SlideShare a Scribd company logo
1 of 81
Microsatellite instability
Presenter Dr Dhanya A N
Moderator Dr Rashmi M V
Contents
• Background
• Terminologies
• Short sequence repeats
• Types of short sequence repeats
• Mutation at microsatellite
• DNA methyl mismatch repair
• Uses of microsatellite
• Microsatellite instability
Conti..
• Mechanism of MSI in HNPCC and colorectal
cancer
• Histopathology of MSI associated CRC
• Immunohistochemistry
• MSI assay
• Prognosis
• Summary
• References
Background
Gene
• DNA- Deoxyribonucleic acid
• Double helix
• Made up of pairs of nucleotides
(A”, “C”, “G” and “T)
• DNA is packed tightly around
the histone and formed into
chromosome which is present
inside the nucleus
• DNA codes for amino acids to
form proteins by transcription
and translation, which are
building blocks of body
Terminologies
• Allele - An allele is an alternative form of a gene (one
member of a pair) that is located at a specific position
on a specific chromosome.
• Homozygous - when identical alleles of the gene are
present on both chromosomes
• Heterozygous - when two different alleles of the gene
are present on both chromosomes
• Epigenetics - the study of heritable chemical
modification of DNA or chromatin that does
not alter the DNA sequence itself.
– DNA methylation
– Histone acetylation
– mi RNA
DNA methylation
Histone acetylation
Micro RNA
Mutations
1.Point mutations - that causes
a single nucleotide base
substitution in the genetic
material
– Transition – purine by purine
or pyrimidine by pyrimidine
– Transversion – purine by
pyrimidine and vice versa
2. Frame shift mutations
is a genetic mutation caused
by insertions or deletions of a
number of nucleotides in a DNA
sequence, due to the triple nature
of gene expression by codons, the
insertion or deletion can change
the reading frame, resulting in a
completely
different translation from the
original.
• Loss of heterozygosity - (LOH) is the loss of
function of one allele of a gene in which the
other allele was already inactivated.
Genomic instability
• Chromosomal instability when karyotype
shows abnormal karyotyping in the form of
abnormal number of chromosome
• Microsatellite instability
Definition
• Short sequence repeat (SSR) - These are gene
loci harbor short or long stretches of repeated
nucleotide sequence.
• SSR constitute around 3% of human genome
Types of SSR
1. Microsatellite : when the repeat units consists of 1
to 6 nucleotides, they are commonly seen in non
coding region.
• These repeat sequences are present in everyone at the
same chromosomal locations, but where the number
of repeat units varies from person to person.
(polymorphism)
• Dinucleotide repeats are the most common, followed
by mononucleotide and then by trinucleotide.
• Among dinucleotide, most frequent dinucleotide
will be (GT)n, followed by (AT)n.
• Most common trinucleotide repeats will be (TAA)n
• Human genome contains 50,000 to 1,00,000
microsatellite.
They are polymorphic among individuals but are unique
and uniform in length in every tissue in each person
2. Minisatelliete : the repeats are longer consists
of 6-100 nucleotides
3. Satellite DNA :
• Repeat sequence > 100 nucleotide, often
found near the region of the centromere
Microsatellite
Properties of microsatellite
• Locus specific
• Co dominant - when the contributions of both alleles are
visible in the phenotype.
• Highly polymorphic – provide variable pattern
• Flanking region is highly conserved/ constant in related
species
• PCR based - Can be obtained from small amounts of tissues
Co dominant
Microsatellites are classified according to the type of
repeat sequence
1.Perfect- the repeat sequence is not interrupted
by any base not belonging to the repeat sequence
e.g. TATATATATATATATA.
2.Imperfect- there is a pair of bases between the repeated
sequence that does not match the repeat sequence
e.g. TATATATACGTATATA
3. Interrupted- there is a small sequence within the
repeated sequence that does not match the repeat sequence
e.g. TATATACGTGTATATATATA
4. Composite- the sequence contains two adjacent
distinctive sequence-repeats
e.g. TATATATATAGTGTGTGTGT
Microsatellite mutations
• Since it’s a region of repetitive sequence of nucleotide,
while replication and recombination they are very much
prone to mutations
• Mainly 2 types of mutations occur at this region
– Unequal crossing over
– Replication slippage
Unequal crossing over
• Microsatellite repetitive regions forms a hairpin during
synapsis,
• During crossing over unequal length of each
chromosome will be exchanged
• One chromosome will receive a larger fragment
because of the larger number of microsatellite repeats
The homologues chromosome receive a smaller number
of repeats
Unequal crossing over
Replication slippage
• During DNA replication DNA polymerase slippage can occur
in which one DNA strand temporarily dissociates from the
other and rapidly rebinds in a different position, leading to
base-pairing errors and forms IDL, and continue the
lengthening of the new strand
• An increase in the number of repeats (i.e. additions) occur if
IDL is on daughter strand or a decreased number of repeats
(i.e. deletions) occur if IDL occurs on parent strand
Replication slippage
DNA methyl mismatch repair
mechanism
• Three important proteins - MutS, MutL, MutH
• The important genes responsible for the MMR proteins
are PMS2, MLH1, MSH2 PMS1, and MLH3, MSH6.
• After replication the parent strand will be methylated
and daughter strand is not methylated, so the MMR
protein can recognize the parent strand
• MutS will identify the mismatch nucleotide error
• MutL will recognize the parent strand and brings the
mismatch strand closer to it for cleaving
• MutH will act as endonuclease and forms a nick
• Then UvrD protien acts as helicase and separates the
DNA strand and cleave the mutated strand
• The gap is filled with new nucleotides by DNA
polymerase enzyme and ligase enzyme
Methyl mismatch repair
Advantages of microsatellite
1. Gene mapping
2. Molecular forensics
3. Parentage testing
4. Analysis of genetic structure of populations
5. Assessment of phylogenetic relationships
Microsatellite instability
• It is caused by mutational inactivation of genes
involved in DNA repair
• DNA polymerase sometimes makes errors
incorporating the correct number of bases
during replication of long repetitive DNA
sequences, such as microsatellites.
• The MMR system consists of a family of
proteins that detect DNA replication errors, in
which the newly synthesized strand has
incorporated the wrong nucleotide
• Mutation rate ranging from 1 in 10² to 1 in 106
nucleotides per gene per cell
• These errors can be recognized and repaired by
the MMR system.
• The important genes responsible for the MMR
factors are PMS2, MLH1, MSH2 PMS1, and
MLH3, MSH6
• Any mutations that occurs to these genes will lead
to non functional MMR, that lead to increase or
decrease of microsatellite. This is the basis of
MSI
MMR gene mutations
Hereditary
• Germ line mutation
– Point mutation
– Frame shift mutation
Sporadic/ Epigenetic mutation
• Hyper methylation – of cytosine at CpG region
Microsatellite instability
• Microsatellite instability is associated with many tumor
conditions
– HNPCC/ Colorectal carcinoma
– Endometrial carcinoma
– Stomach carcinoma
– Ovarian carcinoma
– Urinary tract cancer
– Small intestine carcinoma
Microsatellite instability in
HNPCC/lynch syndrome and
colorectal carcinoma
MSI in HNPCC/ Lynch syndrome
• HNPCC is caused by inherited mutation in genes that
encode proteins responsible for the detection,
excision, repair of errors that occur during DNA
replication
• Majority will have MSH2 or MLH1 gene mutation or
epigenetic silencing.
MSI in colorectal carcinoma
