Endosulfan does not bio accumulate due to microbes in soil- report

1,789 views

Published on

This study reports the enrichment nd isolation of a microbial culturew capable of degrading endosulfan with minimal production of endosulfan sulfate, the toxic metabolite of endosulfan, from tropical acid soil. The results of this study suggest that this novel strain is a valuable source of potent endosulfan- degrading enzymes for use in enzymatic bioremedation. This clearly states that endosulfan does not bio- accumulate due to the microbial culture in the soil.

Published in: Health & Medicine
1 Comment
0 Likes
Statistics
Notes
  • As the author of the research paper 'Enrichment and Isolation of Endosulfan Degrading Microorganism from Tropical Acid Soil' I object to the title 'Endosulfan does not bio accumulate due to microbes in soil - report'.
    As you are all aware, soil contains more than trillions of microorganisms and this research paper reports the enrichment and isolation of one strain of microorganism that can degrade endosulfan. This research paper does not provide any insight into how the rest of the trillions of microorganisms behave in soil. So the title 'Endosulfan does not bio accumulate due to microbes in soil - report' is misleading the viewers regarding the contents of the research paper.
    It is suspected that this is the handiwork of the pro-endosulfan bandwagon that is eager to falsely interpret scientific works to further their trade interests.
    The owners of this website are requested to kindly ensure that this website does not become a platform for such malicious activities.
    Further, all the visitors to this website are requested not to misunderstand the contents of the research paper because of this misleading title'Endosulfan does not bio accumulate due to microbes in soil - report'.
    The authors of this research paper are not in concurrence with this misinterpretation of their research work and strongly condemn the misuse of their research paper.
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • Be the first to like this

No Downloads
Views
Total views
1,789
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
38
Comments
1
Likes
0
Embeds 0
No embeds

No notes for slide

Endosulfan does not bio accumulate due to microbes in soil- report

  1. 1. This article was downloaded by: [Consortium for e-Resources in Agriculture]On: 16 September 2009Access details: Access Details: [subscription number 912062045]Publisher Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,37-41 Mortimer Street, London W1T 3JH, UK Journal of Environmental Science and Health, Part B Publication details, including instructions for authors and subscription information: http://www.informaworld.com/smpp/title~content=t713597269 Enrichment and isolation of endosulfan-degrading microorganism from tropical acid soil Surya Kalyani S a; Jitender Sharma b; Surender Singh c; Prem Dureja d; Lata c a Food and Agriculture Department, Bureau of Indian Standards, New Delhi, India b Department of Biotechnology, Kurukshetra University, Kurukshetra, Haryana, India c Division of Microbiology, Indian Agricultural Research Institute, New Delhi, India d Division of Agricultural Chemicals, Indian Agricultural Research Institute, New Delhi, India Online Publication Date: 01 September 2009To cite this Article Kalyani S, Surya, Sharma, Jitender, Singh, Surender, Dureja, Prem and Lata(2009)Enrichment and isolation ofendosulfan-degrading microorganism from tropical acid soil,Journal of Environmental Science and Health, Part B,44:7,663 — 672To link to this Article: DOI: 10.1080/03601230903163665URL: http://dx.doi.org/10.1080/03601230903163665 PLEASE SCROLL DOWN FOR ARTICLEFull terms and conditions of use: http://www.informaworld.com/terms-and-conditions-of-access.pdfThis article may be used for research, teaching and private study purposes. Any substantial orsystematic reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply ordistribution in any form to anyone is expressly forbidden.The publisher does not give any warranty express or implied or make any representation that the contentswill be complete or accurate or up to date. The accuracy of any instructions, formulae and drug dosesshould be independently verified with primary sources. The publisher shall not be liable for any loss,actions, claims, proceedings, demand or costs or damages whatsoever or howsoever caused arising directlyor indirectly in connection with or arising out of the use of this material.
