Sample & Assay Technologies

GeneRead DNAseq Targeted Exon Enrichment &
GeneRead Library Quantification System for
Next Ge...
Sample & Assay Technologies

Pathway-Focused Analysis Tools

2
Sample & Assay Technologies

GeneRead DNAseq & Library Quant NGS System

Agenda
 Introduction
 Targeted Enrichment
 Wor...
Sample & Assay Technologies

Individual
participants

Cell cycle

P53
MDM2
Cyclins
CDKs

Biological Markers Define Biologi...
Sample & Assay Technologies

Complete Biological Story
Built on Pathway / Network Analysis

Angiogenesis

Inflammation

Pa...
Sample & Assay Technologies

Patient sample =
Wild-type =

Determining DNA Differences

ATGCCATCTGGGACGGGTCAGTAG
ATGCCATCT...
Sample & Assay Technologies

What is NGS (Next Generation Sequencing)?
Massively Paralleled Sequencing

Instead of sequenc...
Sample & Assay Technologies

When doing NGS analysis, what are you looking for?
Easy-to-use workflow and Data output

Dete...
Sample & Assay Technologies

Your NGS research needs

 Identify low frequency DNA mutation variants
 Work with low quali...
Sample & Assay Technologies

Traditional NGS Workflow

Isolate DNA

Library Prep & Quantification

NGS

Sequence Analysis ...
Sample & Assay Technologies

New NGS Workflow with Targeted Enrichment
80 ng

Achieve more sensitive mutation detection
wi...
Sample & Assay Technologies

Target Enrichment: Principles
Multiplex PCR-enabled enrichment of gene of interest

We provid...
Sample & Assay Technologies

Targeted Enrichment: Details

~ 150 bp PCR
products

13
Sample & Assay Technologies

Complete Analysis Workflow
With integrated controls to assess sample quality / TE process

Co...
Sample & Assay Technologies

NGS Sequence Analysis and Variant ID Software

 FREE Complete & Easy to use Data Analysis wi...
Sample & Assay Technologies

Read Mode: Paired End vs Single End
Goal: Increased # of Reads / Amplicon

Sequence of Intere...
Sample & Assay Technologies

How Genes on Panels Are Selected


Comprehensive Cancer Panel (124 genes)



Disease Focuse...
Sample & Assay Technologies

Targeted Enrichment: Panel Information
Sample & Assay Technologies

NGS Target Enrichment Design Strategy
Commonly encountered issues solved by GeneRead Algorith...
Sample & Assay Technologies

Design Coverage Information Provided
Base Pairs Covered

20
Sample & Assay Technologies

Coordinate Information
Sample & Assay Technologies

BED File Information

M1 = Covered
Regions
M*1 =
Uncovered
Regions

22
Sample & Assay Technologies

Gene Visualization with UCSC Genome Browser
Instructions will be provided online at SABioscie...
Sample & Assay Technologies

GeneRead DNAseq Gene Panel: Performance data

% Covered by Design

Design coverage

GeneRead ...
Sample & Assay Technologies

GeneRead DNAseq Gene Panel: Performance data
Sequence coverage uniformity

GeneRead DNAseq
Cu...
Sample & Assay Technologies

Multiplexing Capacity of Target Enrichment
On Popular NGS Platforms

26
Sample & Assay Technologies

GeneRead DNAseq Gene Panel: Performance data

Specificity
(% on-target reads)

Specificity (O...
Sample & Assay Technologies

DNAseq Gene Panel Application Data
KRAS:G12V is present in all three FFPE lung adenocarcinoma...
Sample & Assay Technologies

Next-generation sequencing workflow
Where does Library Quantification fit within the NGS work...
Sample & Assay Technologies

Why choose qPCR for NGS Library Quantification?

1. BioAnalyzer measures total nucleic acids
...
Sample & Assay Technologies

NGS Library Quantification Made Easy
Adapters can be quantified with qRT-PCR

Step 1: You hav...
Sample & Assay Technologies

NGS Library Quantification Made Easy
Adapters can be quantified with qRT-PCR

Step 1: You hav...
Sample & Assay Technologies

GeneRead DNAseq Library Quantification Array
Assess target enrichment / sample quality
Ratio ...
Sample & Assay Technologies

GeneRead Library Quantification System
NGS library quantification for any sequencing applicat...
Sample & Assay Technologies

GeneRead DNAseq & LQ System: Summary

 Focused:
 Biologically relevant content selection en...
Sample & Assay Technologies