• Two molecular pathways are involved in CRC
– APC/β-catenin pathway – 80% sporadic colon tumors
includes mutation of APC gene early in the neoplastic
process
– Microsatellite instability pathway –20% sporadic
associated with defects in DNA MMR and
accumulation of mutated microsatellite repeats
APC/β-catenin pathway
• APC promotes degradation of β catenin
• Loss of APC lead to accumulation of β catenin
• β catenin translocate to nucleus bind to DNA binding
factor TCF, transcription of MYC and cyclin D1 genes
which lead to cell proliferation
• Along with this, mutation of K-RAS promote the
growth and inhibit cell apoptosis
• Tumor suppressor genes SMAD2, SMAD4 also
mutate which inhibit the TGF β signaling which
lead to unrestrained cell growth
• Tp53 mutation also occurs in the later stage of
cancer
• Epigenetic mutation, Hyper methylation occurs at
CpG areas of tumor suppressor genes
APC/β-catenin pathway
Microsatellite instability
pathway
• Microsatellite sometimes also seen in coding region
and encodes typeII TGF β receptor, because TGF β
inhibits the cell division and also encodes pro apoptotic
protein BAX which regulates the cell division
• Any mutation in microsatellite, abnormal typeII TGF β
receptor and BAX protein formed lead to cell
proliferation
• Mutation in DNA MMR genes MHL1, MSH2,
MSH6, PMS1, PMS2 lead to abnormal MMR
system proteins lead to microsatellite instability
• Hypermethylation at CpG island of MLH1
reduces its expression and repair function
• It is associate with BRAF gene mutation
Microsatellite instability
When to perform MSI testing ?
• Amsterdam criteria
• Bethesda criteria
Amsterdam Criteria
1. At least 3 relatives with CRC (one must be a
first-degree relative of the other two) or a Lynch
syndrome–associated cancer*
2. CRC involving at least 2 successive generations
3. One or more cancer cases before age 50 years
4. Familial adenomatous polyposis should be
excluded
5. Tumors should be verified by histologic
examination
Bethesda criteria
1. Colorectal cancer diagnosed in an individual
who is younger than 50 y.
2. Presence of multiple, synchronous or
metachronous Lynch syndrome-associated
tumors, regardless of age.
3. Colorectal cancer with MSI-high histology
diagnosed in a patient who is younger than
60 y.
4. Colorectal cancer diagnosed in 1 or more first
degree relatives with a Lynch syndrome-related
tumor, with 1 of the cancers being diagnosed in a
patient younger than 50 y.
5. Colorectal cancer diagnosed in 2 or more first
or second-degree relatives with LS-related
tumors, regardless of age.
• The CRC occur due to MSI will have unique clinical
and pathological features
– more likely to arise in the proximal colon,
– less likely to be invasive, less aggressive
– less likely to have mutations in KRAS or p53,
– younger patients
– has a better prognosis
Histopathology
Signet Ring Cells:
• The presence of
tumor cells with an
intracytoplasmic
mucin-filled
vacuole causing
lateral compression
of the nucleus,
whether within
extracellular mucin
lakes or infiltrating
directly in stroma.
Mucinous (Colloid) Histology:
• Extracellular
mucin
accumulation
bounded either by
neoplastic
epithelium or by
host stroma
Medullary carcinoma
• The presence of an expansile appearance to the
advancing tumor margin when viewed at low
power
• subtype of poor differentiation, consisting of
nests, trabecula, and sheets of small- to
medium-sized tumor cells with scant to
abundant eosinophilic cytoplasm, frequent
mitotic figures and a distinct stromal
population of small lymphocytes
Necrotic
• characteristic
necrotic debris
in glandular
lumina, so-
called “dirty
necrosis”
Host response
Crohn-like Lymphoid Reaction
• Composed of lymphoid
follicles of different sizes with
germinal centers at the tumor
edge
• In subserosal or pricolonic fat
• Two or more large lymphoid
aggregates in a section are
required for the this feature
• Resemble crohn trans mural
inflammation
Tumor intramural
infiltrating
lymphocytes
• The presence of
small round
lymphocytes
within the tumor
epithelium
Immunohistochemistry (IHC)
• Immunohistochemical analysis is done using
antibodies against the MLH1, MSH2, and MSH6
and PMS1 proteins to identify carriers of MMR
gene mutations.
• Immunohistochemical staining can be performed
on formalin-fixed, paraffin-embedded tissue
sections
IHC staining for the mismatch repair proteins is
interpreted as follows:
• Loss of MLH1 and PMS2 protein staining may indicate
MLH1 mutation
• Loss of PMS2 protein staining usually indicates a
PMS2 mutation
• Loss of MSH2 and MSH6 protein staining usually
indicates a MSH2 mutation.
• Loss of MSH6 protein staining usually indicates a
MSH6 mutation.
Limitations of IHC
• Requires well experienced pathologists
• Difficult in interpretation, may vary the results
• Improper or patchy staining
• Defective MMR gene may still be antigenic
• Less sensitive
MSI analysis
DNA isolation
• Genomic DNA of normal and tumor
tissue was isolated from the paraffin-embedded
material by taking tissue punches (diameter, 0.6
mm) from tumor and normal areas selected on the
basis of a HE-stained slide.
DNA isolation
Tissue fragments
(proteinase K
chelex resin)
Adding100 to 200 microliter lysis buffer
overnight
incubation at 56 C
Dissolved DNA is separated from cell debris by
centrifugation for 10 min ( 13,000 rpm)
The DNA-containing supernatant is separated
from the Chelex resin
(Chelex resin inhibits
polymerase activity)
Transferred to another test tube
Markers for MSI
Marker Gene MS repeats Chromosomal
location
D2S123 Linked to MHS2 CA(n) 2p16
D5S346 Linked to APC CA(n) 5q22-23
D17S250 Linked to p53 CA(n) 17q12
BAT-25 C-kit A(25) 4q12
BAT-26 MSH2 A(26) 2p21
Pentaplex panel of mononucleotide
repeat markers
Markers Genes MS repeats Chromosomal
location
BAT-25 c-kit A(25) 4q12
BAT-26 MSH2 A(26) 2p21
NR-21 SLC7A8 T(21) 14q11
NR-24 Zinc finger 2 (ZNF-
2)
T(24) 2q11
NR-27 Inhibitor of
apoptosis protein-1
T(27) 11q22
• Multiplex fluorescent PCR is done to identify the MSI
• Here the markers will be labeled with the fluorescent
dyes
• Amplified PCR products are passed through gel
electrophoresis
• The tumor gene length is compared with the normal
gene and the interpretation is done
Tumors were classified as
(a) tumors with instability for >30%
of the markers ( > one marker ) (MSI-H),
(b) tumors with instability for <30% of
the markers ( only one marker ) (MSI-L),
(c) tumors with no instability [microsatellite stability (MSS)]
Prognosis
• Tests for MSI can be useful prognostic tool
• Have a better overall survival rate
• Responsive to chemotherapy like 5-FU than
tumors without MSI
Summary
References
1. Kumar, Abbas, Aster. Neoplasia in Robbins
and Cotran Pathologic Basis of Disease. 9th
ed. New Delhi: Reed Elsevier India Private
limited; 2014.
2. Turner RJ. The Gastrointestinal Tract in
Robbins and Cotran Pathologic Basis of
Disease. 9th ed. New Delhi: Reed Elsevier
India Private limited; 2014.
3. Antonarakis SE. Human Genome sequence
and variation in Vogel and Motulsky’s Human
Genetics. 4 th ed. London: Springer; 2010. p.
31-54.
4. Horshthemke B. Epigenetics in Vogel and
Motulsky’s Human Genetics. 4 th ed. London:
Springer; 2010. p. 299- 318.
5.de Jong AE, van Puijenbroek M, Hendriks Y,
Tops C, Wijnen J, Ausems MG, et al.
Microsatellite Instability
immunohistochemistry,
and Additional PMS2 Staining in Suspected
Hereditary Nonpolyposis Colorectal Cancer.
Clin Cancer Res. 2004 Feb 1;10(3):972-80
6. Boland CR, Goel A. Microsatellite Instability
in Colorectal Cancer. Gastroenterology. 2010
Jun;138(6):2073-2087.
7. Bresalier RS. Colorectal Cancer in
Sleisenger’s and Fordtran Gastrointestinal and
liver diseases. 10 ed. Philadelphia: Elsevier; p
2248-2296
Microsatellite instability