  2. 2. Journal of Environmental Science and Health Part B (2009) 44, 663–672 Copyright C Taylor & Francis Group, LLC ISSN: 0360-1234 (Print); 1532-4109 (Online) DOI: 10.1080/03601230903163665 Enrichment and isolation of endosulfan-degrading microorganism from tropical acid soil SURYA KALYANI S1 , JITENDER SHARMA2 , SURENDER SINGH3 , PREM DUREJA4 and LATA3 1 Food and Agriculture Department, Bureau of Indian Standards, New Delhi, India 2 Department of Biotechnology, Kurukshetra University, Kurukshetra, Haryana, India 3 Division of Microbiology, Indian Agricultural Research Institute, New Delhi, India 4 Division of Agricultural Chemicals, Indian Agricultural Research Institute, New Delhi, IndiaDownloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009 Endosulfan (6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9-methano-2,3,4-benzo-dioxathiepin-3-oxide) is a cyclodiene organochlorine currently used as an insecticide all over the world and its residues are posing a serious environmental threat. This study reports the enrichment and isolation of a microbial culture capable of degrading endosulfan with minimal production of endosulfan sulfate, the toxic metabolite of endosulfan, from tropical acid soil. Enrichment was achieved by using the insecticide as sole sulfur source. The enriched microbial culture, SKL-1, later identified as Pseudomonas aeruginosa, degraded up to 50.25 and 69.77 % of α and β endosulfan, respectively in 20 days. Percentage of bioformation of endosulfan sulfate to total formation was 2.12% by the 20th day of incubation. Degradation of the insecticide was concomitant with bacterial growth reaching up to an optical density of 600 nm (OD600) 2.34 and aryl sulfatase activity of the broth reaching up to 23.93 µg pNP/mL/hr. The results of this study suggest that this novel strain is a valuable source of potent endosulfan–degrading enzymes for use in enzymatic bioremediation. Further, the increase in aryl sulfatase activity of the broth with the increase in degradation of endosulfan suggests the probable involvement of the enzyme in the transformation of endosulfan to its metabolites. Keywords: Biodegradation; endosulfan; endosulfan sulfate; Pseudomonas aeruginosa; tropical acid soil. Introduction step in the investigation of enzymatic technologies for en- dosulfan detoxification is the definitive identification of a Endosulfan (6, 7, 8, 9, 10, 10-hexachloro-1, 5, 5a, 6, 9a- biological source of endosulfan–degrading activity. hexahydro-6, 9-methano-2, 3, 4-benzodioxyanthiepin- 3- In a bioremediation process, heterotrophic microorgan- oxide) is widely employed as an insecticide in world agri- isms break down substrates (hazardous compounds) to ob- culture. Technical grade endosulfan contains two stereoiso- tain chemical energy, hence organic pollutants can serve as mers, α and β endosulfan in the ratio of 7: 3. In the close carbon, energy and nutrient sources for microbial growth. vicinities of agricultural fields, the contamination of at- Some studies have described endosulfan as a sulfur source mosphere, soils, sediments, surface and rain waters and for microbial growth and a poor biological energy source foodstuffs by endosulfan has been documented in numer- when used as a sole carbon source.[8,9] Sutherland et al.[8] ous previous studies.[1] The persistence of endosulfan in selected microorganisms for their ability to release the sul- soil and water environments has been observed by different fite group from endosulfan and to use this insecticide as researchers under different conditions.[2,3] Its harmful im- a source of sulfur for bacterial growth. Awasthi et al.[10] pacts on aquatic fauna and numerous mammalian species isolated a bacterial co-culture using endosulfan as a sole including human beings have been reported several times carbon source. To date, some physicochemical and biolog- in literature.[4−7] ical remedial strategies have been described by researchers Detoxification of pesticides through biological means which lead to degradation of endosulfan into both toxic is receiving serious attention as an alternative to existing and non-toxic metabolites.[8−22] methods, such as incineration and landfill. A preliminary In this study we are reporting a bacterial strain SKL-1, isolated using enrichment with endosulfan as sole sulfur Address correspondence to Jitender Sharma, Department of source. The organism identified as Pseudomonas aerugi- Biotechnology, Kurukshetra University, Kurukshetra, Haryana, nosa, is the most active endosulfan-degrading single strain India; E-mail: jksharma.kuk@gmail.com of microorganism, with minimal production of endosul- Received December 3, 2008. fan sulfate, the toxic metabolite of endosulfan degradation.
