Barberis 28 Nov 08

1,939 views

Published on

Published in: Health & Medicine
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,939
On SlideShare
0
From Embeds
0
Number of Embeds
7
Actions
Shares
0
Downloads
12
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Barberis 28 Nov 08

  1. 1. Overview PCR: Principi e applicazioni in genetica molecolare Mutation Detection Strategy: Mutazioni puntiformi Delezioni/duplicazioni DHPLC MLPA
  2. 2. L’invenzione della PCR • Ideata da Kary Mullis nel 1983 • La prima pubblicazione è apparsa nel 1985 • Premio Nobel per la chimica nel 1995
  3. 3. PCR (polymerase chain reaction) 1 ciclo completo di PCR
  4. 4. PCR da DNA genomico I primers, complementari a sequenze esistenti, richiedono la conoscenza delle sequenze fiancheggianti
  5. 5. Il Progetto Genoma 55 anni fa Umano…
  6. 6. Human Genome Genes (exons) 1.5-2 % CNCs 1-3% 95.0% sea3093 ~3,080,000,000 bp; ~25,000 genes
  7. 7. Geni umani clonati, Geni con mutazioni che 1.5% del genoma causano malattie genetiche 24418 2036 6may07
  8. 8. The Human Gene Mutation Database (HGMD) Gross deletions 3779 Complex rearrang 511 Gross Ins & Dupl 681 Repeat variations 155 Small Ins/Del 990 Small Insertions 4421 Small Deletions 10996 Regulatory 915 Single base pair substitutions Splicing 6428 7742 Nonsense Missense 30412 0 4000 8000 12000 16000 20000 24000 28000 32000 67030 mutations in 2478 genes
  9. 9. Genome browser: Ensemble
  10. 10. Genome browser: UCSC
  11. 11. Get a sequence ready to primer design
  12. 12. Progettazione dei Primers
  13. 13. Primers That Form Dimers • A primer may form a dimer with itself or with the other primer. • Primer dimers can be an excellent, but unwanted, substrate for the Taq polymerase.
  14. 14. Primers That Form Hairpins • A primer may be self-complementary and be able to fold into a hairpin • The 3´ end of the primer is base-paired, preventing it annealing to the target DNA.
  15. 15. Bioinformatic tools: Primer3 http://frodo.wi.mit.edu/primer3/input.htm
  16. 16. Scelta dei Parametri
  17. 17. …Primer 3 output
  18. 18. Scelta della target region
  19. 19. Folding DNA prediction: mfold http://www.bioinfo.rpi.edu/applications/mfold/cgi-bin/dna-form1.cgi
  20. 20. Folding output
  21. 21. Optimising the PCR Reaction • Annealing temperature of the primers. • The concentration of Mg2+ in the reaction. • The extension time. • (The denaturing and annealing times.) • (The extension temperature.) • (The amount of template and polymerase — “more is less”.)
  22. 22. Optimising the Annealing Temperature • Primers have a calculated annealing temperature (e.g. 54°C). • Temperature must be confirmed practically. • Temperature steps of 2°C above and below.
  23. 23. Optimising the Mg2+ Concentration • The fidelity of the PCR depends on [Mg2+]. • Vary [Mg2+] in steps of 0.5 mM. • Sometimes a compromise between yield and specificity.
