Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

The Genome Assembly Problem

575 views

Published on

a lightning talk about the de Bruijn Graphs assembling algorithm

Published in: Technology
  • Be the first to comment

The Genome Assembly Problem

  1. 1. The Genome Assembly Problem a lightning talk Mark Chang
  2. 2. The Genome Assembly Problem ACCTCAGAACCCCGCAGTCACGTAGCGTTTGTGGGTACCTCGTGTCTAGT ACCTCAGAACCCCGCAGTCACGTAGCGTTTGTGGGTACCTCGTGTCTAGT Fragmented and Sequenced Finding Overlaps Recunstruction CGTAGCGTTTGTGGGTACCTCAGAACCC AACCCCGCAGTCACGTAG GTGGGTACCTCGTG TCGTGTCTAGT Genome ACCTCAGAACCC AACCCCGCAGTCACGTAG GTGGGTACCTCGTGCGTAGCGTTTGTGGGT TCGTGTCTAGT Short-reads
  3. 3. Finding Overlaps • It is very hard to find the overlaps between millions of short-reads ACCTCAGAACCC AACCCCGCAGTCACGTAG GTGGGTACCTCGTGCGTAGCGTTTGTGGGT TCGTGTCTAGT
  4. 4. Finding Overlaps • Using de Bruijn Graphs AAB CDC ABC BCC CCD CDA DCC AABCCDCCDA graph traversal AABCCDCCDA convert to de Bruijn Graph
  5. 5. Using de Bruijn Graphs • Convert the short-reads into k-mers ACCTCAGAACCC AACCCCGCAGTCACGTAG GAACC AGAAC CAGAA ACCTC CCTCA CTCAG TCAGA AACCC AACCC ACGTA CACGT GCAGT CGCAG CCGCA CCCGC ACCCC CCCCG CGTAG
  6. 6. Using de Bruijn Graphs • Build de bruijn graph from k-mers GAACC AGAAC CAGAA ACCTC CCTCA CTCAG TCAGA AACCC GAACC AGAAC CAGAA ACCTC CCTCA CTCAG TCAGA AACCC
  7. 7. Using de Bruijn Graphs • Build de bruijn graph from k-mers GAACC AGAAC CAGAA ACCTC CCTCA CTCAG TCAGA AACCC AACCC ACGTA CACGT GCAGT CGCAG CCGCA CCCGC ACCCC CCCCG CGTAG ACGTA CACGT GCAGT CGCAG CCGCACCCGCACCCC CCCCG CGTAG
  8. 8. Using de Bruijn Graphs • Graph traversal ACCTCAGAACCCCGCAGTCACGTAG GAACC AGAAC CAGAA ACCTC CCTCA CTCAG TCAGA AACCC ACGTA CACGT GCAGT CGCAG CCGCACCCGCACCCC CCCCG CGTAG
  9. 9. Reference • The Genome Assembly Problem • http://homolog.us/Tutorials/index.php?p=1.1&s=1

×