  3. 3. 664 Kalyani et al. This strain will be further investigated for its endosulfan- culture). Thereafter, 0.1 mL of the enriched medium was degrading potential in soil and for the enzymatic reactions transferred into 10 mL of fresh sterile enrichment medium in detoxification of endosulfan. containing 100 ppm endosulfan and further incubated for two weeks (Round 2 enrichment culture). Materials and methods Endosulfan degrading monocultures Pesticide standards To obtain pure cultures of single strains, 1 mL aliquots of round 2 enrichment culture was centrifuged (8000 rpm, Endosulfan isomers and metabolites, viz., endosulfan sul- 10 min), the supernatant was removed and cell residues fate (C9 H8 Cl4 S), endosulfan diol (C9 H8 Cl6 O), endosulfan were resuspended in 50 µL of sterile enrichment media ether (C9 H6 ClO2 ) and endosulfan lactone (C9 H4 Cl6 O2 ) by vortexing. Aliquots of this suspension were plated on to be used as standards were purchased from Merck, enrichment medium agar by spread plating and incubated Germany. under aerobic conditions at 28◦ C 7d. Isolates were further purified by streaking on fresh plates. Intrinsic antibioticDownloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009 Sample collection for enrichment studies resistance pattern of the selected cultures was carried out to avoid redundancy among the isolates. Samples of laterite, coastal sandy and red loam soils were collected from Kerala (India) having a history of endosul- Screening of isolates for endosulfan degradation in liquid fan application. Top 0–15 cm of soil was collected using culture media core samplers and covered with plastic bags to minimize changes in physical parameters. The samples were stored at Four isolates of bacteria exhibiting luxury growth on the en- 4◦ C. richment medium were selected, and grown in nutrient cul- ture broth containing 100 ppm endosulfan. Cultures were Enrichment of microbial communities incubated (28◦ C, 160 rpm) for one week and cells were har- vested by centrifugation (5000 rpm, 20 min) and washed Soil (approximately 50 g) was first enriched for endosulfan- thrice in 30 mL of nutrient culture media. Cells were there- degrading organisms by the addition of 5 mg of technical after resuspended in the same media. Endosulfan dissolved grade endosulfan in 200 µL of acetone to remoistened soil, in acetone was used to spike Erlenmeyer flasks as described followed by incubation in the dark at room temperature earlier to obtain a final concentration of 100 ppm endosul- for 1 month. Further enrichment was achieved by initiating fan in the media. Two milliliters of inoculum was added to shake flask enrichment cultures from these samples by using each spiked flask except the control flasks after adjusting endosulfan as the only added source of sulfur. their optical densities and incubated (28◦ C, 160 rpm) for The enrichment medium (pH 6.8) consisted of 0.225 g of 20 d. This study was performed in triplicates. K2 HPO4 , 0.225 g of KH2 PO4, 0.225 g of NH4 Cl, 0.845 g of For studying degradation of endosulfan sulfate by SKL- (MgCl)2 .6H2 O, 0.005 g of CaCO3, 0.005 g of FeCl2 .4H2 O, 1, endosulfan sulfate dissolved in acetone was used to spike 1.0 g of D-glucose and 1 mL of a trace element solu- Erlenmeyer flasks as described earlier to obtain a final con- tion per liter. The stock trace element solution contained centration of 10 ppm endosulfan sulfate in the media. 198.0 mg of MnCl2 .4H2 O, 136.0 mg of ZnCl2, 171.0 mg of CuCl2 .2H2 O, 24.0 mg of CoCl2 .6H2 O and 24.0 mg of Molecular identification of bacterial isolate NiCl2 .6H2 O per liter. Erlenmeyer flasks (50 mL) and nutrient culture media The bacterial isolate, tentatively designated SKL-1, was were autoclaved separately for 20 min at 121◦ C. Fifty mi- identified by analysis of 16S rDNA. Amplification of 16S r croliters of acetone containing 1.0 mg of technical-grade DNA was carried out by polymerase chain reaction using a endosulfan (99% pure) was aseptically added to each ster- thermal cycler (M. J. Research PTC-100). The polymerase ilized flask in a laminar flow hood allowing the acetone chain reactions (PCR) were carried out with 50–90 ng of to evaporate. Nine milliliters of enrichment medium was pure genomic DNA. The forward (PA) and reverse primers added to each flask. (PH) were custom synthesized from Bangalore Genei Pvt. Microbial inoculums for the enrichment studies were pre- Ltd. The sequence of the oligonucleotide primers used for pared by shaking 20 g of the enriched soil sample overnight amplification of 16S rDNA genes were: in 100 mL of enrichment medium at 25◦ C and 160 rpm. The PA: 5 CACGGATCCAGAGTTTGAT(C/T)(A/C)- solid particles were allowed to settle for one hour and 1 mL TGGCTCAG3 of supernatant solution from the source flasks was used PH: 5 GTGCTGCAGGGTTACCTTGTTACGACT3 to inoculate the spiked flasks. Uninoculated spiked flasks were also set up as a control to compensate for any chemi- The primers PA and PH, located at the extreme 5 and cal degradation. The flasks were incubated at 28◦ C with or- 3 ends, respectively, of the ribosomal rDNA sequence, en- bital shaking (160 rpm) for two weeks (Round 1 enrichment able the amplification of the entire gene. Purity of the PCR
  4. 4. Endosulfan-degrading microorganism 665 product was checked by agarose gel electrophoresis. Se- dx = endosulfan degraded on nth day (ppm) – endosulfan quencing of the purified PCR product was carried out degraded on n-1th day (ppm) and at an automated fluorescent sequencing facility of Ban- dy = 1 (day) glore Genei Pvt. Ltd. DNA sequence similarity search was done by computing at Basic Local Alignment Search Tool (BLAST), developed by National Center for Biotechnol- Results and discussion ogy Information (NCBI), US[23] for searching the DNA and protein database. Enrichment of endosulfan degrading microorganisms from soil Analytical procedures The different colonies of bacteria isolated from the enrich- For determination of endosulfan and endosulfan sulfate ment media were numbered SKL-1 to 11. Intrinsic antibi- concentration, 5 mL of broth sample kept for incubation otic resistance has been used extensively as a technique for was centrifuged (10000 rpm; 10 min) and the supernatant strain identification in soil bacteria and it has been reported that the pattern of antibiotic resistance of each strain is aDownloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009 was mixed with 0.5 g of activated charcoal. The sample was poured in a funnel containing 4 cm layer of anhydrous stable property by which the strains could be recognized.