Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Clase I Asuntos filosóficos de la psicología fisiológica: una introducción   Elizabeth Torres Millayes, Psy.D.
¿Qué es la Biopsicología? <ul><li>Es el estudio científico de la biología de la conducta. </li></ul><ul><ul><li>Es el enfo...
Relación entre la biopsicologia y otras disciplinas <ul><li>Neuroanatomia: estudio de la estructura del sistema nervioso. ...
Divisiones de la Biopsicología <ul><li>Psicología Fisiológica:  </li></ul><ul><ul><li>Estudia mecanismos neurales de la co...
Divisiones de la Biopsicología (Cont) <ul><li>Psicofisiología: </li></ul><ul><ul><li>Estudio de la relación entre la activ...
¿Y qué tienen en común? <ul><li>Estudian la mente y las conductas desde un punto de vista biológico. </li></ul>
Investigaciones en biopsicologia  <ul><li>Estudian humanos y animales.  </li></ul><ul><ul><li>Ratas, ratones, gatos, perro...
Investigaciones en biopsicologia <ul><li>Se estudian a los animales por la continuidad evolutiva del encéfalo.  </li></ul>...
Investigaciones en biopsicologia <ul><li>Ventajas de los estudios con animales:  </li></ul><ul><ul><li>Los encéfalos y con...
Métodos de investigación en la biopsicología <ul><li>Estudio experimental : examen sistemático y controlado de causa y efe...
Métodos de investigación en la biopsicología <ul><ul><li>Por lo menos se involucran dos tipos de grupos de sujetos:  </li>...
Métodos de investigación en la biopsicología <ul><ul><li>Ventajas: (1) aislar variables mediante grupos de control experim...
Estudios cuasiexperimentales <ul><li>Parecen experimentos pero no son verdaderos experimentos porque las posibles variable...
Métodos de investigación en la psicología <ul><li>Estudio de caso </li></ul><ul><ul><li>Detallada descripción y análisis d...
Investigaciones básicas y aplicadas <ul><li>Investigación básica: esta motivada por la curiosidad del investigador. </li><...
Deducción científica   <ul><li>Método fundamental de la biopsicologia para descubrir algo mediante una observación cuidado...
Juicio critico sobre las tesis biopsicologicas   <ul><li>Evaluar si se ha publicado en una revista científica acreditada. ...
Problema Mente-Cuerpo <ul><li>Antiguo supuesto filosófico. </li></ul><ul><li>Rene Descartes (1596-1650) </li></ul><ul><ul>...
“ El error de Descartes” <ul><li>Antonio Damasio (1994) </li></ul><ul><ul><li>“ La naturaleza aparenta que ha construido e...
Entonces,  ¿quién tiene la razón?
La Conducta <ul><li>Definición:  </li></ul><ul><ul><li>Cualquier actividad humana o animal que pueda observarse y medirse ...
Conductas, ¿Qué sabemos? <ul><li>Todos los seres vivos ejecutan conductas. </li></ul><ul><li>Cada especie posee conductas ...
Bases de la Conducta: Ejemplos <ul><li>Biológica </li></ul><ul><li>Cerebro </li></ul><ul><li>Reflejos </li></ul><ul><li>Me...
¿Cómo se estudian las bases de las conductas humanas?
Sociedad Biología Psique El Modelo Biopsicosocial
<ul><li>Modelo  </li></ul><ul><li>Bio psico social </li></ul><ul><li>Integra los asuntos biológicos, psicológicos y social...
La evolución del hombre
Evolución <ul><li>Carles Darwin:  El Origen de las Especies  (1859) </li></ul><ul><li>Postula la teoría de la Evolución. <...
La evolución del cerebro <ul><li>El tamaño del cerebro no define la inteligencia. </li></ul><ul><ul><li>Elefante </li></ul...
La evolución del cerebro <ul><li>El encéfalo ha aumentado de tamaño. </li></ul><ul><li>El aumento ha sido mas en el cerebr...
El cerebro Triuno <ul><li>Paul McLean (1990) </li></ul><ul><li>Expone que el cerebro ha evolucionado. </li></ul><ul><li>Lo...
Los seres humanos son la única especie que tiene consciencia sobre sus conductas.
La Consciencia <ul><li>Percatarse de lo que pasa a través de los sentidos, las emociones, pensamientos y de nuestra propia...
