nested pcr detecting gmo

1,696 views

Published on

Nested PCR for detecting GM soybean products

Published in: Education
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
1,696
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
64
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

nested pcr detecting gmo

  1. 1. 1 • Authors: Fa´ bio Cristiano Angonesi Brod, Cibele dos Santos Ferrari, Luciana Lehmkuhl Valente, Ana Carolina Maisonnave Aris (Universidade Federal de Santa Catarina, Brazil) By Khang DT
  2. 2. 22 I. INTRODUCTIONI. INTRODUCTION II. MATERIAL AND METHODII. MATERIAL AND METHOD III. RESULTS AND DISCUSSIONIII. RESULTS AND DISCUSSION IV. CONCLUSIONIV. CONCLUSION
  3. 3. 3 • Genetically modified orgamism (GMO) Multifunction Productivity MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION
  4. 4. 4 • The herbicide-tolerant Roundup ReadyTM (RR) Soybean (Monsanto) in Brazil Herbicide tolerant soybean MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION
  5. 5. 5 • Article 21 For commerce of foodstuffs and food ingredients, destined for human or animal consumption, containing GMO above the 1% threshold based on product level, the consumer must be informed of the transgenic origin of this product.’ • Labeling requirement HOW TO DETECT GMO??? MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION
  6. 6. Polymerase chain reaction (PCR) Kary Mullis accepting the Nobel Prize PCR amplification in 1993 Nested PCR increases the confident level 6 MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION DNA Nested PCR region PCR region
  7. 7. 7 1. Samples1. Samples The soy products (six defatted soy flours, six infant formulas containing 14% soy protein isolate and 25 powdered soymilks) were purchased from local supermarkets and pharmacies in Floriano´ polis,Brazil. 2. DNA extraction2. DNA extraction CTAB protocol 3. PCR conditions3. PCR conditions 4. Agarose gel electrophoresis4. Agarose gel electrophoresis MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION
  8. 8. 2. PCR protocol2. PCR protocol • 1XPCR buffer (20 mmol/l Tris-HCl, pH 8.4, 50 mmol/l KCl), • 2.5 mmol/l MgCl2, • 0.2 mmol/l of each dNTP, • 0.5 mM of each primer, • 1 unit of Taq DNA polymerase (Invitrogen) • 2 ml of DNA (maximum 50 ng) 8 PCR CONDITIONSPCR CONDITIONS 95o 12:00m 0:30s 95o 62o 72o 1:00m 0:30s ∞ 4o Temperature Time 50 cycles 1. PCR thermal cycle1. PCR thermal cycle
  9. 9. 9 3. PCR primers3. PCR primers Primer Sequence (50-30) Amplicon size (bp) LEC1 GTGCTACTGACCAAGGCAAACTCAGCA 164 LEC2 GAGGGTTTTGGGGTGCCGTTTTCGTCAAC GMO09 CATGAAGGACCGGTGGGAGAT 447 GMO05 CCACTGACGTAAGGGATGACG GMO08 TGGGGTTTATATGGAAATTGGAA 169 GMO07 ATCCCACTATCCTTCGCAAGA Primers GMO5 and GMO7 are complementary to the CaMV 35S promoter Primers GMO9 hybridizes to the CP4 EPSPS sequence and GMO8 to the CTP sequence GMO8 GMO7 GMO5 GMO9 CaMV35S promoterCTPCP4 EPSPS DNA
  10. 10. 10 1. Samples1. Samples The soy products (six defatted soy flours, six infant formulas containing 14% soy protein isolate and 25 powdered soymilks) were purchased from local supermarkets and pharmacies in Floriano´ polis,Brazil. 2. DNA extraction2. DNA extraction CTAB protocol 3. PCR conditions3. PCR conditions 4. Agarose gel electrophoresis4. Agarose gel electrophoresis MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION
  11. 11. 11 Fig. 1. Amplification of soybean lectin gene. Lane 1: 50 bp ladder (Promega); lane 2: negative control (water); lane 3: positive control (soybean DNA); lanes 4–14: powder soymilks. MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION
  12. 12. 12 Fig. 2. RR soybean detection by nested PCR. Lane 1: 50 bp ladder (Promega); lane 2: positive control (soybean 0.1% RR); lane 3: negative control (water); lane 4: soybean 0% RR; lane 5: soybean 0.001% RR; lane 6: soybean 0.01% RR; lane 7: soybean 0.1% RR; lane 8: soybean 1% RR; lane 9: soybean 10% RR (8 ml PCR product+2ml loading buffer per lane). MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION All soybean mixed samples containing 0.01–10% GM soybean. This fragment was absent for 0% GM soybean and also for 0.001% GM soybean
  13. 13. 13 Fig. 3. RR soybean detection by nested PCR. Lane 1: 50 bp ladder (Invitrogen); lane 2: negative control (water); lane 3: negative control (soybean 0% RR); lane 4: positive control (soybean 10% RR); lanes 5–10: soy flours, first DNA extraction; lanes 11–16: soy flours, second DNA extraction. MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION
  14. 14. 14 Fig. 4. RR soybean detection by nested PCR. Lane 1: 50 bp ladder (Invitrogen); lane 2: negative control (water); lane 3: positive control (soybean 0.1% RR); lane 4: negative control (soybean 0% RR); lanes 5–15: powder soymilks MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION
  15. 15. 15 MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION • In six analysed soy flour samples, four samples were positive for the presence of RR soybean and in 25 analysed soymilk powder samples, 15 showed a positive signal of 169 bp length for the nested PCR detection of RR soybean.
  16. 16. 16 MATERIAL &MATERIAL & METHODMETHOD MATERIAL &MATERIAL & METHODMETHOD RESUL &RESUL & DISCUSSIONDISCUSSION RESUL &RESUL & DISCUSSIONDISCUSSION CONCLUSIONCONCLUSIONCONCLUSIONCONCLUSIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTION This study shows that the nested PCR method developed by Meyer and Jaccaud (1997) is adequate to determine the presence of GM soybean in samples of soybean flour, soymilk powder and infant formula containing protein isolate. This nested PCR method could be employed to distinguish GM from nonGM products, because the legal requirement for the labeling of foods containing GMO.
  17. 17. 17

×