[25] sodium sulfate over a plug of cotton. The sample was eluted Keeping this in mind, the colony morphology and intrinsic with 100 mL of n-hexane:acetone (7:3) and the solvent was antibiotic resistance pattern of the eleven different isolates evaporated to dryness and final volume was made with n- was studied and it was revealed that only four of them were hexane at the time of analysis. Appropriate dilutions of the essentially unique and hence were used for further studies. sample extract were then analyzed with a Hewlett Packard The method of enrichment relies on bacteria being able 5890, Series II gas chromatograph equipped with a methyl to grow in the minimal media and hence the number of silicon column (10 m × 0.53 mm × 2.65 µm film thickness) culturable bacteria is severely restricted. packed with HP - 1 and electron capture detector (ECD) 63 Ni. The oven temperature was 200◦ C, injector tempera- Screening microbial isolates for their ability to utilize ture was 250◦ C and the detector temperature was 250◦ C. endosulfan for growth Nitrogen was the carrier gas at a flow rate of 60 mL min−1 . Bacterial densities in liquid cultures were determined Regression analysis of bacterial population (106 CFU/mL) spectrophotometrically by measuring the absorbance at on OD600 revealed that it followed a linear kinetics, the 600 nm. Aryl sulfatase activity was also measured regression equation being y=34.204x with an R2 value of spectrophotometrically.[24] 0.9045 indicating perfect fit. Hence measurement of OD600 was performed to quantify the growth of the isolate in broth. Calculation of degradation The isolates were screened for their ability to utilize en- Percentage of biodegradation of endosulfan is the differ- dosulfan as the sole sulfur source. Endosulfan is a poor ence between the percentage of degradation of endosulfan biological energy source, as it contains only six potential in the inoculated flasks and the uninoculated control. reducing electrons. But it has a relatively reactive cyclic sul- Percentage of bioformation of endosulfan sulfate to total fite diester group and can serve as a good sulfur source.[26] formation of endosulfan sulfate was calculated according This selection procedure enriches for a culture capable of to Equation 1. either the direct hydrolysis of endosulfan or the oxidation of the insecticide followed by its hydrolysis, thereby reducing BES = [(Ein − Eun ) × 100] /Ein (1) formation of toxic endosulfan sulfate.[8] Where, SKL-1 was the only isolate able to grow utilizing endo- BES = Percentage of bioformation of endosulfan sulfate to sulfan as a sulfur source and hence was used for further total formation of endosulfan sulfate (%) studies. Ein = Endosulfan sulfate formation in inoculated flask (ppm) and Endosulfan degradation by enriched culture Eun = Endosulfan sulfate formation in uninoculated flask (ppm) The gas chromatography (GC) Rt (retention times) for α Progressive rate of degradation of endosulfan was calcu- endosulfan and β endosulfan were 2.70 and 3.70 minutes, lated according to Equation 2. respectively (Fig. 1). The total degradation of α endosul- fan and β endosulfan was 94.40 and 96.38% , respectively K = dx/dy (2) after 20 days of incubation (Figs. 2 and 3). Thus the to- Where, tal degradation of β endosulfan was more than that of K = Progressive rate of degradation of endosulfan for nth α endosulfan. This may be because of the fact that the day (ppm/day) rate of non-biological degradation involving hydrolysis and
  5. 5. 666 Kalyani et al. recently, Siddique et al.[18] reported that bacteria degraded relatively more β endosulfan than α endosulfan. The percentage of biodegradation to total degradation was 76.04 and 72.39% for α and β isomers, respectively after 20 days of incubation. Thus biotransformation contributed to a major portion of total transformation of both the iso- mers in the present study. The predominance of biological degradation over non-biological degradation or vice versa depends on the culture conditions in addition to the effi- ciency of the microbial culture. Endosulfan is susceptible to alkaline hydrolysis, with approximately ten fold increase in hydrolysis occurring with each increase in pH unit.[12] Many previous studies have been unable to differentiate between chemical and biological hydrolysis of endosulfanDownloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009 because microbial growth has led to increases in the alkalin- ity of the culture medium.[12,13] To minimize non-biological hydrolysis, the enrichment medium was buffered to pH 6.8 and cultures were monitored constantly for change in pH. The progressive rate of degradation of endosulfan exhib- ited a prominent increase by the 3rd day of incubation and reached its peak value of 13 ppm/day. Afterwards, there was a steady decrease in the progressive rate of degradation (Fig. 4). The low initial rate of degradation might represent a lag phase while it got accelerated as the incubation pro- ceeded, most likely due to induction/activation of enzymes in the inoculated cultures. Similar observations were made by Hussain et al.