Polimorfismo final


Published on

No Downloads
Total views
On SlideShare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

Polimorfismo final

  1. 1.  DOCENTE: Maria Daniela CURSO: Licenciatura em Ciências Biológicas DISCENTES: Altamira Ramos, Eveline Rocha, Isadora OliveiraLourdes Maria e Marília Pio TEMA: Polimorfismo genético
  2. 2. PolimorfismoGenético
  3. 3. ESTRUTURA: 1- Introdução 2- Conceito 3- Alelos 4- Sistema ABO 5- SNPs (polimorfismos nucleotídicos Únicos/Simples 6- VNTR (Números Variável de Repetições Sequenciais/em Tandem. 7- Herança ??? 8- Referências bibliográficas9- Mapa conceitual
  4. 4. Introdução:A mutação é a base da evolução, a fonte de toda variabilidade genética.Ao contrário da recombinação, que organiza a variação previamente existente amutação cria os novos elementos (alelos) que irão ou não fazer parte do poolgenético de uma população.Quando uma variante genética alcança uma frequência de 1%, é denominadaPOLIMORFISMO.
  5. 5. Origem da palavra O termo Polimorfismo é originaria doGrego e significa “muitas formas” Poli = muitasMorphos = formas
  6. 6. Polimorfismo genéticos Os genes são constituídos basicamente de DNA, que é uma molécula enorme , composta de sequênciascomplexas de nucleotídeos. Variações nessas sequências que ocorrem na população de formaestável, sendo encontradas com frequência de 1% ou superior, são denominadas polimorfismosgenéticos. De maneira mais clara : o polimorfismo é considerado a variação genética, encontrada em pelomenos 1% da população, e que não causa doença letal . Os polimorfismos podem contribuir para traços como cor da pele, tipo sanguíneo (ABO), etambém podem contribuir para a susceptibilidade a algumas doenças e/ou diferentes respostasa agentes farmacológicosO genoma humano possui cerca de 30.000 genes, com um total de 3,12 bilhões de nucleotídeos, osquais apresentam mais de dois milhões de polimorfismos ocorrendo com frequência de 1 a cada 1.250pares de bases.As formas mais comuns de polimorfismos genéticos sãodeleções,mutaçõessubstituições de base única
  7. 7. o que são Polimorfismo? dentro de uma espécie, os cromossomos homólogos são bastante similares entre si, mas emdeterminadas localizações do cromossomo (loci) pode haver variabilidade na sequência superior a1% da população, denomina-se polimorfismo. Polimorfismos podem atuar como marcadores genéticos, já que são transmitidos associados a outrosgenes localizados na região cromossômica próxima a eles (linhagem). desta forma, se um gene próximo a um marcador causa uma doença, todos os indivíduos afetadosna família recebem tanto o marcador como o gene causador da doença . Os polimorfismo também são responsáveis pela diversidade humana. Diferentes fenótipos são decorrentes de diferentes polimorfismos. De outro modo, os polimorfismos podem influenciar diretamente sobre fatores de risco associados adoenças comuns.
  8. 8. Conceito: Diferentes versões de uma certa sequência de DNA em determinado localcromossômico (locus) são chamados de alelos. A coexistência de alelos múltiplos em um locus é chamado de POLIMORFISMOGENÉTICO(Flávia Scapin)
  9. 9.  Caramujo (Capea nemoralis) Mariposa (Biston betulária)
  10. 10. Características dos polimorfismos:Existem diversos tipos de polimorfismo.Polimorfismo de sítio de restrição (RFLP)Polimorfismo de nucleotídeo único (SNP)Polimorfismos de inserção/deleção (indels)Polimorfismos de minissatélites (VNTR)Polimorfismos de microssatélites (SRT)Trataremos de 2 tipos, que são bastante comuns:SNPs (Polimorfismos Nucleotídicos Únicos/Simples) e osVNTRs (Número Variável de Repetições).
  11. 11. Polimorfismos de nucleotídeo único (SNP) é uma variação na sequência de DNA que afeta somente uma base(adenina (A), timina (T), citosina (C) ou guanina (G)) na sequência do genoma.Estas variações devem ocorrer em no mínimo 1% deuma determinada população para ser considerada comoum SNP. Se, por outro lado, a frequência de uma variaçãofor inferior a 1%, a mesma será consideradasimplesmente uma mutação.Os SNPs constituem 90% de todas as variações genômicas humanae aparecem, em média, uma vez a cada 1.300 bases, ao longo dognoma humano. Dois terços dos SNP correspondem a substituiçõesde uma citosina (C) por uma timina (T). Além de poder acarretarmudanças morfológicas, essas variações na sequência do DNApodem influenciar a resposta dos organismos adoenças, bactérias, vírus, produtos químicos, fármacos, etc.