GeneRead DNAseq Panel & Library Quant System for NGS
 Additional NGS Products



GeneRead ...
Sample & Assay Technologies

NOTES / ADDITIONAL INFORMATION

37
Sample & Assay Technologies

Genomic Information
http://hgdownload.cse.ucsc.edu/downloads.html#human

Human Genome build 1...
Sample & Assay Technologies

Species Compatibility

We currently support human samples with our GeneRead NGS Target
Enrich...
Sample & Assay Technologies

Working with UCSC Genome Browser: 2013-01-09
SOP: GeneRead DNAseq Gene Panels with UCSC Brows...
Upcoming SlideShare
Loading in …5
×

2013 02-14 - ngs webinar - sellappan

371 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
371
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
16
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

2013 02-14 - ngs webinar - sellappan

  1. 1. Sample & Assay Technologies GeneRead DNAseq Targeted Exon Enrichment & GeneRead Library Quantification System for Next Generation Sequencing Shankar Sellappan, Ph.D. Global Product Manager Shankar.Sellappan@QIAGEN.com 1
  2. 2. Sample & Assay Technologies Pathway-Focused Analysis Tools 2
  3. 3. Sample & Assay Technologies GeneRead DNAseq & Library Quant NGS System Agenda  Introduction  Targeted Enrichment  Workflow  Principles  Data Analysis  Pathway Content  Performance Data  Application Example  Library Quantification  Workflow  Application Example  Summary 3
  4. 4. Sample & Assay Technologies Individual participants Cell cycle P53 MDM2 Cyclins CDKs Biological Markers Define Biological Processes Angiogenesis VEGF bFGF ANGPT PDGF Inflammation IL8 TLR IFNγ TNFβ 4
  5. 5. Sample & Assay Technologies Complete Biological Story Built on Pathway / Network Analysis Angiogenesis Inflammation Pathway Cell cycle 5
  6. 6. Sample & Assay Technologies Patient sample = Wild-type = Determining DNA Differences ATGCCATCTGGGACGGGTCAGTAG ATGCCATCTGTGACGGGTCAGTAG How could that SINGLE base difference make the person sick? Let’s look at the amino acids that are translated in both samples: Patient sample DNA = Amino Acid Sequence = ATG CCA TCT GGG ACG GGT CAG TAG Met P S G T G Q Stop Valine Glycine Compare the two amino acid sequences: Patient sample AA Sequence = Wild-Type AA Sequence = Met P S G T G Q Stop Met P S V T G Q Stop If the wild-type protein, with the Valine positioned here, looked like: and in the patient sample, it is a Glycine, and it looks like: Well….the protein just won’t work. 6
  7. 7. Sample & Assay Technologies What is NGS (Next Generation Sequencing)? Massively Paralleled Sequencing Instead of sequencing a DNA sequence from Sequence many small pieces at the same time 7
  8. 8. Sample & Assay Technologies When doing NGS analysis, what are you looking for? Easy-to-use workflow and Data output Detection of Low Prevalence Somatic Mutation in FFPE Lung Adenocarcinoma Sample Human Lung Cancer GeneRead DNASeq Gene panel was used to enrich 20 genes in genomic DNA isolated from three FFPE lung adenocarcinoma and one FFPE normal lung samples. Sequencing data was analyzed using QIAGEN NGS Data Analysis Web Portal and high quality variants were filtered. 8
  9. 9. Sample & Assay Technologies Your NGS research needs  Identify low frequency DNA mutation variants  Work with low quality DNA samples, such as FFPE samples  Focus efforts on a focused set of genes important to their research  Simple methodology to make variant calls  Selective sequencing saves sequencing capacity 9
  10. 10. Sample & Assay Technologies Traditional NGS Workflow Isolate DNA Library Prep & Quantification NGS Sequence Analysis & Variant ID • Whole genome analysis • Too much irrelevant data • Poor quality reads / coverage 10
  11. 11. Sample & Assay Technologies New NGS Workflow with Targeted Enrichment 80 ng Achieve more sensitive mutation detection with 1 additional step • Focused on your genes of interest • Why look at all 20,000 genes in the human genome when you are interested in only a few? • Enables deep sequencing to ID low frequency mutation / rare variants • Integrated controls to assess target enrichment 11
  12. 12. Sample & Assay Technologies Target Enrichment: Principles Multiplex PCR-enabled enrichment of gene of interest We provide primer sets that produce overlapping PCR products • For any gene or set of genes in the human genome Division of non-adjacent gene primer sets into 4 tubes decreases non-specific amplification. 12