  24. 24. Relazione tra Magnesio e dNTP Aumentare la concentrazione dei dNTP richiede un adeguato aumento delle concentrazione del Mg perche’ la reazione di PCR avvenga
  25. 25. Parametri fisici di PCR: numero di cicli •La variazione di resa piu’ evidente e’ intorno ai 24 cicli; spesso 28-30x sono sufficienti per la maggior parte degli amplimeri. •Si ha solo un picolo guadagno aumentando il numero di cicli fino a 60x
  26. 26. Un esempio di mutation detection: analisi dei geni TSC in pazienti con diagnosi clinica di Sclerosi Tuberosa
  27. 27. Tuberous Sclerosis Complex Autosomica dominante: frequenza 1/6000 2 geni malattia: TSC1 (9q34) e TSC2 (16p13) Sporadica (75%), familiare (25%) Espressione clinica molto variabile: da forme con chiazze ipomelanotiche e displasie corto-sottocorticali cerebrali asintomatiche, ad epilessia, ritardo mentale, rabdomiomi cardiaci, insufficienza renale e linfangioleiomomatosi polmonare. Amartoma: lesione caratteristica in diversi organi
  28. 28. Criteri diagnostici di Sclerosi Tuberosa 1. Angiofibromi facciali o placche fibrose 2. Fibromi ungueali o periungueali non traumatici 3. Tre o più macchie ipomelanotiche 4. Chiazze zigrinate Segni 5. Amartomi retinici nodulari multipli maggiori 6. Tuberi corticali* 7. Noduli subependimali 8. Astrocitomi subependimali a cellule giganti 9. Rabdomiomi cardiaci, singoli o multipli 10. Linfangiomiomatosi** 11. Angiomiolipomi renali** * Quando i tuberi corticali e l’eterotopia della sostanza bianca compaiono contemporaneamente, vengono considerati un unico segno di sclerosi tuberosa ** Quando sia linfangiomiomatosi che angiomiolipomi renali sono presenti, devono essere presenti anche altri segni per poter porre diagnosi di sclerosi tuberosa.
  29. 29. 1. Difetti focali dello smalto disseminati 2. Polipi amartomatosici rettali 3. Cisti ossee Segni 4. Eterotopia della sostanza bianca* minori 5. Fibromi gengivali 6. Amartomi extra renali 7. Aree ipopigmentate della retina 8. Macchie cutanee a “Coriandolo” 9. Cisti renali multiple CERTA → presenza di due segni maggiori o di un segno maggiore e due segni minori. PROBABILE → presenza di un segno maggiore e un segno minore. POSSIBILE → presenza di un segno maggiore o due segni minori. * Quando i tuberi corticali e l’eterotopia della sostanza bianca compaiono contemporaneamente, vengono considerati un unico segno di sclerosi tuberosa
  30. 30. Segni TS sono età-dipendenti e non sono presenti in tutti i pazienti Retinal Hypomelanotic Facial Renal Cysts, Peri-Ungueal hamartoma maculae Angiofibromas Angiomyolipomas Fibromas Cardiac Rhabdomyomas Giant-Cell Cortical Astrocytoma Tubers Subependymal Nodules Lymphangio- leiomyomatosis Prenatal 20 week 0 5 10 Age (years) 20 30 40
  31. 31. TSC1 23 esoni, 21 codificanti 8,6 kb mRNA (4,5 kb utr) Proteina: amartina 130 kDa TSC2 42 esoni, 41 codificanti 5,4 kb mRNA Proteina: tuberina 180 kDa
  32. 32. Il Complesso TSC TSC2 • cr. 16p13.3 • 42 esoni, 41 codificanti • 5,4 kb mRNA • Proteina: tuberina 180 kDa TSC1 • 55 kb sul cr. 9q34 • 23 esoni, 21 codificanti • 8,6 kb mRNA (4,5 kb utr) • Proteina: amartina 130 kDa
  33. 33. Aumento della dimensione delle cellule nei mutanti di TSC1 o TSC2 in Drosofila
  34. 34. 15-7-2008 940 famiglie TSC (~ 3100 individui ) da > 50 centri del Gruppo Collaborativo Italiano TSC probandi anamnest. sporadici probandi SPORADICI “FAMILIARI” 75 % 25 % mut. confermata de novo 43 % TSC1 57 % 80 % TSC2 20 %
  35. 35. 15-7-2005 Rho activation ERM binding TSC1 Tuberin interaction Coiled-coil self interaction Missense Ins/de 85 23% tot. mut: S l plicing 370 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Stop Large del. Rabaptin binding? GAP domain AKT phosf. Coiled-coil Steroid Hamartin interaction receptor TSC2 binding? 285 77% 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41
  36. 36. Screening di mutazioni nei geni TSC • Dimensione dei due geni da analizzare (64 esoni) • Mancanza di chiari hot spot mutazionali • Diverse tipologie di mutazioni Protocollo in uso DHPLC (mut. puntiformi)/sequenza dei profili HD + MLPA (delezioni) Sensibilita’ dell’ 85-90%
  37. 37. HPLC: High Performance Liquid Cromatography • La cromatografia in fase liquida ad alte prestazioni è una tecnica di separazione ad elevata efficienza e selettività che consente di caratterizzare differenti molecole in base a specifiche caratteristiche chimiche, chimico-fisiche e steriche (dimensionali e strutturali).
