Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Биология за 1 пару                                  Николай Вяххи                               vyahhi@bioinf.spbau.ru    ...
Геном Человека                           3,000,000,000 букв                           13 лет (1990 - 2003)                ...
Геном Человека                           3,000,000,000 букв                           13 лет (1990 - 2003)                ...
Геном Человека                           3,000,000,000 букв                           2 недели                           5...
пятница, 5 октября 12 г.
ДНКпятница, 5 октября 12 г.
ДНК                           Двойная спираль                           Нуклеотиды:                                А—Т    ...
Направление ДНКпятница, 5 октября 12 г.
Направление ДНКпятница, 5 октября 12 г.
Комплементарностьпятница, 5 октября 12 г.
Комплементарность                             1. CCCAGAACUGAGAUCAAU                             2. AGUACCCGUAUUAACGGGпятни...
ДНК → 2 x ДНК                              Репликацияпятница, 5 октября 12 г.
РНК                           Одна цепочка                           Рибонуклеотиды:                               А—U    ...
ДНК → РНК                            Транскрипция                               T→Uпятница, 5 октября 12 г.
Белки / Протеины                           Аминокислоты (20):                              ACDEFGHIKLMNPQRSTVWY           ...
Структура Белка                           Последовательность                           α-спираль / β-лист                 ...
РНК → Белок                                       Трансляция                           Кодон (3 нуклеотида) → 1 аминокисло...
РНК → Белок                           1. CCCAGAACUGAGAUCAAU                           2. AGUACCCGUAUUAACGGGпятница, 5 октя...
Центральная Догмапятница, 5 октября 12 г.
Геныпятница, 5 октября 12 г.
Омикипятница, 5 октября 12 г.
Геномика                           AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT                       ...
Геномикапятница, 5 октября 12 г.
Геномыпятница, 5 октября 12 г.
Сборка Геномапятница, 5 октября 12 г.
Comparative Genomicsпятница, 5 октября 12 г.
Протеомикапятница, 5 октября 12 г.
Протеомикапятница, 5 октября 12 г.
Домашнее задание                                       http://rosalind.info                                        • DNA  ...
Upcoming SlideShare
Loading in …5
×

20121005 algorithmsinbioinformatics vyahhi_lecture01

808 views

Published on

  • Be the first to comment

  • Be the first to like this

20121005 algorithmsinbioinformatics vyahhi_lecture01

  1. 1. Биология за 1 пару Николай Вяххи vyahhi@bioinf.spbau.ru Computer Science клуб Екатеринбург, 2012пятница, 5 октября 12 г.
  2. 2. Геном Человека 3,000,000,000 букв 13 лет (1990 - 2003) 3,000,000,000 $пятница, 5 октября 12 г.
  3. 3. Геном Человека 3,000,000,000 букв 13 лет (1990 - 2003) 3,000,000,000 $пятница, 5 октября 12 г.
  4. 4. Геном Человека 3,000,000,000 букв 2 недели 5,000 $пятница, 5 октября 12 г.
  5. 5. пятница, 5 октября 12 г.
  6. 6. ДНКпятница, 5 октября 12 г.
  7. 7. ДНК Двойная спираль Нуклеотиды: А—Т С—G bp = Base Pairsпятница, 5 октября 12 г.
  8. 8. Направление ДНКпятница, 5 октября 12 г.
  9. 9. Направление ДНКпятница, 5 октября 12 г.
  10. 10. Комплементарностьпятница, 5 октября 12 г.
  11. 11. Комплементарность 1. CCCAGAACUGAGAUCAAU 2. AGUACCCGUAUUAACGGGпятница, 5 октября 12 г.
  12. 12. ДНК → 2 x ДНК Репликацияпятница, 5 октября 12 г.
  13. 13. РНК Одна цепочка Рибонуклеотиды: А—U С—Gпятница, 5 октября 12 г.
  14. 14. ДНК → РНК Транскрипция T→Uпятница, 5 октября 12 г.
  15. 15. Белки / Протеины Аминокислоты (20): ACDEFGHIKLMNPQRSTVWY Функции: структурная, ферментативная, рецепторная, гормональная, транспортная, сократительная, защитная.пятница, 5 октября 12 г.
  16. 16. Структура Белка Последовательность α-спираль / β-лист Трёхмерная структура Комплекспятница, 5 октября 12 г.
  17. 17. РНК → Белок Трансляция Кодон (3 нуклеотида) → 1 аминокислотапятница, 5 октября 12 г.
  18. 18. РНК → Белок 1. CCCAGAACUGAGAUCAAU 2. AGUACCCGUAUUAACGGGпятница, 5 октября 12 г.
  19. 19. Центральная Догмапятница, 5 октября 12 г.
  20. 20. Геныпятница, 5 октября 12 г.
  21. 21. Омикипятница, 5 октября 12 г.
  22. 22. Геномика AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT AGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAA TACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATG AAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGAC GCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGG TAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGT TTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCT CTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGA TGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCC GCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAA AACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGAT TTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAAC GTTACTGTTATCGATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCG ATATTGCTGAGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGAT GGCAGGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAACGGTTCCGAC TACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATTGTTGCGAGATTTGGACGGACGTTG ACGGGGTCTATACCTGCGACCCGCGTCAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTA CCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCCCC ATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCTCAAGCACCAGGTACGCпятница, 5 октября 12 г.
  23. 23. Геномикапятница, 5 октября 12 г.
  24. 24. Геномыпятница, 5 октября 12 г.
  25. 25. Сборка Геномапятница, 5 октября 12 г.
  26. 26. Comparative Genomicsпятница, 5 октября 12 г.
  27. 27. Протеомикапятница, 5 октября 12 г.
  28. 28. Протеомикапятница, 5 октября 12 г.
  29. 29. Домашнее задание http://rosalind.info • DNA • RNA • REVC • PROT • HAMM http://rosalind.info/classes/enroll/ 171da3d314a0b07e00883287cd2b6ddeeeba225b/пятница, 5 октября 12 г.

×