Niveles de Consciencia <ul><li>Alerta </li></ul><ul><ul><li>Pendiente a estímulos internos y externos </li></ul></ul><ul><...
¿Cómo funciona la consciencia? <ul><li>Se relaciona con los niveles de atención. </li></ul><ul><li>Requiere de la regulaci...
La conducta, ¿es genética o aprendida? El dilema vs. Nurture Nature
Herencia vs ambiente <ul><li>Dicotomias tradicionales </li></ul><ul><ul><li>John B. Watson : conductismo </li></ul></ul><u...
Un modelo de la biología de la conducta  Evolución Genes Experiencia Organismo  en el momento Situación Actual Conducta  A...
Psicología evolucionista <ul><li>Entender la conducta humana considerando las presiones que llevaron a su evolución </li><...
Psicología evolucionista <ul><li>El vinculo de apareamiento se desarrolla por que las hembras mamíferas paren una cantidad...
Psicología evolucionista <ul><li>Poligamia </li></ul><ul><ul><li>Las hembras hacen una mayor aportación en la crianza de l...
Psicología evolucionista <ul><li>Monogamia:  </li></ul><ul><ul><li>Un macho y una hembra. </li></ul></ul><ul><li>Teoría de...
Psicología evolucionista <ul><li>Cont. Teoría de la evolución de elección de pareja: (Buss, 1992) </li></ul><ul><ul><li>El...
Clase II: Genética  y  Genética Conductual
Genética <ul><li>El origen de todo ser vivo. </li></ul><ul><li>Estudia las variaciones biológicas (herencia). </li></ul><u...
Genética <ul><li>Cont. Gregorio Mendel (1865) </li></ul><ul><ul><li>Genotipo:  </li></ul></ul><ul><ul><ul><li>material gen...
Genética <ul><li>Cont. Gregorio Mendel (1865) </li></ul><ul><ul><li>Estudios con guisantes:  </li></ul></ul><ul><ul><ul><l...
Genética <ul><li>Mendel propuso que existen dos tipos de factores hereditarios para cada rasgo dicotómico.  </li></ul><ul>...
Características heredadas <ul><li>Homocigoto  </li></ul><ul><ul><li>Dos genes idénticos para un rasgo </li></ul></ul><ul><...
ADN La información genética se encuentra en una secuencia de aminoácidos, en el núcleo de las células, llamado Ácido Deoxi...
Genes <ul><li>Son la unidad de herencia definidos por la secuencia de bases nitrogenadas y aminoácidos. </li></ul><ul><li>...
<ul><li>Deficiencias en Genes </li></ul><ul><li>Se pueden dar mutaciones en el orden de la secuencia de bases pares, ya se...
Cromosoma <ul><li>Estructuras filiformes en el núcleo de la célula. </li></ul><ul><li>Conjunto de la hélice de ADN. </li><...
Estructura del cromosoma
Algunas Anomalías Cromosómicas
Genoma <ul><li>Todo el material genético contenido en los cromosomas de un organismo. </li></ul><ul><li>El ser humano tien...
En resumen…
División Celular <ul><li>Mitosis </li></ul><ul><ul><li>División en células somáticas. </li></ul></ul><ul><ul><li>Producto:...
<ul><li>Mitosis </li></ul><ul><li>Profase </li></ul><ul><li>Metafase </li></ul><ul><li>Anafase </li></ul><ul><li>Telofase ...
Pasos división celular:  Mitosis vs. Meiosis
Genética Conductual <ul><li>Intenta buscar qué diferencias genéticas son responsables (en conjunto con la ambiental) de ra...
EU GENICS ( del griego )   EU  = bueno GENICS =generación
Francis Galton: Eugenics <ul><li>Notó que los hijos de las personas inteligentes de su época, también eran inteligentes. <...
Métodos de investigación en la Genética y Genética Conductual <ul><li>Estudios estadísticos   </li></ul><ul><li>Concordanc...
<ul><li>Estudios Moleculares:   </li></ul><ul><li>Polymerase Chain Reaction (PCR) </li></ul><ul><ul><li>Método para amplif...
Condiciones estudiadas <ul><li>Alcoholismo </li></ul><ul><li>Autismo </li></ul><ul><li>ADHD </li></ul><ul><li>Depresión </...
Human Genome Project <ul><li>Human Genome Project </li></ul><ul><ul><li>Esfuerzo internacional que busca identificar todos...
¿Qué se hereda? (cont) <ul><li>Se hereda la mitad de la información genética de padre y de madre. </li></ul><ul><li>Los ge...
Upcoming SlideShare
Loading in …5


Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 1 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 2 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 3 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 4 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 5 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 6 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 7 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 8 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 9 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 10 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 11 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 12 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 13 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 14 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 15 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 16 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 17 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 18 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 19 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 20 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 21 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 22 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 23 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 24 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 25 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 26 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 27 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 28 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 29 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 30 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 31 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 32 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 33 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 34 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 35 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 36 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 37 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 38 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 39 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 40 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 41 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 42 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 43 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 44 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 45 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 46 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 47 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 48 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 49 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 50 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 51 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 52 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 53 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 54 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 55 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 56 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 57 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 58 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 59 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 60 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 61 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 62 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 63 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 64 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 65 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 66 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 67 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 68 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 69 Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las Slide 70
Upcoming SlideShare
Celulas sistema nervioso
Download to read offline and view in fullscreen.



Download to read offline

Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las

Download to read offline

Related Books

Free with a 30 day trial from Scribd

See all

Related Audiobooks

Free with a 30 day trial from Scribd

See all
  • Be the first to like this

Clase i y_ii_asuntos_filos_ficos_de_la_psicolog_a_fisiol_gica_y_las

  1. 1. Clase I Asuntos filosóficos de la psicología fisiológica: una introducción Elizabeth Torres Millayes, Psy.D.
  2. 2. ¿Qué es la Biopsicología? <ul><li>Es el estudio científico de la biología de la conducta. </li></ul><ul><ul><li>Es el enfoque biológico del estudio de la psicología. </li></ul></ul><ul><ul><li>“ La organizacion de la conducta” por D.O. Hebb : Nacimiento de la ciencia. </li></ul></ul><ul><ul><ul><li>Como la actividad cerebral produce fenómenos psicológicos. </li></ul></ul></ul>
  3. 3. Relación entre la biopsicologia y otras disciplinas <ul><li>Neuroanatomia: estudio de la estructura del sistema nervioso. </li></ul><ul><li>Neuroquimica: estudio de las bases químicas de la actividad neural. </li></ul><ul><li>Neuroendocrinologia: estudio de las interacciones entre el sistema nervioso y el sistema endocrino. </li></ul><ul><li>Neuropatologia: estudio de los trastornos del sistema nervioso. </li></ul><ul><li>Neurofarmacologia: estudio de los efectos de los farmacos sobre la actividad neural. </li></ul><ul><li>Neurofisiologia: estudio de las funciones y la actividad del sistema nervioso. </li></ul>
  4. 4. Divisiones de la Biopsicología <ul><li>Psicología Fisiológica: </li></ul><ul><ul><li>Estudia mecanismos neurales de la conducta a través de la manipulación directa del cerebro. </li></ul></ul><ul><li>Psicofarmacología: </li></ul><ul><ul><li>Enfatiza la manipulación de la actividad neural y conducta con drogas. </li></ul></ul><ul><li>Neuropsicología: </li></ul><ul><ul><li>Estudio de los efectos psicológicos de daño cerebral en humanos. </li></ul></ul>
  5. 5. Divisiones de la Biopsicología (Cont) <ul><li>Psicofisiología: </li></ul><ul><ul><li>Estudio de la relación entre la actividad fisiológica y los procesos psicológicos en humanos. </li></ul></ul><ul><li>Neurociencia Cognoscitiva: </li></ul><ul><ul><li>Estudia los mecanismos neurales de la cognición humana. </li></ul></ul><ul><li>Psicología Comparativa: </li></ul><ul><ul><li>Estudia la evolución, genética y capacidad adaptativa de la conducta a través de las diversas especies. </li></ul></ul>
  6. 6. ¿Y qué tienen en común? <ul><li>Estudian la mente y las conductas desde un punto de vista biológico. </li></ul>
  7. 7. Investigaciones en biopsicologia <ul><li>Estudian humanos y animales. </li></ul><ul><ul><li>Ratas, ratones, gatos, perros y primates. </li></ul></ul><ul><li>Con los humanos hay varias ventajas de investigación: </li></ul><ul><ul><li>Siguen instrucciones </li></ul></ul><ul><ul><li>Pueden comunicar sus experiencias </li></ul></ul><ul><ul><li>Pueden ser mas económicos </li></ul></ul><ul><ul><li>Cerebros humanos </li></ul></ul>
  8. 8. Investigaciones en biopsicologia <ul><li>Se estudian a los animales por la continuidad evolutiva del encéfalo. </li></ul><ul><ul><li>Se diferencian en su tamaño global y en el grado de desarrollo cortical. </li></ul></ul><ul><ul><li>Son diferencias cuantitativas y no cualitativas. </li></ul></ul>
  9. 9. Investigaciones en biopsicologia <ul><li>Ventajas de los estudios con animales: </li></ul><ul><ul><li>Los encéfalos y conductas son mas sencillas. </li></ul></ul><ul><ul><li>El enfoque comparativo </li></ul></ul><ul><ul><li>Se pueden hacer investigaciones que no se permiten en humanos. </li></ul></ul>
  10. 10. Métodos de investigación en la biopsicología <ul><li>Estudio experimental : examen sistemático y controlado de causa y efecto. </li></ul><ul><ul><li>El propósito es probar relaciones de causa y efecto. </li></ul></ul><ul><ul><li>Variable independiente: tratamiento que los investigadores controlan o manipulan. </li></ul></ul><ul><ul><li>Variable dependiente: el fenómeno que es tratado como un efecto o resultado. </li></ul></ul>
  11. 11. Métodos de investigación en la biopsicología <ul><ul><li>Por lo menos se involucran dos tipos de grupos de sujetos: </li></ul></ul><ul><ul><ul><li>Grupo experimental: expuesto al tratamiento experimental </li></ul></ul></ul><ul><ul><ul><li>Grupo control: expuesto a todas las condiciones experimentales, excepto al tratamiento experimental. </li></ul></ul></ul><ul><ul><li>Asignación aleatoria </li></ul></ul>
  12. 12. Métodos de investigación en la biopsicología <ul><ul><li>Ventajas: (1) aislar variables mediante grupos de control experimental. (2) Otros investigadores pueden repetir el experimento para verificar los resultados. </li></ul></ul><ul><ul><li>Desventajas: (1) un investigador puede manipular sólo un pequeño número de variable. (2) Las situaciones que un investigador crea en un laboratorio quizás no refleje el “mundo real”. </li></ul></ul>
  13. 13. Estudios cuasiexperimentales <ul><li>Parecen experimentos pero no son verdaderos experimentos porque las posibles variables extrañas no se han controlado. </li></ul>