  13. 13. Sample & Assay Technologies Targeted Enrichment: Details ~ 150 bp PCR products 13
  14. 14. Sample & Assay Technologies Complete Analysis Workflow With integrated controls to assess sample quality / TE process Coming Soon! - QIAGEN GeneRead Library Preparation Kits (for IT and IL) QIAGEN GeneRead Size Selection Kits QIAGEN GeneRead Library Indexing Kits - QIAGEN NGS Platform 14
  15. 15. Sample & Assay Technologies NGS Sequence Analysis and Variant ID Software  FREE Complete & Easy to use Data Analysis with Web-based Software 15
  16. 16. Sample & Assay Technologies Read Mode: Paired End vs Single End Goal: Increased # of Reads / Amplicon Sequence of Interest: TACGCATCGATGCGGTAACTGCTGATCGTCGTAGTGCTAGCTGA Single End Sequencing: TACGCATCGATGCGGTAACTGCTGATCGTCGTAGTGCTAGCTGA Paired End Sequencing (both ends are sequenced): TACGCATCGATGCGGTAACTGCTGATCGTCGTAGTGCTAGCTGA AGTCGATCGTGATGCTGCTAGTCGTCAATGGCGTAGCTACGCAT
  17. 17. Sample & Assay Technologies How Genes on Panels Are Selected  Comprehensive Cancer Panel (124 genes)  Disease Focused Gene Panels (20 genes)  Breast cancer Liver cancer  Colon Cancer Lung Cancer  Gastric cancer Ovarian Cancer  Leukemia Prostate Cancer  Genes with High Relevance  Biologically relevant gene content  Clinically relevant: Published association with the disease state – Multiple Publically accessible databases – Text mining tools – Manually curated  Genes Involved in Disease ALSO AVAILABLE: Custom Panels from ANY GENE or COLLECTION OF GENES in Human Genome Technically relevant gene content  Most frequently mutated genes  Specific feedback from the thought leaders 17
  18. 18. Sample & Assay Technologies Targeted Enrichment: Panel Information
  19. 19. Sample & Assay Technologies NGS Target Enrichment Design Strategy Commonly encountered issues solved by GeneRead Algorithm • Design Coverage • How much of the gene is covered by your amplicons • Sequence Coverage Uniformity • How much ease base pair is covered: Ideally, it should be uniform • Specificity • % of reads mapped back to your sequence of interest 19
  20. 20. Sample & Assay Technologies Design Coverage Information Provided Base Pairs Covered 20
  21. 21. Sample & Assay Technologies Coordinate Information
  22. 22. Sample & Assay Technologies BED File Information M1 = Covered Regions M*1 = Uncovered Regions 22
  23. 23. Sample & Assay Technologies Gene Visualization with UCSC Genome Browser Instructions will be provided online at SABiosciences.com 23
  24. 24. Sample & Assay Technologies GeneRead DNAseq Gene Panel: Performance data % Covered by Design Design coverage GeneRead DNAseq Custom Panel GeneRead DNAseq Lung Cancer Panel GeneRead DNAseq Comprehensive Cancer Panel Discover more potential variants by covering more exons for genes of interest in assay design 24
  25. 25. Sample & Assay Technologies GeneRead DNAseq Gene Panel: Performance data Sequence coverage uniformity GeneRead DNAseq Custom Panel GeneRead DNAseq Lung Cancer Panel GeneRead DNAseq Comprehensive Cancer Panel More bases sequenced above minimum read depth, generating more high-quality consensus calls. 25
  26. 26. Sample & Assay Technologies Multiplexing Capacity of Target Enrichment On Popular NGS Platforms 26
  27. 27. Sample & Assay Technologies GeneRead DNAseq Gene Panel: Performance data Specificity (% on-target reads) Specificity (On-target reads)* GeneRead DNAseq Custom Panel GeneRead DNAseq Lung Cancer Panel GeneRead DNAseq Comprehensive Cancer Panel No wasting of sequencing capacity * On-Target Reads= Number of reads on target out of total number of reads per run 27
  28. 28. Sample & Assay Technologies DNAseq Gene Panel Application Data KRAS:G12V is present in all three FFPE lung adenocarcinomas Detection of Low Prevalence Somatic Mutation in FFPE Lung Adenocarcinoma Sample Human Lung Cancer GeneRead DNASeq Gene panel was used to enrich 20 genes in genomic DNA isolated from three FFPE lung adenocarcinoma and one FFPE normal lung samples. Sequencing data was analyzed using QIAGEN NGS Data Analysis Web Portal and high quality variants were filtered. NOTE: KRAS mutations confirmed by either Pyro or ARMS mutation assays (qBiomarker Somatic Mutation PCR Array) 28