More Related Content

What's hot

Oncotype Dx Mammaprint
Oncotype Dx MammaprintOncotype Dx Mammaprint
Oncotype Dx Mammaprint
fondas vakalis
 

What's hot (20)

Microsatellite instability
Microsatellite instabilityMicrosatellite instability
Microsatellite instability
 
Role of ihc on soft tissue tumours
Role of ihc on soft tissue tumoursRole of ihc on soft tissue tumours
Role of ihc on soft tissue tumours
 
Yokohama system cytology
Yokohama system cytologyYokohama system cytology
Yokohama system cytology
 
Cancer and ihc markers
Cancer and ihc markersCancer and ihc markers
Cancer and ihc markers
 
Small round cell tumors
Small round cell tumorsSmall round cell tumors
Small round cell tumors
 
Mucinous lesions of breast
Mucinous lesions of breastMucinous lesions of breast
Mucinous lesions of breast
 
Tumor markers
Tumor markersTumor markers
Tumor markers
 
Prognostic factors in carcinoma breast ppt
Prognostic factors in carcinoma breast pptPrognostic factors in carcinoma breast ppt
Prognostic factors in carcinoma breast ppt
 
Molecular profiling in breast cancer
Molecular profiling in breast cancerMolecular profiling in breast cancer
Molecular profiling in breast cancer
 
Recent advances in soft tissue tumors
Recent advances in soft tissue tumorsRecent advances in soft tissue tumors
Recent advances in soft tissue tumors
 
