 55 61 67 73 Human miFinder miRNA Assay - 38 - Sample & Assay Technologies
  39. 39. miRNA expression profiling using FFPE samples (cont.) 2-∆CT: Tumor vs. Normal Fold-Regulation: Tumor vs. Normal 14 Log2 Fold-Regulation (Tumor vs. Normal) 2 -∆CT : Tumor Lung FFPE Tissue 1.E+04 1.E+03 1.E+02 1.E+01 1.E+00 1.E-01 1.E-02 1.E-03 1.E-04 1.E+04 1.E+03 1.E+02 1.E+01 1.E+00 -∆CT 1.E-01 1.E-02 1.E-03 1.E-04 2 : Normal Lung FFPE Tissue 10 6 2 -2 -6 -10 -14 Significant differences exist between the mature miRNA expression levels of the two tissue types ± 2-fold [red lines] used as a arbitrary cutoff - 39 - Sample & Assay Technologies
  40. 40. miRNA expression profiling using serum samples 2-∆CT: Breast Cancer vs. Normal Normal Serum 1.E+01 : Breast Cancer Serum 38 30 26 -∆CT 22 Serum Isolation 1 18 Serum Isolation 2 Serum Isolation 3 1.E-01 1.E-02 miR-34a 1.E-03 1.E-04 1.E-05 1.E+01 200 µl serum 50 µl total RNA 5 µl total RNA, HiSpec Buffer miFinder miScript miRNA PCR Array 1.E+00 Workflow -∆CT 1.E-01 2 1.E-02 miRNA 1.E-03 6 11 16 21 26 31 36 41 46 51 56 61 1.E-04 1.E-05 14 1 1.E+00 2 CT Value 34 : Normal Serum one-half of cDNA used for 96-well High reproducibility can be achieved using the miRNeasy Supplementary Protocol Each isolation was from a different normal serum donor Significant differences exist between the mature miRNA expression levels of the two tissue types ± 2-fold [red lines] used as a cutoff for significance - 40 - Sample & Assay Technologies
  41. 41. miRNA Analysis: From Cellular to Molecular Isolation miRNeasy miRNA Studies Target Identification Expression miScript miRNA PCR Arrays and PCR Assays SureFIND Transcriptome PCR Arrays Function miRNA mimics & inhibitors Cignal Reporters - 41 - Sample & Assay Technologies
  42. 42. Cignal Reporter System: Measure Pathway Activity in Cells Cignal Reporter Assays enable researchers to monitor transcription factor activation Flexible system allows monitoring of different reporter assays (GFP or Luciferase) Available as single assays or grouped by biology or pathway Validated assays for high signal to noise ratios - 42 - Sample & Assay Technologies
  43. 43. What Cignal Reporter Assays Provide Functionally validated dual-reporter formulation . Minimizes variability, increasing the biological relevance of each experiment Ready-to-use reporters and controls, coupled with a transient reporter system Enables simple and rapid analysis of the regulation of 45 signal transduction pathways Combination of custom-engineered transcriptional regulatory elements (TREs) and destabilized, codon-optimized firefly luciferase Increases the signal to noise ratio and maximizes assay sensitivity and specificity - 43 - Sample & Assay Technologies
  44. 44. Cignal Reporter Assays: Complete Solution How Cignal Reporter Assays Work Pathway-targeted Transcriptional Regulatory Elements (TRE), which establish the pathway specificity of each reporter TATA box Reporter Construct firefly luciferase Tandem repeats of TRE TF FL Upstream Signaling Events - 44 - Sample & Assay Technologies
  45. 45. Reporter Design: Dual-Luciferase Assays The Transcriptional Regulatory Elements (TREs) are what establish the pathway specificity of each reporter! Pathway-targeted transcriptional regulatory elements (45) Reporter Construct TRE TATA box Firefly luciferase Normalization Construct CMV TATA box Renilla luciferase Constitutive transcriptional regulatory element (1) - 45 - Sample & Assay Technologies