  14. 14. Métodos de investigación en la psicología <ul><li>Estudio de caso </li></ul><ul><ul><li>Detallada descripción y análisis de una o pocas personas </li></ul></ul><ul><ul><li>Lo más usado en psicología </li></ul></ul><ul><ul><li>El sesgo del investigador puede ser problema </li></ul></ul><ul><ul><li>No se pueden hacer generalizaciones </li></ul></ul>
  15. 15. Investigaciones básicas y aplicadas <ul><li>Investigación básica: esta motivada por la curiosidad del investigador. </li></ul><ul><ul><li>Adquirir conocimiento </li></ul></ul><ul><li>Investigación aplicada: investigación encaminada a lograr algún beneficio directo para la humanidad. </li></ul>
  16. 16. Deducción científica <ul><li>Método fundamental de la biopsicologia para descubrir algo mediante una observación cuidadosa. </li></ul><ul><ul><li>Método científico </li></ul></ul><ul><ul><li>Deducción científica: deducir lógicamente lo que no pueden observar. </li></ul></ul>
  17. 17. Juicio critico sobre las tesis biopsicologicas <ul><li>Evaluar si se ha publicado en una revista científica acreditada. </li></ul><ul><li>Esto garantiza la evaluación y aprobación de los especialistas del tema. </li></ul>
  18. 18. Problema Mente-Cuerpo <ul><li>Antiguo supuesto filosófico. </li></ul><ul><li>Rene Descartes (1596-1650) </li></ul><ul><ul><li>Teoría del Dualismo </li></ul></ul><ul><ul><li>Cogito Ergo Sum (“Pienso, luego existo”) </li></ul></ul><ul><ul><ul><li>Mente y Cuerpo son dos sustancias diferentes, pero interaccionan: </li></ul></ul></ul><ul><ul><ul><ul><li>El cuerpo afecta a la mente en la percepción. </li></ul></ul></ul></ul><ul><ul><ul><ul><li>La mente afecta al cuerpo en la acción deliberada. </li></ul></ul></ul></ul><ul><li>¿Pensamos así? </li></ul>
  19. 19. “ El error de Descartes” <ul><li>Antonio Damasio (1994) </li></ul><ul><ul><li>“ La naturaleza aparenta que ha construido el aparato de la racionalidad no solo para estar al frente de la regulación biológica, sino también para venir de ella y estar con ella”. </li></ul></ul><ul><li>La mente (el cerebro) es parte del cuerpo, y éstos se influencian bilateralmente laborando de forma integrada, produciendo las conductas. </li></ul>
  20. 20. Entonces, ¿quién tiene la razón?
  21. 21. La Conducta <ul><li>Definición: </li></ul><ul><ul><li>Cualquier actividad humana o animal que pueda observarse y medirse objetivamente. </li></ul></ul>
  22. 22. Conductas, ¿Qué sabemos? <ul><li>Todos los seres vivos ejecutan conductas. </li></ul><ul><li>Cada especie posee conductas propias. </li></ul><ul><ul><li>Se repiten a través de las generaciones. </li></ul></ul><ul><li>Todas tienen un objetivo. </li></ul><ul><li>Tienen bases biológicas, psicológicas y sociales. </li></ul>
  23. 23. Bases de la Conducta: Ejemplos <ul><li>Biológica </li></ul><ul><li>Cerebro </li></ul><ul><li>Reflejos </li></ul><ul><li>Metabolismo </li></ul><ul><li>Genética </li></ul><ul><li>Psicológica </li></ul><ul><li>Emoción </li></ul><ul><li>Motivación </li></ul><ul><li>Introspección </li></ul><ul><li>Funciones Ejecutivas </li></ul><ul><li>Social </li></ul><ul><li>Aprendizaje </li></ul><ul><li>Validación </li></ul><ul><li>Liderazgo </li></ul><ul><li>Conversación </li></ul>
  24. 24. ¿Cómo se estudian las bases de las conductas humanas?
  25. 25. Sociedad Biología Psique El Modelo Biopsicosocial
  26. 26. <ul><li>Modelo </li></ul><ul><li>Bio psico social </li></ul><ul><li>Integra los asuntos biológicos, psicológicos y sociales como sistemas del cuerpo. </li></ul><ul><li>Surge en 1977 (George Engel) como un movimiento para estudiar más efectivamente al ser humano en un contexto médico. </li></ul><ul><li>Explica de forma integrada cómo influyen los sistemas en el ser humano. </li></ul>
  27. 27. La evolución del hombre
  28. 29. Evolución <ul><li>Carles Darwin: El Origen de las Especies (1859) </li></ul><ul><li>Postula la teoría de la Evolución. </li></ul><ul><ul><li>Las evidencias para esta teoría fueron: </li></ul></ul><ul><ul><ul><li>Evolución de fósiles. </li></ul></ul></ul><ul><ul><ul><li>Similaridades de extremidades </li></ul></ul></ul><ul><ul><ul><li>Cambios en las plantas y animales en crianza selectiva. </li></ul></ul></ul><ul><ul><ul><li>Cambios en el pico de aves. </li></ul></ul></ul><ul><li>Establece el concepto de selección natural. </li></ul><ul><ul><li>Adaptación. </li></ul></ul><ul><ul><li>Variación. </li></ul></ul><ul><ul><li>Sobrereproducción. </li></ul></ul><ul><ul><li>El mas fuerte sobrevive. </li></ul></ul>