  12. 12. os SNP consistem de modificações em um único nucleotídeo, que pode:i) ser substituído; ii) ser excluído ou iii) ser adicionado.Em todas as três possibilidades há modificação na sequência de DNA. Considere aseguinte sequência como exemplo:Sequência originalSubstituiçãoDeleçãoAdição:ATCGATCGATCGATCGATCGACTAGCTA:ATCGATCGTTCGATCGATCGACTAGCTA:ATCGATCGTCGATCGATCGACTAGCTA:ATCGATCGTATCGATCGATCGACTAGCTA
  13. 13. Polimorfismos de minissatélites (VNTR)As VNTR consistem de sequências nucleotídicas repetidas quevariam no número de ocorrências do motivo básico. Porexemplo, considere o motivo básico CAG. Alguns indivíduos napopulação podem apresentar 5 vezes este motivo em uma regiãoespecífica do genoma, ao passo que outros indivíduos podemapresentar 6, 7, 8, 9, n repetições.ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,AGA,TGA,TGC,ATG,CAT,CGTATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,TGC,ATG,CAT,GCA,TCGATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,CAG,GAT,GCA,TGC,ATCATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,CAG,CAG,ATG,CAT,GCTATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,CAG,CAG,CAG,AGT,CAT
  14. 14. Alelos Múltiplos
  15. 15. Alelos MúltiplosÉ quando vários alelos condicionalum único caráter.Exemplo:Cor da pelagem em coelhos.Grupo sanguíneo.
  16. 16. Tabela:Fenótipos Gene Genótipos Cor da pelagemAguti ouselvagemC CC,CCch,CCh,CaPreto ou marromescuroChinchila Cch CchCch,CchCh,CchCaCinza claroHimalaia Ch ChCh,ChCa, Branco com asextremidadesescurasAlbino Ca Branco com oolho vermelho
  17. 17. Tipos de pelagem Aguti ou selvagem  Chinchila
  18. 18. Tipos de pelagem Himalaia  Albino
  19. 19. Grupo sanguíneo
  20. 20. Componentes do sangue Plasma sanguíneos : é ocomponente líquido do sangue, no qual as células sanguíneas estãosuspensas. O plasma é um líquidode cor amarelada e é o maiorcomponente dosangue, compondo cerca de 82%de seu volume total.Elementos figurados:Hemácias;Leucócitos ePlaquetas
  21. 21. Hemácias: São células em forma de discobicôncavo. São anucleadas. Dura cerca de 120 dias. São produzidas pela medulaóssea vermelha. Função: atuam no transporte degases respiratórios.
  22. 22. Leucócitos: São células esféricas maiores queas hemácias porem presentes nosangue em menor quantidade. São nucleadas. São produzidas pela medulaóssea e pelos nódulos linfáticos Função: atuam na defesa doorganismo através da produçãode anti corpos.
  23. 23. Plaquetas: São anucleadas. Não são células e sim fragmentos. São produzidas na medula ósseavermelha a partir de célulasdenominadas megacariocitos. Função: atuam no processo dacoagulação do sangue.
  24. 24. Sistema ABO: São quatro os tipos de sangue:A, B, AB e O. é caracterizado pela presença ouausência de aglutinogênio, nashemácias, e aglutinina, no plasmasanguíneo.
  25. 25. Aglutinogênios: são antígenos encontrados na superfície das hemácias e sãoresponsáveis pela determinação do fenótipo sanguíneo.Grupo sanguíneo: Aglutinogênio nas hemáciasA AB BAB ABO -
  26. 26. Genética do sistema ABO: O sistema ABO apresenta herança que édeterminada por uma série de três alelosmúltiplos: IA, IB, i.
  27. 27. Transfusão: Tipo A recebe do tipo A e do O Tipo B recebe do tipo B e do O Grupo AB recebe dos gruposA, B, AB e O pois não possuemaglutininas no plasma. Grupo O só podem recebersangue de pessoas do grupo O. O e doador universal e ABreceptor universal.
  28. 28. Fator RH: O fator Rh é um dos dois grupos de antígenos eritrocitários de maiorimportância clínica, estando envolvido nas reações transfusionaishemolíticas e na Doença Hemolítica do Recém-Nascido.Observação: Fator RH+ : Presença de aglutinogênios. Fator RH - : Ausência de aglutinogênios e aglutininas.