[19] The steady decrease in rate of degra- dation afterwards may be due to exhaustion of nutrients in the media. The metabolites formed during the degradation of endo- sulfan were identified as endosulfan diol (Rt = 0.89 min), endosulfan ether (Rt = 2.21 min) endosulfan lactone (Rt = 3.21 min) and endosulfan sulfate (Rt = 4.90 min) (Fig. 1). Miles and Moy[13] and Katayama and Matsumura[20] have confirmed the formation of these metabolites by microbial isolates during biodegradation of endosulfan. Fig. 1. Separation of endosulfan and its metabolites by gas liquid Endosulfan diol, endosulfan ether and endosulfan lac- chromatography. (A) Uninoculated control – Day 0; (B) inocu- tone are nontoxic, where as endosulfan sulfate is toxic in lated with SKL-1– Day 0; (C) uninoculated control– Day 20; and nature. Unlike the isomers of endosulfan, the toxic metabo- (D) inoculated with SKL-1 – day 20. 1 – solvent peak; 2 – endo- lite endosulfan sulfate can accumulate in animal fat and sulfan diol; 3 – endosulfan ether; 4 – α endosulfan; 5 – endosulfan hence the formation of endosulfan sulfate was studied in lactone; 6 – β endosulfan; 7 – endosulfan sulfate. detail.[30] It was observed that by the 20th day 15.91% of the applied endosulfan was transformed to endosulfan sulfate. Of the total endosulfan degraded 16.74% was converted photodecomposition is more for the β isomer and the differ- to endosulfan sulfate. There was a steady decrease in the ence is all the more prominent in alkaline conditions.[13,27,28] percentage of bioformation of endosulfan sulfate to total Further, the recent discovery that the isomers form a eutec- formation as period of incubation progressed. By the 20th tic mixture indicates that application of a mixture is most day of incubation, the percentage of bioformation of en- likely to enhance the volatilization of the β isomer.[29] dosulfan sulfate to total transformation was only 2.12% The biodegradation of α endosulfan and β endosulfan (Table 1). by SKL- 1 was 71.78 and 69.77% , respectively after 20 days In order to clarify whether endosulfan sulfate was further of incubation (Figs. 2 and 3) indicating that biodegradation degraded by SKL-1, biodegradation of endosulfan sulfate of the α isomer is more than that of the β isomer. Earlier by SKL-1 was studied by spiking the medium with 10 ppm studies have shown that microbial species prefer α endo- endosulfan sulphate. Table 2 indicates that there was no fur- sulfan for degradation over β endosulfan.[10,22] However, ther degradation of endosulfan sulfate by SKL-1. Similar
  6. 6. Endosulfan-degrading microorganism 667Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009 Fig. 2. Progressive degradation of α endosulfan by SKL-1 in pure culture. observations were also made by Sutherland et al.[8] and fate by SKL-1 with time. This suggests that the metabolism Shivaramaiah and Kennedy[21] in their studies on biodegra- of endosulfan is mediated by two divergent pathways, one dation of endosulfan by soil bacteria. hydrolytic leading to the production of endosulfan diol, The inability to transport the more polar compound endosulfan ether and endosulfan lactone and the other ox- into the cell or the absence of an enzyme capable of hy- idative leading to the production of the toxic metabolite, drolyzing the oxidized compound may be reasons for the endosulfan sulfate, which is resistant to further biodegra- lack of biodegradation of endosulfan sulfate. The differ- dation. Kullman and Matsumura[15] while working with ent oxidation states of the sulfur in endosulfan and en- Phanerochaete chrysosporium suggested similar mechanism dosulfate make it unlikely that the same enzyme will be of degradation of endosulfan. capable of releasing the sulfur containing moiety from both. Thus the decrease in the percentage of bioformation of Bacterial density, culture pH and aryl sulfatase activity endosulfan sulfate to total formation of endosulfan sul- fate during the course of incubation may be attributed to The bacterial density, culture pH and aryl sulfatase activity the reduction in the rate of formation of endosulfan sul- were measured to assess the relationship between growth Fig. 3. Progressive degradation of β endosulfan by SKL-1 in pure culture.
  7. 7. 668 Kalyani et al. Table 1. Progressive formation of endosulfan sulfate from endo- Table 2. Incubation of endosulfan sulfate with SKL-1 in vitro. sulfan by SKL-1 in pure culture. Endosulfan sulfate remaining Endosulfan Percentage of in broth (ppm) Endosulfan sulfate bioformation of sulfate formed formed to endosulfan Days of Control Incubation with Days of endosulfan to endosulfan sulfate to incubation (Media) SKL-1 incubation applied (%) degraded (%) total formation 0 10.00 10.00 0 0.00 0.00 0.00 1 9.98 9.98 1 0.23 4.41 11.02 2 9.97 9.97 2 1.04 8.84 7.38 3 9.95 9.96 3 2.18 5.15 5.28 4 9.91 9.92 4 3.83 8.11 3.26 5 9.92 9.91 5 7.02 13.55 1.92 6 9.90 9.91 6 7.08 12.29 2.04 7 9.87 9.88Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009 7 7.57 11.81 1.91 8 9.88 9.89 8 7.83 11.16 2.13 9 9.87 9.87 9 8.59 11.57 2.24 10 9.88 9.86 10 8.88 11.58 2.17 11 9.87 9.85 11 10.29 13.05 1.87 12 9.84 9.85 12 10.69 13.26 1.89 13 9.85 9.84 13 11.49 13.84 2.04 14 9.82 9.83 14 11.78 13.73 1.99 15 9.81 9.83 15 12.39 13.98 2.10 16 9.82 9.83 16 13.00 14.45 2.02 17 9.80 9.82 17 13.67 14.98 2.20 18 9.78 9.80 18 14.63 15.71 2.08 19 9.79 9.81 19 15.16 16.11 2.03 20 9.79 9.80 20 15.91 16.74 2.12 CV (%) 4.78 CV (%) 4.20 4.59 4.38 Days Treatment SEm± 0.76 2.16 2.24 SEm± 0.03 0.01 CD (P = 0.05) 1.49 4.23 4.39 CD (P=0.05) 0.06 0.02 Fig. 4. Change in optical density (OD600 ) of medium inoculated with SKL-1 during endosulfan degradation.