  29. 30. La evolución del cerebro <ul><li>El tamaño del cerebro no define la inteligencia. </li></ul><ul><ul><li>Elefante </li></ul></ul><ul><ul><li>Einstein </li></ul></ul><ul><li>Tronco del encéfalo: supervivencia </li></ul><ul><li>Cerebro: procesos adaptativos complejos. </li></ul>
  30. 31. La evolución del cerebro <ul><li>El encéfalo ha aumentado de tamaño. </li></ul><ul><li>El aumento ha sido mas en el cerebro. </li></ul><ul><li>Hay un incremento en la cantidad de circunvoluciones cerebrales. </li></ul>
  31. 32. El cerebro Triuno <ul><li>Paul McLean (1990) </li></ul><ul><li>Expone que el cerebro ha evolucionado. </li></ul><ul><li>Los humanos tenemos tres cerebros en uno. </li></ul><ul><ul><li>Primitivo o Reptiliano (reptiles y aves) </li></ul></ul><ul><ul><ul><li>Tallo Cerebral y Cerebelo. </li></ul></ul></ul><ul><ul><ul><ul><li>Sobrevivencia. </li></ul></ul></ul></ul><ul><ul><li>Intermedio o Sistema Límbico (mamíferos) </li></ul></ul><ul><ul><ul><li>Primitivo + Sistema Límbico. </li></ul></ul></ul><ul><ul><ul><ul><li>Emociones-Paranoia, miedos. </li></ul></ul></ul></ul><ul><ul><li>Neocorteza (primates y humanos) </li></ul></ul><ul><ul><ul><li>Racionalidad. </li></ul></ul></ul>
  32. 33. Los seres humanos son la única especie que tiene consciencia sobre sus conductas.
  33. 34. La Consciencia <ul><li>Percatarse de lo que pasa a través de los sentidos, las emociones, pensamientos y de nuestra propia consciencia. </li></ul><ul><li>La conciencia, definida sencillamente, es el estado de darse cuenta. </li></ul><ul><li>Explícita/Implícita </li></ul>Cortesía Dra. M. Camacho, PUCPR 2005
  34. 35. Niveles de Consciencia <ul><li>Alerta </li></ul><ul><ul><li>Pendiente a estímulos internos y externos </li></ul></ul><ul><li>Letargo o Somnolencia </li></ul><ul><ul><li>No totalmente alerta y muestra de sueño cuando no se estimula activamente. </li></ul></ul><ul><li>Obtundación o confusión </li></ul><ul><ul><li>Difícil de estar pendiente de alertar, y cuando se hace, está confundido. </li></ul></ul><ul><li>Estupor o semicoma </li></ul><ul><ul><li>Solo responde a estimulación persistente o vigorosa. </li></ul></ul><ul><li>Coma </li></ul><ul><ul><li>No reacciona a estimulación. </li></ul></ul>
  35. 36. ¿Cómo funciona la consciencia? <ul><li>Se relaciona con los niveles de atención. </li></ul><ul><li>Requiere de la regulación de todo el sistema nervioso para: </li></ul><ul><ul><li>estar alerta, </li></ul></ul><ul><ul><li>seleccionar el estímulo, </li></ul></ul><ul><ul><li>focalizar en él, y </li></ul></ul><ul><ul><li>sostener la atención </li></ul></ul><ul><li>Envuelve principalmente el Tallo Cerebral, Sistema Límbico y Lóbulo frontal (corteza prefrontal). </li></ul>
  36. 37. La conducta, ¿es genética o aprendida? El dilema vs. Nurture Nature
  37. 38. Herencia vs ambiente <ul><li>Dicotomias tradicionales </li></ul><ul><ul><li>John B. Watson : conductismo </li></ul></ul><ul><ul><li>En contra de la dicotomia: </li></ul></ul><ul><ul><ul><li>Evidencia que cambios psicológicos complejos pueden ser causados por lesiones o estimulaciones cerebrales. </li></ul></ul></ul><ul><ul><ul><li>Algunos animales tienen capacidades que antes se creían que eran únicamente humanas. </li></ul></ul></ul>
  38. 39. Un modelo de la biología de la conducta Evolución Genes Experiencia Organismo en el momento Situación Actual Conducta Actual
  39. 40. Psicología evolucionista <ul><li>Entender la conducta humana considerando las presiones que llevaron a su evolución </li></ul><ul><li>Vínculos del apareamiento: relaciones de apareamiento duraderas. </li></ul><ul><ul><li>El apareamiento es totalmente promiscuo en la mayoría de las especies. </li></ul></ul>
  40. 41. Psicología evolucionista <ul><li>El vinculo de apareamiento se desarrolla por que las hembras mamíferas paren una cantidad relativamente pequeñas de crías indefensas y que se desarrollan lentamente (Trivers, 1972). </li></ul><ul><li>El macho puede traspasar sus características hereditarias. </li></ul>
  41. 42. Psicología evolucionista <ul><li>Poligamia </li></ul><ul><ul><li>Las hembras hacen una mayor aportación en la crianza de las crías. </li></ul></ul><ul><ul><li>Los machos pueden engendrar muchos descendientes. </li></ul></ul><ul><li>Poliandria </li></ul><ul><ul><li>La hembra establece vínculos de apareamiento con más de un macho. </li></ul></ul><ul><ul><li>Los machos contribuyen más a la reproducción. </li></ul></ul>