  38. 38. Advantages of DHPLC • No sample preparation, uses PCR products directly • Automated, run 24 hours a day unattended • Perform 450 automated analyses per day • Per analysis cost of under $1 per sample.
  39. 39. Considerazioni sui costi dell’analisi Sequenza diretta = 6-8.50 euro Costo del sequenziamento diretto (64 amplimeri) = 380-540 euro Costo analisi dHPLC (64 amplimeri) = 64 euro Numero di sequenze medie per pz (dopo dHPLC) = 3 (18-25 euro) Risparmio per ogni probando analizzato= 375 euro circa
  40. 40. Anatomy of the System
  41. 41. Sistema cromatografico E’ costituito da: Fase stazionaria: solida, costituita da un polimero di polistirene-divinil-benzene (diametro dei pori circa 2 micron) impaccata in una colonna cromatografica. Fase Mobile: liquida, costituita dal solvente ( di solito un tampone) che scorre attraverso la colonna.
  42. 42. PRC & Formazione degli HD
  43. 43. Interazione tra DNA e colonna cromatografica
  44. 44. Why denaturing HPLC… Le molecole di DNA con gruppi fosfato della molecoladalDNA Le cariche negative dei il mismatch eluiscono prima di sono attratte dalle cariche positive dei gruppi ammonio del sistema cromatografico (interazione più debole) TEAA (controione)
  45. 45. UV Detector e data analysis
  46. 46. Stanford DHPLC Melt Calculator http://insertion.stanford.edu/melt.html
  47. 47. Navigator melting profiles page Frammento WT Frammento mutato
  48. 48. Comportamento della molecola di DNA a diverse Rtm: esone 12 TSC2 RTm 62.4 ° C g.1312 A>T, p.K438X RTm 62 ° C RTm +2 64 ° C Rtm 63.8 ° C MUT. POS Ctrl emizig.
  49. 49. Sensibilita’ analitica: Esone 16 RTm 56.1° C wt Met666Thr (t>c) Met666Arg (t>g) Gly671Arg (g>a) 666 671 ATG AAT GAA AAG GTT GGG ACG AGG AGG
  50. 50. Elaborazione del dato cromatografico Gly671Arg Met666Thr Met666Arg RTm 56.1° C
  51. 51. Es. di SNP ricorrenti: esone 15 TSC1 RTm 62 ° C RTm 63 ° C g.1618 -39 c>t 872.3 g.1618 -14 c>t 886.3 g.1618 -14 c>t -39 c>t 867.3
  52. 52. Es. di mutazione: Famiglia in esone 7 TSC1 Father Mother healthy healthy RTm 61 ° C TSC1 ex07: 574delT Son L191 fs> +17aa->stop affected
  53. 53. Complicazione all’analisi al dHPLC: alcuni casi particolari
  54. 54. MOSAICISMO genetico il gene mutato è presente in un individuo malato, ma non in tutte le cellule o in tutti i tessuti talvolta le cellule del sangue con la mutazione sono troppo poche per essere identificate dal test capelli ? cute sangue
  55. 55. MOSAICISMO: quanto frequente ? 2 o più figli con la stessa mutazione e genitori sani, senza mut. nel sangue: Mosaicismo nella linea germinale 5 su 211 famiglie ( 2-3 %) Non tutte le cellule del sangue del genitore malato sono mutate: Mos. Somatico 18 su 211 ( 8 % ) nel genitore malato nel probando 9 / 211 (4 %) 9 / 211 (4 %)
  56. 56. Paternal Mosaicism (DHPLC pos., SEQ. neg.) M Mother healthy Fam. 131 TSC2 ex 9 T A C C A G G F homoz. Father w.t. affected seq. T A C N A G G D 991 C>T Daughter Q325X affected 64° RTm+2
  57. 57. allelic ST 198 MUT ST 177 allelic ratio DHPLC cells DHPLC ratio wt : % wt : mut mut 100 : 0 0 100 : 0 95 : 5 10 95 : 5 90 : 10 20 90 : 10 80 : 20 40 80 : 20 70 : 30 60 70 : 30 60 : 40 80 60 : 40 55 : 45 90 55 : 45 50 : 50 100 50 : 50
  58. 58. Polymorphisms in the seq. recognized by the primers must be excluded using external primers Mut in CIS preferential amplification of w.t. allele Mut in TRANS preferential amplification of mutant allele
  59. 59. PRIMER EXTENSION After amplification of a fragment of DNA containing the SNP, an oligonucleotide primer is annealed immediately upstream or downstream from the SNP. In the presence of the appropriate dNTPs and ddDNTPs, the primer is extended (Sequenase) by one or more bases depending upon the sequence at the polymorphic site.