Immunohistochemistry in diagnosis of soft tissue tumours seminar
Immunohistochemistry in diagnosis of soft tissue tumours seminarImmunohistochemistry in diagnosis of soft tissue tumours seminar
Immunohistochemistry in diagnosis of soft tissue tumours seminar
 
Circulating tumor cells
Circulating tumor cellsCirculating tumor cells
Circulating tumor cells
 
Minimal Residual Disease in Acute lymphoblastic leukemia
Minimal Residual Disease in Acute lymphoblastic leukemiaMinimal Residual Disease in Acute lymphoblastic leukemia
Minimal Residual Disease in Acute lymphoblastic leukemia
 
Epithelial and mesenchymal transition in invasion and metastasis
Epithelial and mesenchymal transition in invasion and metastasisEpithelial and mesenchymal transition in invasion and metastasis
Epithelial and mesenchymal transition in invasion and metastasis
 
Liquid biopsy
Liquid biopsyLiquid biopsy
Liquid biopsy
 
Molecular biology of colo rectal cancers
Molecular biology of colo rectal cancersMolecular biology of colo rectal cancers
Molecular biology of colo rectal cancers
 
Oncotype Dx Mammaprint
Oncotype Dx MammaprintOncotype Dx Mammaprint
Oncotype Dx Mammaprint
 
Genetic origins of human cancer - recent advances
Genetic origins of human cancer  - recent advancesGenetic origins of human cancer  - recent advances
Genetic origins of human cancer - recent advances
 
Tumor markers
Tumor markersTumor markers
Tumor markers
 
Microsatellite instability pathway and molecular genetics of colorectal cancer
Microsatellite instability pathway and molecular genetics of colorectal cancerMicrosatellite instability pathway and molecular genetics of colorectal cancer
Microsatellite instability pathway and molecular genetics of colorectal cancer
 

Viewers also liked

minisatellites
 minisatellites minisatellites
minisatellites
khehkesha
 
Transposone And Retrotransposone
Transposone And RetrotransposoneTransposone And Retrotransposone
Transposone And Retrotransposone
salar_bakhtiari
 
Acute Pancreatitis
Acute PancreatitisAcute Pancreatitis
Acute Pancreatitis
hareesh c
 
Molecular basis of thyroid neoplasm subhasish
Molecular basis of thyroid neoplasm  subhasishMolecular basis of thyroid neoplasm  subhasish
Molecular basis of thyroid neoplasm subhasish
Subhasish Saha
 

Viewers also liked (20)

minisatellites
 minisatellites minisatellites
minisatellites
 
Microsatellite
MicrosatelliteMicrosatellite
Microsatellite
 
Microsatellites
MicrosatellitesMicrosatellites
Microsatellites
 
The bethesda system for reporting thyroid cytopathology
The bethesda system for reporting thyroid cytopathology The bethesda system for reporting thyroid cytopathology
The bethesda system for reporting thyroid cytopathology
 
Recent advances in amyloidosis
Recent advances in amyloidosis   Recent advances in amyloidosis
Recent advances in amyloidosis
 
Liver biopsy interpretation
Liver biopsy interpretation   Liver biopsy interpretation
Liver biopsy interpretation
 
Telepathology
TelepathologyTelepathology
Telepathology
 
color atlas on bethesda system for reporting thyroid cytology
color atlas on bethesda system for reporting thyroid cytologycolor atlas on bethesda system for reporting thyroid cytology
color atlas on bethesda system for reporting thyroid cytology
 
Membranous Nephropathy
Membranous NephropathyMembranous Nephropathy
Membranous Nephropathy
 
Everything You Need to Know About IRAP Funding
Everything You Need to Know About IRAP FundingEverything You Need to Know About IRAP Funding
Everything You Need to Know About IRAP Funding
 
Transposone And Retrotransposone
Transposone And RetrotransposoneTransposone And Retrotransposone
Transposone And Retrotransposone
 
Pitfalls in minor salivary gland neoplasms
Pitfalls in minor salivary gland neoplasmsPitfalls in minor salivary gland neoplasms
Pitfalls in minor salivary gland neoplasms
 
Genetic predipositio to cancer
Genetic predipositio to cancerGenetic predipositio to cancer
Genetic predipositio to cancer
 
Cytologic assessment of bronchopulmonary lesions
Cytologic assessment of bronchopulmonary lesionsCytologic assessment of bronchopulmonary lesions
Cytologic assessment of bronchopulmonary lesions
 
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
 
Acute Pancreatitis
Acute PancreatitisAcute Pancreatitis
Acute Pancreatitis
 
Evaluation of csf
Evaluation of csfEvaluation of csf
Evaluation of csf
 
Mds&mds mpn
Mds&mds mpnMds&mds mpn
Mds&mds mpn
 
myoglobin
myoglobinmyoglobin
myoglobin
 
Molecular basis of thyroid neoplasm subhasish
Molecular basis of thyroid neoplasm  subhasishMolecular basis of thyroid neoplasm  subhasish
Molecular basis of thyroid neoplasm subhasish
 

Similar to Microsatellite instability

Similar to Microsatellite instability (20)

Chromosomes
ChromosomesChromosomes
Chromosomes
 
genetic in stability and its role in cancer
genetic in stability and its role in cancer genetic in stability and its role in cancer
genetic in stability and its role in cancer
 
Dna methylation
Dna methylationDna methylation
Dna methylation
 
Dna methylation
Dna methylationDna methylation
Dna methylation
 
Genetic engineering
Genetic engineeringGenetic engineering
Genetic engineering
 
Genetics - Ophthalmology
Genetics - OphthalmologyGenetics - Ophthalmology
Genetics - Ophthalmology
 
Metastatic cascade and Epithelial Mesenchymal Transition
Metastatic cascade and Epithelial Mesenchymal TransitionMetastatic cascade and Epithelial Mesenchymal Transition
Metastatic cascade and Epithelial Mesenchymal Transition
 
Organellar genome
Organellar genomeOrganellar genome
Organellar genome
 
chloroplast inheritance.ppt
chloroplast inheritance.pptchloroplast inheritance.ppt
chloroplast inheritance.ppt
 
Genomic instability and Cancer
Genomic instability and CancerGenomic instability and Cancer
Genomic instability and Cancer
 
Cancer epigenetics
Cancer epigenetics Cancer epigenetics
Cancer epigenetics
 
Gene silencing
Gene silencingGene silencing
Gene silencing
 
Mb & Genetics 8.pptx. .
Mb & Genetics 8.pptx.                   .Mb & Genetics 8.pptx.                   .
Mb & Genetics 8.pptx. .
 