  8. 8. Endosulfan-degrading microorganism 669 Table 3. Correlation coefficients between transformation of en- dation of endosulfan by SKL-1 resulted in an increase dosulfan and OD600 , pH and aryl sulfatase activity in vitro. in the pH of the culture medium. Though this observa- tion is in conformity with the observations of Miles and At Ab Bt Bb St Sb Moy[13] and Martens,[12] it is contradictory to the observa- OD 0.061 0.332∗∗ 0.068 0.468∗∗ −0.041 −0.164 tions of Hussain et al.[19] and Siddique et al.[18] In either pH 0.205∗ 0.284∗∗ 0.201∗ 0.371∗∗ −0.355∗∗ 0.007 case the change in pH depends on the products of degra- ∗∗ As −0.140 0.310 −0.135 0.422∗∗ −0.131 −0.065 dation. The increase in pH in the present study due to biological activity of SKL-1 could have further acceler- At = Progressive rate of degradation of α endosulfan (total) (%). Ab = Progressive rate of degradation of α endosulfan (biological) (%). ated the alkaline hydrolysis of endosulfan, especially the β Bt = Progressive rate of degradation of β endosulfan (total) (%). isomer.[27] Bb = Progressive rate of degradation of β endosulfan (biological) (%). Interestingly, pH change exhibited highly significant neg- St = Progressive rate of formation of endosulfan sulfate (total) (%). ative correlation with total formation of endosulfan sulfate Sb = Progressive rate of formation of endosulfan sulfate (biological) (Table 3). This may be due to the fact that under alka- (%). OD = Optical density of growth (600nm). line conditions hydrolysis of endosulfan is predominantDownloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009 pH = pH of the broth. over its oxidation and hence formation of endosulfan sul- As = Aryl sulfatase activity of the broth (µg/mL/hr). fate, the product of oxidative degradation of endosulfan is ∗ Significant at 5% level. minimized. ∗∗ Significant at 1% level. The aryl sulfatase activity of the broth followed the pro- gressive rate of degradation of endosulfan closely (Fig. 6). and metabolic activities of the organism and its capability Aryl sulfatase activity exhibited highly significant positive to degrade endosulfan. correlation with biodegradation of α endosulfan and β en- The growth of SKL-1 quantified by OD600 followed the dosulfan (Table 3). Aryl sulfatase activity reached 23. 93 progressive rate of degradation of endosulfan (Fig. 4). The µg pNP/mL/hr as progressive rate of α and β endosulfan OD600 reached 2.34 as progressive rate of α and β endo- reached its peak. Further, aryl sulfatase activity did not ex- sulfan reached its peak. Growth of SKL-1 exhibited highly hibit any significant correlation with endosulfan sulfate for- significant positive correlation with biodegradation of α mation. Aryl sulfatase enzyme catalyzes the removal of sul- endosulfan and β endosulfan (Table 3) indicating that the fur moiety from organic sulfur compounds.[24] Katayama microorganism utilizes endosulfan for its growth. OD600 and Matsumura[20] studying biodegrdation of endosulfan had no significant correlation with formation of endosulfan by Trichoderma harzianum had suggested that endosulfan sulfate suggesting the limited role of the microbial isolate sulfate was further converted to endosulfan diol by hy- in the formation of endosulfan sulfate. drolysis in presence of sulfatase enzyme. However, since in Change in pH exhibited significant positive correlation our study endosulfan sulfate was not degraded further by with total degradation and biodegradation of both α and β SKL-1, aryl sulfatase enzyme may be involved in the direct endosulfan (Fig. 5 and Table 3). The growth and biodegra- hydrolysis of endosulfan to endosulfan diol. Fig. 5. Change in pH of medium inoculated with SKL-1 during endosulfan degradation.
  9. 9. 670 Kalyani et al.Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009 Fig. 6. Change in aryl sulfatase activity of medium inoculated with SKL-1 during endosulfan degradation. Phylogenetic identity of bacterial strain SKL-1 aeruginosa strains (Fig. 7). The sequence was submitted in Genbank and the accession number was allotted as The 16S rDNA gene of the microbial isolate was amplified EF443060. and sequenced. Homology search in the BLAST server Earlier reports of degradation of endosulfan involved developed by NCBI, USA revealed that the organism ex- mixed bacterial cultures, bacterial co-cultures, As- hibited 99% homology with many of the Pseudomonas pergillus niger, Phanerochaete chrysosporium, Mucor Fig. 7. Phylogenetic tree of Pseudomonas aeruginosa SKL-1.