  29. 29. Sample & Assay Technologies Next-generation sequencing workflow Where does Library Quantification fit within the NGS workflow? Purification and amplification Sample enrichment Library preparation Next generation sequencing run Result verification (Optional) GeneRead (DNAseq) Library Quantification and QC System Why do you want to: 1. quantify their NGS DNA libraries 2. know the quality of their NGS DNA libraries?  You have to, in order to ensure high quality reads  Sequencing runs are expensive and time consuming, therefore, you want to ensure that downstream sequencing analyses are performed on samples of adequate quality for NGS technology. 29
  30. 30. Sample & Assay Technologies Why choose qPCR for NGS Library Quantification? 1. BioAnalyzer measures total nucleic acids - Why is this a problem? 2. Low limit of detection 3. Consistency of results - For each technology, the greater the concentration of each sample (X-axis), the greater the # of clusters - This should be a linear relationship - Only qPCR provides this 30
  31. 31. Sample & Assay Technologies NGS Library Quantification Made Easy Adapters can be quantified with qRT-PCR Step 1: You have your DNA (whole genome or target enriched) Step 2: You prepare the DNA library for NGS by adding (via ligation) NGS platformspecific adapters  NOTE: The adapters are short pieces of DNA Step 3: We provide you 2 reagents: 1. Pre-aliquoted dilutions of the standard 2. qPCR Primer Assays that detect the adapters Step 4: You perform qPCR with your sample. It should fall between our standard curve created with 5 sequential 10-fold dilutions. THAT is your library concentration to use in preparing your NGS analysis. 31
  32. 32. Sample & Assay Technologies NGS Library Quantification Made Easy Adapters can be quantified with qRT-PCR Step 1: You have your DNA (whole genome or target enriched) Step 2: You prepare the DNA library for NGS by adding (via ligation) NGS platformspecific adapters  NOTE: The adapters are short pieces of DNA Step 3: We provide you 2 reagents: 1. Pre-aliquoted dilutions of the standard 2. qPCR Primer Assays that detect the adapters Step 4: You perform qPCR with your sample. It should fall between our standard curve created with 5 sequential 10-fold dilutions. THAT is your library concentration to use in preparing your NGS analysis. 32
  33. 33. Sample & Assay Technologies GeneRead DNAseq Library Quantification Array Assess target enrichment / sample quality Ratio of Target DNA : Control DNA Quality of DNA Input to NGS 33
  34. 34. Sample & Assay Technologies GeneRead Library Quantification System NGS library quantification for any sequencing application , Ion Proton 34
  35. 35. Sample & Assay Technologies GeneRead DNAseq & LQ System: Summary  Focused:  Biologically relevant content selection enables deep sequencing on relevant genes and identification of rare mutations  Flexible:  Mix and match any gene of interest  NGS platform independent:  Functionally validated for IT PGM, MiSeq/HiSeq  Integrated controls:  Enabling quality control of prepared library before sequencing  Free, complete and easy of use data analysis tool 35
  36. 36. Sample & Assay Technologies GeneRead DNAseq Panel & Library Quant System for NGS  Additional NGS Products   GeneRead rRNA Depletion Kit REPLI-g Mini Kit  Coming Soon   GeneRead Library Preparation Kits GeneRead Size Selection Kits Starter Pack Promotion Available to U.S. Customers - Look in email I send to you Questions? Contact Technical Support: 9 AM – 6 PM M – F ET Contact: 1-800-742-4368 OR support@SABiosciences.com Shankar Sellappan, Ph.D. (Global Product Manager) Shankar.Sellappan@QIAGEN.com Ph.D. Trained Application Scientists  Available Before, During, and After Your Experiments for Consultation / Help 36
  37. 37. Sample & Assay Technologies NOTES / ADDITIONAL INFORMATION 37
  38. 38. Sample & Assay Technologies Genomic Information http://hgdownload.cse.ucsc.edu/downloads.html#human Human Genome build 19: hg19 38
  39. 39. Sample & Assay Technologies Species Compatibility We currently support human samples with our GeneRead NGS Target Enrichment Panels. For the LQ kit (the generic version), it could be used on any species, as the adaptors are species independent. 39
  40. 40. Sample & Assay Technologies Working with UCSC Genome Browser: 2013-01-09 SOP: GeneRead DNAseq Gene Panels with UCSC Browser 1. Have BED file for gene list with amplicon coordinates 2. Go to UCSC Genome Browser: http://genome.ucsc.edu/cgi-bin/hgGateway 3. Click: add custom tracks 40

×