Mutations types and causes
Mutations types and causesMutations types and causes
Mutations types and causes
 
Cytogenetic and molecular pathology of soft tissue tumours
Cytogenetic and molecular pathology of soft tissue tumoursCytogenetic and molecular pathology of soft tissue tumours
Cytogenetic and molecular pathology of soft tissue tumours
 
cytogeneticandmolecularpathologyofsofttissuetumours-210412064652.pptx
cytogeneticandmolecularpathologyofsofttissuetumours-210412064652.pptxcytogeneticandmolecularpathologyofsofttissuetumours-210412064652.pptx
cytogeneticandmolecularpathologyofsofttissuetumours-210412064652.pptx
 
Gene silencing amirtham
Gene silencing   amirthamGene silencing   amirtham
Gene silencing amirtham
 
Presentation
Presentation Presentation
Presentation
 
Lecture 12.ppt
Lecture 12.pptLecture 12.ppt
Lecture 12.ppt
 
Epigenetics- Transcription regulation of gene expression
Epigenetics- Transcription regulation of gene expressionEpigenetics- Transcription regulation of gene expression
Epigenetics- Transcription regulation of gene expression
 

Recently uploaded

Neurulation and the formation of the neural tube
Neurulation and the formation of the neural tubeNeurulation and the formation of the neural tube
Neurulation and the formation of the neural tube
SaadHumayun7
 

Recently uploaded (20)

[GDSC YCCE] Build with AI Online Presentation
[GDSC YCCE] Build with AI Online Presentation[GDSC YCCE] Build with AI Online Presentation
[GDSC YCCE] Build with AI Online Presentation
 
size separation d pharm 1st year pharmaceutics
size separation d pharm 1st year pharmaceuticssize separation d pharm 1st year pharmaceutics
size separation d pharm 1st year pharmaceutics
 
Incoming and Outgoing Shipments in 2 STEPS Using Odoo 17
Incoming and Outgoing Shipments in 2 STEPS Using Odoo 17Incoming and Outgoing Shipments in 2 STEPS Using Odoo 17
Incoming and Outgoing Shipments in 2 STEPS Using Odoo 17
 
....................Muslim-Law notes.pdf
....................Muslim-Law notes.pdf....................Muslim-Law notes.pdf
....................Muslim-Law notes.pdf
 
Essential Safety precautions during monsoon season
Essential Safety precautions during monsoon seasonEssential Safety precautions during monsoon season
Essential Safety precautions during monsoon season
 
Pragya Champions Chalice 2024 Prelims & Finals Q/A set, General Quiz
Pragya Champions Chalice 2024 Prelims & Finals Q/A set, General QuizPragya Champions Chalice 2024 Prelims & Finals Q/A set, General Quiz
Pragya Champions Chalice 2024 Prelims & Finals Q/A set, General Quiz
 
Application of Matrices in real life. Presentation on application of matrices
Application of Matrices in real life. Presentation on application of matricesApplication of Matrices in real life. Presentation on application of matrices
Application of Matrices in real life. Presentation on application of matrices
 
Exploring Gemini AI and Integration with MuleSoft | MuleSoft Mysore Meetup #45
Exploring Gemini AI and Integration with MuleSoft | MuleSoft Mysore Meetup #45Exploring Gemini AI and Integration with MuleSoft | MuleSoft Mysore Meetup #45
Exploring Gemini AI and Integration with MuleSoft | MuleSoft Mysore Meetup #45
 
Open Educational Resources Primer PowerPoint
Open Educational Resources Primer PowerPointOpen Educational Resources Primer PowerPoint
Open Educational Resources Primer PowerPoint
 
2024_Student Session 2_ Set Plan Preparation.pptx
2024_Student Session 2_ Set Plan Preparation.pptx2024_Student Session 2_ Set Plan Preparation.pptx
2024_Student Session 2_ Set Plan Preparation.pptx
 
How to Manage Notification Preferences in the Odoo 17
How to Manage Notification Preferences in the Odoo 17How to Manage Notification Preferences in the Odoo 17
How to Manage Notification Preferences in the Odoo 17
 
REPRODUCTIVE TOXICITY STUDIE OF MALE AND FEMALEpptx
REPRODUCTIVE TOXICITY  STUDIE OF MALE AND FEMALEpptxREPRODUCTIVE TOXICITY  STUDIE OF MALE AND FEMALEpptx
REPRODUCTIVE TOXICITY STUDIE OF MALE AND FEMALEpptx
 
Removal Strategy _ FEFO _ Working with Perishable Products in Odoo 17
Removal Strategy _ FEFO _ Working with Perishable Products in Odoo 17Removal Strategy _ FEFO _ Working with Perishable Products in Odoo 17
Removal Strategy _ FEFO _ Working with Perishable Products in Odoo 17
 
Features of Video Calls in the Discuss Module in Odoo 17
Features of Video Calls in the Discuss Module in Odoo 17Features of Video Calls in the Discuss Module in Odoo 17
Features of Video Calls in the Discuss Module in Odoo 17
 
Basic Civil Engineering notes on Transportation Engineering, Modes of Transpo...
Basic Civil Engineering notes on Transportation Engineering, Modes of Transpo...Basic Civil Engineering notes on Transportation Engineering, Modes of Transpo...
Basic Civil Engineering notes on Transportation Engineering, Modes of Transpo...
 