  10. 10. Endosulfan-degrading microorganism 671 thermohyalospora, Anabaena spp. and Fusarium [2] Rao, D. M.R.; Murty, A. S. Persistence of endosulfan in soils. J. ventricosum.[8,10,14−18] Recently, Hussain et al.[19] reported Agric. Food Chem. 1980, 28, 1099–1101. [3] Guerin, T. F.; Kennedy, I. R. Distribution and dissipation of endo- that Pseudomonas spinosa, P. aeruginosa and Burkholderia sulfan and related cyclodienes in sterile aqueous systems: implica- cepacia degraded endosulfan efficiently. The bacteria tions for studies on biodegradation. J. Agric. Food Chem. 1992, 40, belonging to Pseudomonas sp. are gram negative soil 2315–2323. bacteria and have been previously documented as excellent [4] Sunderam, R.I.M.; Cheng, D.M.H.; Thompson, G.B. Toxicity of degraders of a wide range of xenobiotics and recalcitrant endosulfan to native and introduced fish in Australia. Environ. Tox- icol. Chem. 1992, 11, 1469–1476. compounds both in soil and water environment.[31,32] [5] Paul, V.; Balasubramaniam, E. Effect of single and repeated ad- ministration of endosulfan on behaviour and its interaction with Conclusion centrally acting drugs in experimental animals: A mini review. En- viron. Toxicol. Pharmacol. 1997, 3, 151–157. [6] Sinha, N.; Narayan, R.; Saxena, D.K. Effect of endosulfan on testis We have successfully enriched and isolated endosulfan de- of growing rats. Bull. Environ. Contam. Toxicol. 1997, 58, 79–86. grading bacterial strain Pseudomonas aeruginosa SKL-1 [7] Chaudhuri, K.; Selvaraj, S.; Pal, A.K. Studies on the genotoxicology that can utilize endosulfan as sole sulfur source in broth cul- of endosulfan in bacterial system. Mutat. Res. 1999, 439, 63–67.Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009 ture. After approximately 100 rounds of subculturing, the [8] Sutherland, T.D.; Horne, I.; Lacey, M.J.; Harcourt, R.L.; Russel, R.J.; Oakeshott, J.G. Enrichment of an endosulfan-degrading mixed culture metabolizes 100 ppm endosulfan to undetectable bacterial culture. Appl. Environ. Microbiol. 2000, 66, 2822–2828. levels in less than 30 days. This rate of degradation is signif- [9] Guerin, T.F. The anaerobic degradation of endosulfan by indige- icantly higher than those previously measured for bacteria, nous microorganisms from low-oxygen soils and sediments. Envi- considering the fact that non-biological degradation has ron. Pollut. 1999, 106, 13–21. been minimized. Further, it was also observed that there is [10] Awasthi, N.; Manickam, N.; Kumar, A. Biodegradation of endosul- fan by a bacterial coculture. Bull. Environ. Contam. Toxicol. 1997, a significant correlation between endosulfan degradation 59, 928–934. and aryl sulfatase activity suggesting the possible involve- [11] Knoevenagel, K.; Himmelreich, R. Degradation of compounds con- ment of this enzyme in the degradation of endosulfan by taining carbon atoms by photo-oxidation in the presence of water. this organism. Arch. Environ. Contam. Toxicol. 1976, 4, 324–333. The results have valuable applications for endosulfan [12] Martens, R. Degradation of endosulfan-8, 9-Carbon-14 in soil un- der different conditions. Bull. Environ. Contam. Toxicol. 1977, 17, bioremediation in polluted sites. From this study, we can- 438–446. not predict the efficiency of the microbial isolate to utilize [13] Miles, J. R.W.; Moy, P. Degradation of endosulfan and its metabo- endosulfan as a sulfur source in the soil environment. The lites by a mixed culture of soil microorganisms. Bull. Environ. Con- majority of the sulfur content of soils is found in an or- tam. Toxicol. 1979, 23, 13–19. ganic form, with over 95% present as sulfonates and sulfate [14] Mukherjee, I.; Gopal, M. Degradation of beta-endosulfan by As- pergillus niger. Toxicol. Environ. Chem. 1994, 46, 217–221. esters. Soil bacteria have numerous enzymes capable of re- [15] Kullman, S.W.; Matsumura, F. Metabolic pathways utilized by leasing sulfur from organic compounds. The ability of the Phanerochaete chrysosporium for degradation of the cyclodiene microbial isolate to degrade endosulfan in natural soil con- pesticide endosulfan. Appl. Environ. Microbiol. 