Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

7.5.2018, Παρουσίαση Αθ. Τσαυτάρη στην εκδήλωση του Κύκλου Ιδεών

96 views

Published on

Παρουσίαση Αθανάσιου Τσαυτάρη στην εκδήλωση του Κύκλου Ιδεών στη Θεσσαλονίκη, 7.5.2018, "Η ΕΛΛΑΔΑ ΜΕΤΑ: ΕΛΠΙΔΕΣ ΚΑΙ ΚΙΝΔΥΝΟΙ. Προετοιμάζοντας την περίοδο 2019 -2022"

https://ekyklos.gr/ev/598-7-5-2018-i-ellada-meta-elpides-kai-kindynoi.html

Published in: Data & Analytics
  • Be the first to comment

7.5.2018, Παρουσίαση Αθ. Τσαυτάρη στην εκδήλωση του Κύκλου Ιδεών

  1. 1. ΓΕΝΕΤΙΚΗ
  2. 2. Οι Ολυμπιακοί ήταν οι παλαιότεροι και πιο σημαντικοί από όλους τους ελληνικούς αγώνες. Ήταν η μεγαλύτερη θρησκευτική γιορτή, ανάμεσα στις γιορτές τις αφιερωμένες στο Δία, τον ανώτατο θεό. Το ιερό της Ολυμπίας επέβαλλε το κύρος του σε ολόκληρο τον ελληνικό κόσμο, ενώ σύντομα οι Ολυμπιακοί Αγώνες έγιναν το σύμβολο της πανελλήνιας ενότητας. Οι Ολυμπιακοί Αγώνες τελούνταν κάθε τέσσερα χρόνια τις πιο ζεστές ημέρες του καλοκαιριού. Μια σειρά αθλητικών αγώνων γίνονταν στο Στάδιο, το Ιπποδρόμιο και άλλους χώρους της θέσης, μπροστά σε χιλιάδες θεατές από όλες τις πόλεις του γνωστού ελληνικού κόσμου. Οι νικητές στεφανώνονταν με ένα στεφάνι αγριελιάς και απολάμβαναν ιδιαίτερες τιμές από την πατρίδα τους. Γενετική Γονιδιωματική Αναγνώριση βάσης Ποιότητα αλληλουχίας Απομάκρυνση φορέα Σύνδεση αλληλουχιών Αυτόματη αλληλούχιση λογισμικό >Gene ACCTGTCAGTGTCAACTGCTTCAA TAGCTAATGCTAGGCTCGATAATC GCTGGCCTCAGCTCAGTCT
  3. 3. ΤΟ ΑΝΘΡΩΠΙΝΟ ΓΟΝΙΔΙΩΜΑ
  4. 4. ΦΑΙΝΟΤΥΠΟΣ DNA RNA Πρωτεΐνες
  5. 5. ΥΨΟΣ ΒΑΡΟΣ ΧΟΛΗΣΤΕΡΙΝΗ ΣΑΚΧΑΡΟ ΣΤΟΡΓΙΚΟΤΗΤΑ ΣΥΓΚΕΝΤΡΩΣΗ ΣΥΜΠΟΝΟΙΑ ΦΑΙΝΟΤΥΠΟΣ
  6. 6. ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΕΠΙΓΟΝΙΔΙΩΜΑΤΙΚΗ Κληρονομήσιμη αλλαγή χαρακτήρων που δεν περιλαμβάνει αλλαγή στην αλληλουχία του DNA Κληρονομήσιμη αλλαγή χαρακτήρων που περιλαμβάνει αλλαγή στην αλληλουχία του DNA M M M M M M M M M M M M M ΚΑΛΟΣ ΚΑΚΟΣ ΠΑΝΩΡΑΙΑ ΩΡΑΙΑ Καλός Κάλος
  7. 7. Small Seed Large Seed
  8. 8. CH3 ΕΠΙΔΙΑΤΡΟΦΙΚΗ ΑΞΙΑ ΛΑΧΑΝΙΚΩΝ
  9. 9. ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΜΕΤΑΓΟΝΙΔΙΩΜΑΤΙΚΗ
  10. 10. ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΜΕΤΑΓΟΝΙΔΙΩΜΑΤΙΚΗ
  11. 11. ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΜΕΤΑΓΟΝΙΔΙΩΜΑΤΙΚΗ
  12. 12. ΔΗΜΙΟΥΡΓΙΑ ΝΕΩΝ ΠΟΙΚΙΛΙΩΝ 1ο 2ο ΚΑΛΛΙΕΡΓΕΙΑ ΜΕΤΑΠΟΙΗΣΗ 3ο Γονιδιωματικές Τεχνολογίες
  13. 13. ΕΠΑΝΑΣΤΟΙΧΕΙΟΘΕΤΗΣΗ
  14. 14. Οι τέσσερις περίοδοι στη Βελτίωση των Φυτὠν Συμβατική Βελτίωση Μοριακή Βελτίωση Γενετική Μηχανική Επαναστοιχειοθέτηση Νέαποικιλία 15 χρόνια επιλογής 4 χρόνια επιλογής   Αποκοπή και μεταφορά 1-2 έτη Λ Λ Λ Κ Επαναστοιχειοθέτηση του Κ με το Λ 3 μήνες ¶ ¶

×