Mbaye_Astou.Education Civica_Human Rights.pptx
Mbaye_Astou.Education Civica_Human Rights.pptxMbaye_Astou.Education Civica_Human Rights.pptx
Mbaye_Astou.Education Civica_Human Rights.pptx
 
BỘ LUYỆN NGHE TIẾNG ANH 8 GLOBAL SUCCESS CẢ NĂM (GỒM 12 UNITS, MỖI UNIT GỒM 3...
BỘ LUYỆN NGHE TIẾNG ANH 8 GLOBAL SUCCESS CẢ NĂM (GỒM 12 UNITS, MỖI UNIT GỒM 3...BỘ LUYỆN NGHE TIẾNG ANH 8 GLOBAL SUCCESS CẢ NĂM (GỒM 12 UNITS, MỖI UNIT GỒM 3...
BỘ LUYỆN NGHE TIẾNG ANH 8 GLOBAL SUCCESS CẢ NĂM (GỒM 12 UNITS, MỖI UNIT GỒM 3...
 
philosophy and it's principles based on the life
philosophy and it's principles based on the lifephilosophy and it's principles based on the life
philosophy and it's principles based on the life
 
slides CapTechTalks Webinar May 2024 Alexander Perry.pptx
slides CapTechTalks Webinar May 2024 Alexander Perry.pptxslides CapTechTalks Webinar May 2024 Alexander Perry.pptx
slides CapTechTalks Webinar May 2024 Alexander Perry.pptx
 
Neurulation and the formation of the neural tube
Neurulation and the formation of the neural tubeNeurulation and the formation of the neural tube
Neurulation and the formation of the neural tube
 