  46. 46. Cignal Reporter Assays (45 Pathways) Pathway Amino Acid Deprivation Androgen Antioxidant Response ATF6 C/EBP cAMP/PKA Cell Cycle DNA Damage EGR1 ER Stress Estrogen GATA Glucocorticoid Heat Shock Response Heavy Metal Stress Hedgehog HNF4 Hypoxia Interferon Regulation Type I Interferon Interferon Gamma KLF4 Liver X Transcription Factor ATF4/ATF3/ATF2 Androgen Receptor Nrf2 & Nrf1 ATF6 C/EBP CREB E2F/DP1 p53 EGR1 CBF/NF-Y/YY1 ER GATA GR HSF MTF1 Gli HNF4 HIF-1 IRF-1 STAT1/STAT2 STAT1/STAT1 KLF4 LXR - 46 - Pathway MAPK/ERK MAPK/JNK MEF2 c-myc Nanog NFκB Notch Oct4 Pax6 PI3K/AKT PKC/Ca++ PPAR Progesterone Retinoic Acid Retinoid X Sox2 SP1 STAT3 TGFβ VDRE Wnt Xenobiotic Transcription Factor Elk-1/SRF AP-1 MEF2 Myc/Max Nanog NFκB RBP-Jk Oct4 Pax6 FOXO NFAT PPAR PR RAR RXR Sox2 SP1 STAT3 SMAD2/3/4 Vitamin D Receptor TCF/LEF AhR Sample & Assay Technologies
  47. 47. Cignal Pathway Reporter System Products Primary cells, stem cells, and difficult to transfect cell lines Easy to transfect cell lines Endpoint Assays Cignal Dual-Luciferase Reporter Assays Single Pathway Assays 10-Pathway Arrays Dynamic Live Cell Assays Dynamic Live Cell Assays Endpoint Assays Cignal GFP Reporter Assays Cignal Lenti Luciferase Reporters Single Pathway Assays Single Pathway Assays - 47 - 10-Pathway Arrays Cignal Lenti GFP Reporters Single Pathway Assays Sample & Assay Technologies
  48. 48. Cignal Reporters: What You Need Cignal Reporter Assay Reliable transfection reagent and protocol (Attractene, HiPerFect) Biological Test miRNA mimics & Inhibitors Detection Instrument and Luciferase Substrates - 48 - Sample & Assay Technologies
  49. 49. Solutions for microRNA Function QIAGEN miRNA Mimics and Inhibitors For functional analysis of miRNA QIAGEN Target Protectors Disrupt Specific miRNA-Target Interactions - 49 - Sample & Assay Technologies
  50. 50. miRNA Mimics & Inhibitors: How do they work? Transfection of Mimics Transfection of Inhibitors RISC Target Expression Level - 50 - Sample & Assay Technologies
  51. 51. miRNA Mimics & Inhibitors: How do they work? Transfection of Mimics Transfection of Inhibitors Mimics increase miRNA activity RISC Target Expression Level - 51 - Sample & Assay Technologies
  52. 52. miRNA Mimics & Inhibitors: How do they work? Transfection of Mimics Transfection of Inhibitors Inhibitor decrease miRNA activity RISC Target Expression Level - 52 - Sample & Assay Technologies
  53. 53. Application Example: miRNA & Pathway Activity The let-7 family of miRNAs is widely viewed as playing a role in tumor suppression. . Expression of let-7 family members is downregulated in many cancer types and during tumor progression in comparison to normal tissue. . Humans have 10 mature let-7 family sequences (let-7a, 7b, 7c, 7d, 7e, 7f, 7g, 7i, miR-98, and miR-202) . Interestingly, certain let-7 species are also known to be upregulated in some cancer types. These data on the expression of let-7 in various cancers indicate that individual let-7 family members can have different activities. . Question: Which let-7 family members effect cell cycle progression and how? . - 53 - Sample & Assay Technologies
  54. 54. Cignal Reporters: What You Need • Cignal Cell Cycle Pathway Reporter Measures E2F/DP1 Activity • Transfection of HEK293 cells • Biological Test •Let-7 family mimics • Dual-Luciferase Assay - 54 - Sample & Assay Technologies
  55. 55. Let-7 Family Members and the Cell Cycle - 55 - Sample & Assay Technologies
  56. 56. miRNA Analysis: From Cellular to Molecular Isolation miRNeasy miRNA Studies Target Identification Expression miScript miRNA PCR Arrays and PCR Assays SureFIND Transcriptome PCR Arrays Function miRNA mimics & inhibitors Cignal Reporters - 56 - Sample & Assay Technologies
  57. 57. Discover miRNAs Regulating the Expression of any Gene Sample & Assay Technologies
  58. 58. What regulates your gene? miRNA Upstream Pathway Regulators mRNA GOI DNA Transcriptional Factors - 58 - Sample & Assay Technologies