  60. 60. Principio della Primer Extension Forward 20 bp G Reverse C A T 20 bp GA + ddGTP, ddATP + ddCTP, ddTTP G C A T 21 bp 21 bp
  61. 61. Fam. 131: Mosaicism confirmed by Primer Extension Forward Reverse C Normal G allele C Father G 131.1 T A Mutated allele (991 C>T) T A T C G Daughter A 131.3
  62. 62. Ricerca di delezioni
  63. 63. Advantages of MLPA • Detection of copy number of 45 genomic DNA sequences in a simple to perform, PCR based, reaction. • Requires only 20 ng human DNA • Only a thermocycler and a sequence type electrophoresis system are required. • Identical protocol for many different applications. • High throughput ; Results available within 24 hrs. • All reagents have proved to be very stable. • Including electrophoresis, total reagent costs are < EUR 15,- / reaction.
  64. 64. Disadvantages of MLPA Reactions are more sensitive to contaminants (PCR inhibitors e.g. phenol) Cannot be used to investigate single cells Is not a method to detect unknow point mutations
  65. 65. SALSA MLPA probes • Denaturation • Hybridization MLPA technique • Ligation • Amplification
  66. 66. Hybridysation & Ligation 1. The MLPA probemix is added to denatured genomic DNA 2. The two parts of each probe hybridise to adjacent target sequences 3. Probes are ligated by a thermostable ligase
  67. 67. Amplification 4. A universal primer pair is used to amplify all ligated probes. The amplification product of each probe has a unique length (130 480 bp).
  68. 68. Profilo di delezione del gene MSH2 • • • • • • normale • • • • • • • • • • deleto
  69. 69. Delezione esoni 2-5 del gene STK11 e2 Delezione esoni 2-5 STK11 e3 e4 e5 Non deleto (controllo)
  70. 70. Gene MSH2: delezione esone 8 e8 Delezione esone 8MSH2 Non deleto (controllo)
  71. 71. Polimorfismo nell’ esone 6 (MSH2) riduce l’efficienza di ibridazione e simula una delezione TCTCTGGCCTGCCTTGCTGAATAAGTGTAAAACCC 984C>T ligation site Sonda Media SD MSH2 ex4 1,04 0,07 ctrl cr11p13 1,10 0,09 MLH1 ex 5 0,94 0,04 1,40 MSH2 ex5 1,11 0,06 1,20 1,19 1,11 1,04 1,10 1,11 1,07 1,04 1,08 1,01 MLH1 ex6 1,19 0,10 1,00 0,94 0,99 0,99 MSH2 ex6 0,63 0,09 0,80 0,63 MLH1 ex7 1,07 0,04 0,60 MSH2 ex7 0,99 0,03 0,40 MLH1 ex8 0,99 0,05 0,20 MSH2 ex8 1,01 0,05 0,00 MLH1 ex9 1,04 0,04 MSH2 ex4 ctrl cr11p13 MLH1 ex 5 MSH2 ex5 MLH1 ex6 MSH2 ex6 MLH1 ex7 MSH2 ex7 MLH1 ex8 MSH2 ex8 MLH1 ex9 ctrl cr17q21 MSH2 ex9 ctrl cr17q21 1,08 0,10 MSH2 ex9 1,11 0,08
  72. 72. conclusioni

×