Microsatellite instability

  • 1. Microsatellite instability Presenter Dr Dhanya A N Moderator Dr Rashmi M V
  • 2. Contents • Background • Terminologies • Short sequence repeats • Types of short sequence repeats • Mutation at microsatellite • DNA methyl mismatch repair • Uses of microsatellite • Microsatellite instability
  • 3. Conti.. • Mechanism of MSI in HNPCC and colorectal cancer • Histopathology of MSI associated CRC • Immunohistochemistry • MSI assay • Prognosis • Summary • References
  • 4. Background Gene • DNA- Deoxyribonucleic acid • Double helix • Made up of pairs of nucleotides (A”, “C”, “G” and “T) • DNA is packed tightly around the histone and formed into chromosome which is present inside the nucleus • DNA codes for amino acids to form proteins by transcription and translation, which are building blocks of body
  • 5. Terminologies • Allele - An allele is an alternative form of a gene (one member of a pair) that is located at a specific position on a specific chromosome. • Homozygous - when identical alleles of the gene are present on both chromosomes • Heterozygous - when two different alleles of the gene are present on both chromosomes
  • 6.
  • 7. • Epigenetics - the study of heritable chemical modification of DNA or chromatin that does not alter the DNA sequence itself. – DNA methylation – Histone acetylation – mi RNA
  • 11. Mutations 1.Point mutations - that causes a single nucleotide base substitution in the genetic material – Transition – purine by purine or pyrimidine by pyrimidine – Transversion – purine by pyrimidine and vice versa
  • 12. 2. Frame shift mutations is a genetic mutation caused by insertions or deletions of a number of nucleotides in a DNA sequence, due to the triple nature of gene expression by codons, the insertion or deletion can change the reading frame, resulting in a completely different translation from the original.
  • 13. • Loss of heterozygosity - (LOH) is the loss of function of one allele of a gene in which the other allele was already inactivated.
  • 14. Genomic instability • Chromosomal instability when karyotype shows abnormal karyotyping in the form of abnormal number of chromosome • Microsatellite instability
  • 15. Definition • Short sequence repeat (SSR) - These are gene loci harbor short or long stretches of repeated nucleotide sequence. • SSR constitute around 3% of human genome
  • 16. Types of SSR 1. Microsatellite : when the repeat units consists of 1 to 6 nucleotides, they are commonly seen in non coding region. • These repeat sequences are present in everyone at the same chromosomal locations, but where the number of repeat units varies from person to person. (polymorphism)
  • 17. • Dinucleotide repeats are the most common, followed by mononucleotide and then by trinucleotide. • Among dinucleotide, most frequent dinucleotide will be (GT)n, followed by (AT)n. • Most common trinucleotide repeats will be (TAA)n • Human genome contains 50,000 to 1,00,000 microsatellite.
  • 18. They are polymorphic among individuals but are unique and uniform in length in every tissue in each person 2. Minisatelliete : the repeats are longer consists of 6-100 nucleotides 3. Satellite DNA : • Repeat sequence > 100 nucleotide, often found near the region of the centromere
  • 19.
  • 21. Properties of microsatellite • Locus specific • Co dominant - when the contributions of both alleles are visible in the phenotype. • Highly polymorphic – provide variable pattern • Flanking region is highly conserved/ constant in related species • PCR based - Can be obtained from small amounts of tissues
  • 23. Microsatellites are classified according to the type of repeat sequence 1.Perfect- the repeat sequence is not interrupted by any base not belonging to the repeat sequence e.g. TATATATATATATATA. 2.Imperfect- there is a pair of bases between the repeated sequence that does not match the repeat sequence e.g. TATATATACGTATATA
  • 24. 3. Interrupted- there is a small sequence within the repeated sequence that does not match the repeat sequence e.g. TATATACGTGTATATATATA 4. Composite- the sequence contains two adjacent distinctive sequence-repeats e.g. TATATATATAGTGTGTGTGT
  • 25. Microsatellite mutations • Since it’s a region of repetitive sequence of nucleotide, while replication and recombination they are very much prone to mutations • Mainly 2 types of mutations occur at this region – Unequal crossing over – Replication slippage
  • 26. Unequal crossing over • Microsatellite repetitive regions forms a hairpin during synapsis, • During crossing over unequal length of each chromosome will be exchanged • One chromosome will receive a larger fragment because of the larger number of microsatellite repeats The homologues chromosome receive a smaller number of repeats
  • 28. Replication slippage • During DNA replication DNA polymerase slippage can occur in which one DNA strand temporarily dissociates from the other and rapidly rebinds in a different position, leading to base-pairing errors and forms IDL, and continue the lengthening of the new strand • An increase in the number of repeats (i.e. additions) occur if IDL is on daughter strand or a decreased number of repeats (i.e. deletions) occur if IDL occurs on parent strand
  • 30. DNA methyl mismatch repair mechanism • Three important proteins - MutS, MutL, MutH • The important genes responsible for the MMR proteins are PMS2, MLH1, MSH2 PMS1, and MLH3, MSH6. • After replication the parent strand will be methylated and daughter strand is not methylated, so the MMR protein can recognize the parent strand • MutS will identify the mismatch nucleotide error
  • 31. • MutL will recognize the parent strand and brings the mismatch strand closer to it for cleaving • MutH will act as endonuclease and forms a nick • Then UvrD protien acts as helicase and separates the DNA strand and cleave the mutated strand • The gap is filled with new nucleotides by DNA polymerase enzyme and ligase enzyme
  • 33. Advantages of microsatellite 1. Gene mapping 2. Molecular forensics 3. Parentage testing 4. Analysis of genetic structure of populations 5. Assessment of phylogenetic relationships
  • 34. Microsatellite instability • It is caused by mutational inactivation of genes involved in DNA repair • DNA polymerase sometimes makes errors incorporating the correct number of bases during replication of long repetitive DNA sequences, such as microsatellites.
  • 35. • The MMR system consists of a family of proteins that detect DNA replication errors, in which the newly synthesized strand has incorporated the wrong nucleotide • Mutation rate ranging from 1 in 10² to 1 in 106 nucleotides per gene per cell
  • 36. • These errors can be recognized and repaired by the MMR system. • The important genes responsible for the MMR factors are PMS2, MLH1, MSH2 PMS1, and MLH3, MSH6 • Any mutations that occurs to these genes will lead to non functional MMR, that lead to increase or decrease of microsatellite. This is the basis of MSI
  • 37. MMR gene mutations Hereditary • Germ line mutation – Point mutation – Frame shift mutation Sporadic/ Epigenetic mutation • Hyper methylation – of cytosine at CpG region
  • 38. Microsatellite instability • Microsatellite instability is associated with many tumor conditions – HNPCC/ Colorectal carcinoma – Endometrial carcinoma – Stomach carcinoma – Ovarian carcinoma – Urinary tract cancer – Small intestine carcinoma
  • 39. Microsatellite instability in HNPCC/lynch syndrome and colorectal carcinoma
  • 40. MSI in HNPCC/ Lynch syndrome • HNPCC is caused by inherited mutation in genes that encode proteins responsible for the detection, excision, repair of errors that occur during DNA replication • Majority will have MSH2 or MLH1 gene mutation or epigenetic silencing.