  59. 59. How do you identify those regulators? Bioinformatics Overexpression . . Promoter Analysis Chemical Treatments . . × mRNA RNAi knockdown Forward Genetics . . × DNA - 59 - Sample & Assay Technologies
  60. 60. Approach to Identifying miRNA Regulators miRNA mimic miRNA 1 2 3 4 1) Treat Cells 2) Isolate RNA 3) First Strand cDNA Synthesis 4) qPCR for Gene Expression - 60 - Sample & Assay Technologies
  61. 61. Transcriptome cDNA panels Transcriptome PCR Arrays are ready-to-use cDNA panels for discovering the miRNAs, Pathways or Transcription Factors that regulate the expression of any gene. . Each Transcriptome PCR Array is a panel of Transcriptomes or cDNAs: 90 Experimental cDNA samples 4 Vehicle Control cDNA samples 2 PCR Controls (only for SYBR green reactions) . Each experimental cDNA sample is derived from cells treated with a different treatment. . - 61 - Sample & Assay Technologies
  62. 62. Example Transcriptome PCR Array cDNA Sample 1 cDNA Sample 2 cDNA Sample 3 cDNA Sample 4 cDNA Sample 5 cDNA Sample 6 - 62 - Sample & Assay Technologies
  63. 63. Materials needed for miRNA discovery . . . Transcriptome PCR Array (1 for each GOI or HKG) The Research Also Needs: qPCR Thermocycler Micropipettor qPCR Master Mix qPCR Assay (either SYBR® green or Probe-based Assays) Computer with Microsoft Excel for Data Analysis - 63 - Sample & Assay Technologies
  64. 64. SureFIND Protocol - 64 - Sample & Assay Technologies
  65. 65. Application Example: miRNA regulation of INPPL1 INPPL1, also known as SHIP2, is a SH2-containing 5'-inositol phosphatase . Converts PIP3 to PtdIns(3,4)P2, which negatively regulates PI3K signaling . Linked to Carcinogenesis . - 65 - Sample & Assay Technologies
  66. 66. Site Predictions for INPPL1 TargetScan PicTar miRANDA miR-10 miR-184 miR-18a miR-135 miR-205 miR-18b miR-146 miR-342-3p miR-184 miR-642 miR-18ab miR-671-3p miR-205 miR-27ab miR-29abc - 66 - Sample & Assay Technologies
  67. 67. Cancer miRNA Transcriptome PCR Array Results for INPPL1 - 67 - Sample & Assay Technologies
  68. 68. Site Predictions for INPPL1 TargetScan PicTar miRANDA miR-10 miR-184 miR-18a miR-135 miR-205 miR-18b miR-146 miR-342-3p miR-184 miR-642 miR-18ab miR-671-3p miR-205 miR-27ab miR-29abc - 68 - Sample & Assay Technologies
  69. 69. Compare Results with Research Community What’s really exciting…. Three new miRNAs that play a role in INPPL1 expression mir-193b mir-138 mir-373 - 69 - Sample & Assay Technologies
  70. 70. Now what?............. Suggestions to Validate your “Hits” miRNA-based Discovery Perform a miScript miRNA mimic experiment Identical Gain-Of-Function experiment Perform a miScript miRNA inhibitor experiment Loss-of-Function Experiment Peform a miScript Target Protector experiment ssRNA that disrupt a specific Target-miRNA interaction . - 70 - Sample & Assay Technologies
  71. 71. Summary: miRNA Analysis: From Cellular to Molecular Isolation miRNeasy miRNA Studies Target Identification Expression miScript miRNA PCR Arrays and PCR Assays SureFIND Transcriptome PCR Arrays Function miRNA mimics & inhibitors Cignal Reporters - 71 - Sample & Assay Technologies
  72. 72. Questions, Comments, Concerns or Suggestions? *SURVEY? Answers to your technical and biological questions: Questions, Comments, Concerns? US Applications Support Questions, Comments, Concerns? Global Applications Support SABio@qiagen.com 888-503-3187 ̣ support@sabiosciences.com Samuel Rulli Samuel.Rulli@QIAGEN.com Copy of slides? Type slides into questions box or fill out survey on exit Want someone to call you? Type contact me into questions box Want to try something? Request demos in the questions box miRneasy isolation; -miScript miRNA Arrays; miRNA mimics/inhibitors; target protectors; Cignal Reporter assays; etc. - 72 - Sample & Assay Technologies

×