  29. 29. Fator RH
  30. 30. Genética Fator RH Fenótipos: RH+ Genótipos: Rr e r Fenótipos: RH- Genótipos: rr
  31. 31. Usos e exemplos A maioria dos polimorfismos não têm efeito sobre ofenótipo, porque eles estão em regiões não codificastes, algunsafetam nosso fenótipo (altura alta / baixa, luz de cabelo /escuro, cor dos olhos, etc.) e um número muito pequeno depolimorfismos são responsáveis ​​por doenças genéticas, como umaem cada 20 pessoas do norte da Europa leva o gene para a fibrosecística.
  32. 32. Polimorfismos de DNA de Interesse ForenseA análise de marcadores polimórficos de DNA é atualmente reconhecidamundialmente como uma técnica forense padrão para a investigação e detecção de uma amplavariedade de crimes, desde pequenos delitos até crimes hediondos (estupros ou latrocínios)O DNA pode ser encontrado em qualquer amostra detecido, incluindo sangue, sêmen, e até mesmo em salivae cabelo.Os genes, que servem de molde para a produção deproteínas nas células, constituem somente 5% de umacadeia de DNA. O restante é não-codificável e incluimuitos pares de base repetidos
  33. 33. (VNTRs)(STRs)10 a 100 bases1 a 4 basesMinisatéliteMicrosatélite.Short Tandem RepeatsVariable Number Tandem RepeatO método mais usado hoje em dia, é o estudo de regiões repetitivas de DNAchamadas de minissatélites (VNTRs) e microssatélites (STRs)
  34. 34. Uma técnica muito utilizada para visualização eseparação de moléculas de DNA é aeletroforese. Esta técnica separa moléculas de DNA deacordo com o tamanho (massa), forma e compactação.Técnicas e métodos.
  35. 35. Método RFLP (Polimorfismo por Comprimento de Fragmento de Restrição)Até 25 fios de cabeloUma mancha de fluidos corpóreosdo tamanho de uma moeda de 10 centavosPode demorar até um mês [fonte: Baden]Já não é utilizado atualmente(VNTRs)A análise RFLP requer que os investigadores dissolvam o DNAem uma enzima que quebra a cadeia em pontos específicos. Onúmero de repetições afeta o comprimento de cada cadeia deDNA resultante. Os investigadores comparam amostras pormeio da comparação dos comprimentos das cadeias. Aanálise RFLP requer uma amostra de DNA bastante grande eque não tenha sido contaminada por sujeira.requer o exame de seções múltiplas do feixe deDNA, para localizar variações, o que aumenta apossibilidade de erro humano
  36. 36. Método por PCR (Reação em Cadeia de Polimerase)replicar uma pequena quantidade deDNA, criando quantidade maior para análisedura cerca de cinco minutosmais precisãopode transformar o DNA em uma amostrabem menorO desenvolvimento da técnica de PCR proporcionouuma revolução no processo de identificação humanapor DNA, ao permitir, em poucas horas, a obtenção debilhões de cópias de um determinado locus presente emum pequeno fragmento de DNA. A amplificação do DNApor PCR resultou em um grande aumento desensibilidade, fazendo com que materiais biológicosdegradados, encontrados em pequenas quantidadesem cenas de crime, pudessem ser analisados comsucesso. Dessa forma, marcadores genéticos polimórficosanalisáveis em pequenos fragmentos de DNA (o que nãoé o caso dos minissatélites) passaram a representar abase que fundamenta a identificação humana por DNA(Butler, 2005; Goodwin et al, 2007; Jobling e Gill, 2004)polimerase de DNA resistente ao calor - uma enzima especial que se une ao DNA e permitesua réplica - é acrescida. Em seguida, a amostra de DNA é aquecida a 93 graus para separaros feixes. Depois, a amostra é refrigerada e aquecida novamente. O reaquecimento duplicao número de cópias. Depois que o processo é repetido cerca de 30 vezes, existe DNAsuficiente para análise posterior.
  37. 37. Referências bibliográficas http://www.ebah.com.br/content/ABAAAfL3QAD/apostila-genetica-forense http://pessoas.hsw.uol.com.br/prova-de-dna1.htm http://aprendendogenetica.blogspot.com.br/2010/06/genetica-molecular-polimorfismos.html http://geneticanaescola.com.br/wp-home/wp-content/uploads/2012/10/Genetica-na-Escola-51-Artigo-08.pdf http://ciencia.hsw.uol.com.br/evidencias-de-dna1.htm http://genetica.ufcspa.edu.br/biomedic/conteudo/genetica_molecular/polimorfgen.PDF