  • 41. MSI in colorectal carcinoma • Two molecular pathways are involved in CRC – APC/β-catenin pathway – 80% sporadic colon tumors includes mutation of APC gene early in the neoplastic process – Microsatellite instability pathway –20% sporadic associated with defects in DNA MMR and accumulation of mutated microsatellite repeats
  • 42. APC/β-catenin pathway • APC promotes degradation of β catenin • Loss of APC lead to accumulation of β catenin • β catenin translocate to nucleus bind to DNA binding factor TCF, transcription of MYC and cyclin D1 genes which lead to cell proliferation • Along with this, mutation of K-RAS promote the growth and inhibit cell apoptosis
  • 43. • Tumor suppressor genes SMAD2, SMAD4 also mutate which inhibit the TGF β signaling which lead to unrestrained cell growth • Tp53 mutation also occurs in the later stage of cancer • Epigenetic mutation, Hyper methylation occurs at CpG areas of tumor suppressor genes
  • 45. Microsatellite instability pathway • Microsatellite sometimes also seen in coding region and encodes typeII TGF β receptor, because TGF β inhibits the cell division and also encodes pro apoptotic protein BAX which regulates the cell division • Any mutation in microsatellite, abnormal typeII TGF β receptor and BAX protein formed lead to cell proliferation
  • 46. • Mutation in DNA MMR genes MHL1, MSH2, MSH6, PMS1, PMS2 lead to abnormal MMR system proteins lead to microsatellite instability • Hypermethylation at CpG island of MLH1 reduces its expression and repair function • It is associate with BRAF gene mutation
  • 48.
  • 49. When to perform MSI testing ? • Amsterdam criteria • Bethesda criteria
  • 50. Amsterdam Criteria 1. At least 3 relatives with CRC (one must be a first-degree relative of the other two) or a Lynch syndrome–associated cancer* 2. CRC involving at least 2 successive generations 3. One or more cancer cases before age 50 years 4. Familial adenomatous polyposis should be excluded 5. Tumors should be verified by histologic examination
  • 51. Bethesda criteria 1. Colorectal cancer diagnosed in an individual who is younger than 50 y. 2. Presence of multiple, synchronous or metachronous Lynch syndrome-associated tumors, regardless of age. 3. Colorectal cancer with MSI-high histology diagnosed in a patient who is younger than 60 y.
  • 52. 4. Colorectal cancer diagnosed in 1 or more first degree relatives with a Lynch syndrome-related tumor, with 1 of the cancers being diagnosed in a patient younger than 50 y. 5. Colorectal cancer diagnosed in 2 or more first or second-degree relatives with LS-related tumors, regardless of age.
  • 53. • The CRC occur due to MSI will have unique clinical and pathological features – more likely to arise in the proximal colon, – less likely to be invasive, less aggressive – less likely to have mutations in KRAS or p53, – younger patients – has a better prognosis
  • 54. Histopathology Signet Ring Cells: • The presence of tumor cells with an intracytoplasmic mucin-filled vacuole causing lateral compression of the nucleus, whether within extracellular mucin lakes or infiltrating directly in stroma.
  • 55. Mucinous (Colloid) Histology: • Extracellular mucin accumulation bounded either by neoplastic epithelium or by host stroma
  • 56. Medullary carcinoma • The presence of an expansile appearance to the advancing tumor margin when viewed at low power • subtype of poor differentiation, consisting of nests, trabecula, and sheets of small- to medium-sized tumor cells with scant to abundant eosinophilic cytoplasm, frequent mitotic figures and a distinct stromal population of small lymphocytes
  • 57.
  • 58. Necrotic • characteristic necrotic debris in glandular lumina, so- called “dirty necrosis”
  • 59. Host response Crohn-like Lymphoid Reaction • Composed of lymphoid follicles of different sizes with germinal centers at the tumor edge • In subserosal or pricolonic fat • Two or more large lymphoid aggregates in a section are required for the this feature • Resemble crohn trans mural inflammation
  • 60. Tumor intramural infiltrating lymphocytes • The presence of small round lymphocytes within the tumor epithelium
  • 61. Immunohistochemistry (IHC) • Immunohistochemical analysis is done using antibodies against the MLH1, MSH2, and MSH6 and PMS1 proteins to identify carriers of MMR gene mutations. • Immunohistochemical staining can be performed on formalin-fixed, paraffin-embedded tissue sections
  • 62.
  • 63. IHC staining for the mismatch repair proteins is interpreted as follows: • Loss of MLH1 and PMS2 protein staining may indicate MLH1 mutation • Loss of PMS2 protein staining usually indicates a PMS2 mutation • Loss of MSH2 and MSH6 protein staining usually indicates a MSH2 mutation. • Loss of MSH6 protein staining usually indicates a MSH6 mutation.
  • 64. Limitations of IHC • Requires well experienced pathologists • Difficult in interpretation, may vary the results • Improper or patchy staining • Defective MMR gene may still be antigenic • Less sensitive
  • 65. MSI analysis DNA isolation • Genomic DNA of normal and tumor tissue was isolated from the paraffin-embedded material by taking tissue punches (diameter, 0.6 mm) from tumor and normal areas selected on the basis of a HE-stained slide.
  • 66. DNA isolation Tissue fragments (proteinase K chelex resin) Adding100 to 200 microliter lysis buffer overnight incubation at 56 C Dissolved DNA is separated from cell debris by centrifugation for 10 min ( 13,000 rpm)
  • 67. The DNA-containing supernatant is separated from the Chelex resin (Chelex resin inhibits polymerase activity) Transferred to another test tube
  • 68. Markers for MSI Marker Gene MS repeats Chromosomal location D2S123 Linked to MHS2 CA(n) 2p16 D5S346 Linked to APC CA(n) 5q22-23 D17S250 Linked to p53 CA(n) 17q12 BAT-25 C-kit A(25) 4q12 BAT-26 MSH2 A(26) 2p21
  • 69. Pentaplex panel of mononucleotide repeat markers Markers Genes MS repeats Chromosomal location BAT-25 c-kit A(25) 4q12 BAT-26 MSH2 A(26) 2p21 NR-21 SLC7A8 T(21) 14q11 NR-24 Zinc finger 2 (ZNF- 2) T(24) 2q11 NR-27 Inhibitor of apoptosis protein-1 T(27) 11q22
  • 70. • Multiplex fluorescent PCR is done to identify the MSI • Here the markers will be labeled with the fluorescent dyes • Amplified PCR products are passed through gel electrophoresis • The tumor gene length is compared with the normal gene and the interpretation is done
  • 71.
  • 72. Tumors were classified as (a) tumors with instability for >30% of the markers ( > one marker ) (MSI-H), (b) tumors with instability for <30% of the markers ( only one marker ) (MSI-L), (c) tumors with no instability [microsatellite stability (MSS)]
  • 73. Prognosis • Tests for MSI can be useful prognostic tool • Have a better overall survival rate • Responsive to chemotherapy like 5-FU than tumors without MSI
  • 74.
  • 75.
  • 77. References 1. Kumar, Abbas, Aster. Neoplasia in Robbins and Cotran Pathologic Basis of Disease. 9th ed. New Delhi: Reed Elsevier India Private limited; 2014. 2. Turner RJ. The Gastrointestinal Tract in Robbins and Cotran Pathologic Basis of Disease. 9th ed. New Delhi: Reed Elsevier India Private limited; 2014.
  • 78. 3. Antonarakis SE. Human Genome sequence and variation in Vogel and Motulsky’s Human Genetics. 4 th ed. London: Springer; 2010. p. 31-54. 4. Horshthemke B. Epigenetics in Vogel and Motulsky’s Human Genetics. 4 th ed. London: Springer; 2010. p. 299- 318.
  • 79. 5.de Jong AE, van Puijenbroek M, Hendriks Y, Tops C, Wijnen J, Ausems MG, et al. Microsatellite Instability immunohistochemistry, and Additional PMS2 Staining in Suspected Hereditary Nonpolyposis Colorectal Cancer. Clin Cancer Res. 2004 Feb 1;10(3):972-80
  • 80. 6. Boland CR, Goel A. Microsatellite Instability in Colorectal Cancer. Gastroenterology. 2010 Jun;138(6):2073-2087. 7. Bresalier RS. Colorectal Cancer in Sleisenger’s and Fordtran Gastrointestinal and liver diseases. 10 ed. Philadelphia: Elsevier; p 2248-2296