1996, 62, 593– ditions, where other sulfur sources are also present needs to 600. be investigated. The use of microorganisms for bioremedia- [16] Shetty, P.K.; Mitra, J.; Murthy, N.B.K.; Namitha, K.K.; Savitha, K.N.; Raghu, K. Biodegradation of cyclodiene insecticide endosul- tion requires an understanding of all the physiological and fan by Mucor thermo-hyalospora MTCC 1384. Curr. Sci. 2000, 79, biochemical aspects involved in chemical transformations. 1381–1383. Future research will focus on identification and isolation [17] Lee, S.E.; Kim, J.S.; Kennedy, I.R.; Park, J.W.; Kwon, G.S.; Koh, of the enzymes involved, including a study of their regu- S.C.; Kim, J.E. Biotransformation of an organochlorine insecticide, lation and optimization of conditions. Modern molecular endosulfan, by Anabaena species. J. Agric. Food Chem. 2003, 51(5), 1336–40. approaches developed for remediation would be suitably [18] Siddique, T.; Okeke, B.C.; Arshad, M.; Frankenberger, W.T. Jr. En- applied to achieve these objectives. richment and isolation of endosulfan degrading microorganisms. J Environ Qual. 2003, 32, 47–54. [19] Hussain, S.; Arshad, M.; Saleem, M.; Khalid, A. Biodegradation of Acknowledgements α - and β -endosulfan by soil bacteria. Biodegradation 2007, 18(6), 731–740. The first author gratefully acknowledges the University [20] Katayama, A.; Matsumura, F. Degradation of organochlorine pes- Grants Commission for providing fellowship during the ticides particularly endosulfan by Trichoderma harzianum. Environ. Toxicol. Chem. 1993, 12, 1059–1065. tenure of the research work at the Indian Agricultural Re- [21] Shivaramaiah, H. M.; Kennedy, I. R. Biodegradation of endosulfan search Institute. by a soil bacterium. J. Environ. Sci. Health Part B. 2006, 41, 895– 905. [22] Kwon, G.S.; Kim, J.E.; Kim, T.K.; Sohn, H.Y.; Koh, S.C.; Shin, K.S.; References Kim, D.G. Klebsiella pneumoniae KE-1 degrades endosulfan with- out formation of the toxic metabolite, endosulfan sulfate. FEMS [1] United States Department of Health and Human Services. Toxi- Microbiol. Lett. 2002, 215, 255–259. cological Profile for Endosulfan; Agency for Toxic Substances and [23] Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Disease Registry: Atlanta, GA, 1990. local alignment search tool. J. Mol. Biol. 1990, 215, 403–410.
  11. 11. 672 Kalyani et al. [24] Tabatabhai, M.A.; Bremner, J.M. Aryl sulfatase activity of soils. tional evidence for the irreversible conversion of β- to α-endosulfan. Soil. Sci. Soc. Am. Proc. 1970, 34, 427–429. J Agric Food Chem. 2001, 49, 5372–5376. [25] Josey, D.P.; Beynon, J. L.; Johnston, A.W.B.; Beringer, J.E. Strain [30] Dorough, H.W.; Huhtanen, K.; Marshall, T.C.; Bryant, H.E. identification in Rhizobium using intrinsic antibiotic resistance. J. Fate of endosulfan in rats and toxicological considerations Appl. Microbiol. 2008, 46(2), 343–350. of apolar metabolites. Pest. Biochem. Physiol. 1978, 8, 241– [26] Van Woerden, H.F. Organic sulfites. Chem. Rev. 1963, 63, 557–571. 252. [27] Walse, S.S.; Scott, G.I.; Ferry, J.L. Stereo selective degradation of [31] Radehaus, P.M.; Schmidt, S.K. Characterization of a novel aqueous endosulfan in modular estuarine mesocosms. J. Environ. Pseudomonas sp. that mineralizes high concentrations of pen- Monit. 2003, 5, 373–379. tachlorophenol. Appl. Environ. Microbiol. 1992, 58, 2879– [28] Singh, N.C.; Dasgupta, T.P.; Roberts, E.V.; Mansingh, A. Dynamics 2885. of pesticides in tropical conditions. 1. Kinetic studies of volatiliza- [32] Filonov, A.E.; Puntus, I.F.; Karpov, A.V.; Kosheleva, I.A.; Akhme- tion, hydrolysis and photolysis of dieldrin and alpha and beta- tov, L.I.; Yonge, D.R.; Petersen, J.N.; Boronin, A.M. Assessment endosulfan. J. Agric. Food Chem. 1991, 39, 575–579. of naphthalene biodegradation efficiency of Pseudomonas and [29] Schmidt, W.F.; Bilboulian, S.; Rice, C.P.; Fettinger, J.C.; McConnell, Burkholderia strains tested in soil model systems. J. Chem. Tech- L.L.; Hapeman, C. J. Thermodynamic, spectroscopic and computa- nol. Biotechnol. 2006, 81, 216–224.Downloaded By: [Consortium for e-Resources in Agriculture] At: 12:13 16 September 2009

×