Биология за 1 пару                                         Николай Вяххи                                  vyahhi@bioinform...
Формат обучениявоскресенье, 24 февраля 13 г.
Формат обучения                       12 лекций по воскресеньям                       Квизы для самопроверки              ...
Сегодня                       ДНК                       РНК                       Белки                       Геномика    ...
ДНК                       Двойная спираль                       Нуклеотиды:                                A = T          ...
ДНКвоскресенье, 24 февраля 13 г.
Направление ДНК         ➡ CCCAGAACTGAGATCAAT ➡воскресенье, 24 февраля 13 г.
Направление ДНК         ➡ CCCAGAACTGAGATCAAT ➡                          ATTGATCTCAGTTCTGGGвоскресенье, 24 февраля 13 г.
Репликация                                ДНК → 2 x ДНКвоскресенье, 24 февраля 13 г.
РНК                       Одна цепь                       Рибонуклеотиды:                                A = U            ...
Транскрипция                                   ДНК → РНК                                    T→Uвоскресенье, 24 февраля 13 г.
Белки / Протеины                       Аминокислоты (20):                                ACDEFGHIKLMNPQRSTVWY             ...
Структура                            белка               1. Последовательность               2. α-спираль / β-лист        ...
Трансляция                                    РНК → Белок                      3 нуклеотида (кодон) → 1 аминокислота (aa)в...
Центральная Догмавоскресенье, 24 февраля 13 г.
Омики                                 Геном — все ДНК организма.                           Транскриптом — все РНК организм...
Геном человекавоскресенье, 24 февраля 13 г.
Геномывоскресенье, 24 февраля 13 г.
Чтение геномоввоскресенье, 24 февраля 13 г.
Геномика                       AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGC                       A...
Аннотациивоскресенье, 24 февраля 13 г.
Геном человекавоскресенье, 24 февраля 13 г.
Сравнительная геномикавоскресенье, 24 февраля 13 г.
Филогениявоскресенье, 24 февраля 13 г.
Протеомикавоскресенье, 24 февраля 13 г.
Масс-спектрометриявоскресенье, 24 февраля 13 г.
Pathwaysвоскресенье, 24 февраля 13 г.
Сегодня                       ДНК                       РНК                       Белки                       Геномика    ...
Формат обучения                       12 лекций по воскресеньям                       Квизы для самопроверки              ...
Upcoming SlideShare
Loading in …5
×

Bioinf lecture1

1,472 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,472
On SlideShare
0
From Embeds
0
Number of Embeds
1,049
Actions
Shares
0
Downloads
2
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Bioinf lecture1

  1. 1. Биология за 1 пару Николай Вяххи vyahhi@bioinformaticsinstitute.ru Computer Science Club Санкт-Петербург, 2013воскресенье, 24 февраля 13 г.
  2. 2. Формат обучениявоскресенье, 24 февраля 13 г.
  3. 3. Формат обучения 12 лекций по воскресеньям Квизы для самопроверки Домашние задания и вопросы онлайн http://rosalind.info/classes/enroll/ff45302de4/воскресенье, 24 февраля 13 г.
  4. 4. Сегодня ДНК РНК Белки Геномика Протеомикавоскресенье, 24 февраля 13 г.
  5. 5. ДНК Двойная спираль Нуклеотиды: A = T C ≡ G Мера длины: bp (base pair)воскресенье, 24 февраля 13 г.
  6. 6. ДНКвоскресенье, 24 февраля 13 г.
  7. 7. Направление ДНК ➡ CCCAGAACTGAGATCAAT ➡воскресенье, 24 февраля 13 г.
  8. 8. Направление ДНК ➡ CCCAGAACTGAGATCAAT ➡ ATTGATCTCAGTTCTGGGвоскресенье, 24 февраля 13 г.
  9. 9. Репликация ДНК → 2 x ДНКвоскресенье, 24 февраля 13 г.
  10. 10. РНК Одна цепь Рибонуклеотиды: A = U C ≡ Gвоскресенье, 24 февраля 13 г.
  11. 11. Транскрипция ДНК → РНК T→Uвоскресенье, 24 февраля 13 г.
  12. 12. Белки / Протеины Аминокислоты (20): ACDEFGHIKLMNPQRSTVWY Функции: структурная, ферментативная, рецепторная, гормональная, транспортная, сократительная, защитная.воскресенье, 24 февраля 13 г.
  13. 13. Структура белка 1. Последовательность 2. α-спираль / β-лист 3. Трёхмерная структура 4. Комплексвоскресенье, 24 февраля 13 г.
  14. 14. Трансляция РНК → Белок 3 нуклеотида (кодон) → 1 аминокислота (aa)воскресенье, 24 февраля 13 г.
  15. 15. Центральная Догмавоскресенье, 24 февраля 13 г.
  16. 16. Омики Геном — все ДНК организма. Транскриптом — все РНК организма. Протеом — все белки организма.воскресенье, 24 февраля 13 г.
  17. 17. Геном человекавоскресенье, 24 февраля 13 г.
  18. 18. Геномывоскресенье, 24 февраля 13 г.
  19. 19. Чтение геномоввоскресенье, 24 февраля 13 г.
  20. 20. Геномика AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGC AGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTT AACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATT AGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAA CACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAAC CATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGAT ATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCA ACCACCTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGC CGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAA TTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATTAGTTTGTTGG GGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTAT GGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCTGGCA GTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCCGCCGTATTGCGGCAAGCCGCA TTCCGGCTGATCACATGGTGCTGATGGCAGGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGT GCTTGGACGCAACGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATTGTTGC GAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGTCAGGTGCCCGATGCGAGGTTGT TGAAGTCGATGTCCTACCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCG CACCATTACCCCCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCTCAAGCA CCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACCGGTCAAGGGCCGGGACTCGCCCGвоскресенье, 24 февраля 13 г.
  21. 21. Аннотациивоскресенье, 24 февраля 13 г.
  22. 22. Геном человекавоскресенье, 24 февраля 13 г.
  23. 23. Сравнительная геномикавоскресенье, 24 февраля 13 г.
  24. 24. Филогениявоскресенье, 24 февраля 13 г.
  25. 25. Протеомикавоскресенье, 24 февраля 13 г.
  26. 26. Масс-спектрометриявоскресенье, 24 февраля 13 г.
  27. 27. Pathwaysвоскресенье, 24 февраля 13 г.
  28. 28. Сегодня ДНК РНК Белки Геномика Протеомикавоскресенье, 24 февраля 13 г.
  29. 29. Формат обучения 12 лекций по воскресеньям Квизы для самопроверки Домашние задания и вопросы онлайн http://rosalind.info/classes/enroll/ff45302de4/воскресенье, 24 февраля 13 г.

×