  42. 43. Psicología evolucionista <ul><li>Monogamia: </li></ul><ul><ul><li>Un macho y una hembra. </li></ul></ul><ul><li>Teoría de la evolución de elección de pareja: (Buss, 1992) </li></ul><ul><ul><li>Los hombres de la mayoría de las culturas valoran la juventud y el atractivo en sus parejas más de lo que lo hacen las mujeres. </li></ul></ul><ul><ul><li>Las mujeres valoran el poder y la capacidad de ingreso económico más que los hombres. </li></ul></ul>
  43. 44. Psicología evolucionista <ul><li>Cont. Teoría de la evolución de elección de pareja: (Buss, 1992) </li></ul><ul><ul><li>El atractivo físico es lo que mejor predice que mujeres se unirán con hombres de alto nivel profesional. </li></ul></ul><ul><ul><li>La principal estrategia de las mujeres para atraer a una pareja es aumentar su atractivo físico. </li></ul></ul><ul><ul><li>La de los hombres, hacer alarde de su poder y sus recursos. </li></ul></ul><ul><ul><li>Los hombres son más propensos que las mujeres a ser adúlteros. </li></ul></ul>
  44. 45. Clase II: Genética y Genética Conductual
  45. 46. Genética <ul><li>El origen de todo ser vivo. </li></ul><ul><li>Estudia las variaciones biológicas (herencia). </li></ul><ul><li>Gregorio Mendel (1865) </li></ul><ul><ul><li>Estudió y estableció las leyes de la herencia. </li></ul></ul><ul><ul><li>Base de la genética: DNA </li></ul></ul><ul><ul><ul><li>Secuencia de aminoácidos que constituyen la información genética, de las células y del organismo. </li></ul></ul></ul><ul><ul><ul><li>Se encuentra en el núcleo de cada célula del cuerpo </li></ul></ul></ul>
  46. 47. Genética <ul><li>Cont. Gregorio Mendel (1865) </li></ul><ul><ul><li>Genotipo: </li></ul></ul><ul><ul><ul><li>material genético de algún rasgo. </li></ul></ul></ul><ul><ul><li>Fenotipo: </li></ul></ul><ul><ul><ul><li>rasgo observable, producto de un genotipo. </li></ul></ul></ul><ul><ul><li>Estudios con guisantes: </li></ul></ul><ul><ul><ul><li>Rasgos dicotómicos: ocurren de una manera o de otra. </li></ul></ul></ul><ul><ul><ul><li>Líneas reproductoras puras: siempre se produce una descendencia con el mismo rasgo. </li></ul></ul></ul>
  47. 48. Genética <ul><li>Cont. Gregorio Mendel (1865) </li></ul><ul><ul><li>Estudios con guisantes: </li></ul></ul><ul><ul><ul><li>Rasgos dominantes: se manifiesta en todos los descendientes de la primera generación. </li></ul></ul></ul><ul><ul><ul><li>Rasgos recesivos: se manifiesta alrededor de una cuarta parte de la descendencia de segunda generación. </li></ul></ul></ul>
  48. 49. Genética <ul><li>Mendel propuso que existen dos tipos de factores hereditarios para cada rasgo dicotómico. </li></ul><ul><ul><li>Gen </li></ul></ul><ul><li>Cada organismo posee dos genes para cada uno de sus rasgos dicotomicos. </li></ul><ul><ul><li>alelos </li></ul></ul>
  49. 50. Características heredadas <ul><li>Homocigoto </li></ul><ul><ul><li>Dos genes idénticos para un rasgo </li></ul></ul><ul><ul><li>Por ej. Padre y Madre con pelo lacio. </li></ul></ul><ul><li>Heterocigoto </li></ul><ul><ul><li>Dos genes diferentes para un rasgo </li></ul></ul><ul><ul><li>Por ej. Padre pelo lacio y Madre pelo rizo. </li></ul></ul><ul><li>Uno de los tipos de genes de cada rasgo dicotómico domina al otro en los organismo heterocigóticos. </li></ul>
  50. 51. ADN La información genética se encuentra en una secuencia de aminoácidos, en el núcleo de las células, llamado Ácido Deoxiribonucleico (ADN). Es una estructura de doble hélice con 4 bases nitrogenadas (“base pairs”): Adenina (A) , Guanina (G), Citocina (C) y Timina (T) que parean A-T, T-A y C-G, G-C.
  51. 52. Genes <ul><li>Son la unidad de herencia definidos por la secuencia de bases nitrogenadas y aminoácidos. </li></ul><ul><li>Por ejemplo, la secuencia de un gen podría ser: </li></ul><ul><li>GATGGAATCCGGGCAATGCGGCATGCCACATAGGCTAGCCCTAATCGCGTATTAACCGGCTGCAATGCAAGTACGTACGAATTGAACTTGGCATGAGTTCGTCCAGAACCT </li></ul>
  52. 53. <ul><li>Deficiencias en Genes </li></ul><ul><li>Se pueden dar mutaciones en el orden de la secuencia de bases pares, ya sea por omisión o repetición de las bases. </li></ul><ul><ul><li>Ejemplo 1: GAT CCT AAT se muta si se omite la segunda C : GAT CTA AT </li></ul></ul><ul><ul><li>Ejemplo 2: GAT CCT AAT se muta si se repite la segunda C : GAT CC C TAA T </li></ul></ul>
  53. 54. Cromosoma <ul><li>Estructuras filiformes en el núcleo de la célula. </li></ul><ul><li>Conjunto de la hélice de ADN. </li></ul><ul><li>Hay 23 pares de cromosomas en el humano, 22 pares somáticos y 1 par sexual, llamado XX (mujeres) o XY (hombres). </li></ul>
  54. 55. Estructura del cromosoma
  55. 56. Algunas Anomalías Cromosómicas
  56. 57. Genoma <ul><li>Todo el material genético contenido en los cromosomas de un organismo. </li></ul><ul><li>El ser humano tiene: </li></ul><ul><ul><li>46 cromosomas </li></ul></ul><ul><ul><ul><li>22 pares somáticos y 1 par sexual </li></ul></ul></ul><ul><ul><li>80,000 a 100,000 genes </li></ul></ul><ul><ul><li>3,000,000 bases nitrogenadas </li></ul></ul>
  57. 58. En resumen…
  58. 59. División Celular <ul><li>Mitosis </li></ul><ul><ul><li>División en células somáticas. </li></ul></ul><ul><ul><li>Producto: 2 células iguales. </li></ul></ul><ul><ul><li>En la fertilización se forma el cigoto. </li></ul></ul><ul><li>Meiosis </li></ul><ul><ul><li>División en células sexuales (gametos) </li></ul></ul><ul><ul><li>Producto: 4 células con mitad de la información genética. </li></ul></ul>
  59. 60. <ul><li>Mitosis </li></ul><ul><li>Profase </li></ul><ul><li>Metafase </li></ul><ul><li>Anafase </li></ul><ul><li>Telofase </li></ul><ul><li>Meiosis </li></ul><ul><li>Profase I </li></ul><ul><li>Metafase I </li></ul><ul><li>Anafase I </li></ul><ul><li>Telofase I </li></ul><ul><li>Metafase II </li></ul><ul><li>Anafase II </li></ul><ul><li>Telofase II </li></ul>Pasos división celular: Mitosis vs. Meiosis
  60. 61. Pasos división celular: Mitosis vs. Meiosis
  61. 63. Genética Conductual <ul><li>Intenta buscar qué diferencias genéticas son responsables (en conjunto con la ambiental) de rasgos y/o conductas de índole psicológicos. </li></ul><ul><li>Francis Galton (1900). </li></ul><ul><ul><li>Genética e inteligencia. </li></ul></ul><ul><ul><li>“ Eugenics”. </li></ul></ul>
  62. 64. EU GENICS ( del griego ) EU = bueno GENICS =generación
  63. 65. Francis Galton: Eugenics <ul><li>Notó que los hijos de las personas inteligentes de su época, también eran inteligentes. </li></ul><ul><li>Decía que por naturaleza, el ser humano buscaba las personas más aptas para procrear y mejorar su progenie (y su especie). </li></ul><ul><li>Nature vs. Nurture </li></ul>
  64. 66. Métodos de investigación en la Genética y Genética Conductual <ul><li>Estudios estadísticos </li></ul><ul><li>Concordancia vs. Discordancia </li></ul><ul><ul><ul><li>Cuán parecido o cuan diferente son los rasgos. </li></ul></ul></ul><ul><li>Estudios con hermanos </li></ul><ul><ul><li>Monozigóticos (MZ) = gemelos idénticos </li></ul></ul><ul><ul><li>Dizigóticos (DZ) = gemelos fraternos </li></ul></ul><ul><li>Estudios: </li></ul><ul><ul><ul><li>Gemelos Idénticos Criados Separados </li></ul></ul></ul><ul><ul><ul><li>Gemelos Idénticos Criados en Conjunto </li></ul></ul></ul><ul><ul><ul><li>Gemelos Fraternos Criados Separados </li></ul></ul></ul><ul><ul><ul><li>Gemelos Fraternos Criados en Conjunto </li></ul></ul></ul><ul><ul><ul><li>Adoptados </li></ul></ul></ul><ul><ul><li>MZ correlaciona a 1.0 y DZ correlaciona a .50 </li></ul></ul>
  65. 67. <ul><li>Estudios Moleculares: </li></ul><ul><li>Polymerase Chain Reaction (PCR) </li></ul><ul><ul><li>Método para amplificar el DNA </li></ul></ul><ul><ul><ul><li>Cromosomal </li></ul></ul></ul><ul><ul><ul><ul><li>kariotipos , FISH </li></ul></ul></ul></ul><ul><ul><ul><li>Mapeo Genético (marcadores genéticos) </li></ul></ul></ul><ul><ul><ul><ul><li>electroforesis </li></ul></ul></ul></ul><ul><ul><ul><li>Secuenciación </li></ul></ul></ul><ul><ul><ul><ul><li>recuento de bases nitrogenadas de los genes. </li></ul></ul></ul></ul>Métodos de investigación en la Genética y Genética Conductual
  66. 68. Condiciones estudiadas <ul><li>Alcoholismo </li></ul><ul><li>Autismo </li></ul><ul><li>ADHD </li></ul><ul><li>Depresión </li></ul><ul><li>Alzheimer </li></ul><ul><li>Ansiedad </li></ul><ul><li>Esquizofrenia </li></ul><ul><li>Y muuuuuchos mas… </li></ul><ul><li>… ..… pero muuuuuuuuuuchos más … </li></ul>
  67. 69. Human Genome Project <ul><li>Human Genome Project </li></ul><ul><ul><li>Esfuerzo internacional que busca identificar todos los genes del genoma humano. </li></ul></ul><ul><li>Además de las características físicas, se han encontrado evidencia de bases genéticas de enfermedades y condiciones. </li></ul><ul><ul><li>Incluye condiciones psiquiátricas. </li></ul></ul>
  68. 70. ¿Qué se hereda? (cont) <ul><li>Se hereda la mitad de la información genética de padre y de madre. </li></ul><ul><li>Los genes pueden estar presentes, pero no implica que se manifieste la característica. </li></ul><ul><ul><li>Los genes se activan e inactivan. </li></ul></ul><ul><li>Si el genotipo está presente, existe la predisposición de presentar una característica. </li></ul>


Total views


On Slideshare


From embeds


Number of embeds










