Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Drafting chemical patent specs and claims


Published on

Intellectual Property Management Training Cum Writeshop on Technology Disclosure and Claim Drafting, Philippine Council for Agriculture, Aquatic, and Natural Resources Research and Development (PCAARRD), Bulwagang Panday Karunungan, PCAARRD, Los Baños, Laguna (Philippines), 30 August 2012

Published in: Technology
  • Be the first to comment

Drafting chemical patent specs and claims

  1. 1. Patenting “chemical” inventionsAn appreciation topic to draft specificationsand claims in the Chemical FieldCaezar Angelito E. ArceoRegistered Patent Agent in the Philippines(Non-chemical field, 2006; Chemical field, 2007)Mentor, Patent Agent Qualifying Examinations 2011Intellectual Property Management Training Cum Writeshop on Technology Disclosure and Claim DraftingPhilippine Council for Agriculture, Aquatic, and Natural Resources Research and Development (PCAARRD)Bulwagang Panday Karunungan, PCAARRD, Los Baños, Laguna (Philippines)30 August 2012
  2. 2. Special notes(1) Grateful acknowledgment: Mr. Noel A. Catibog, PCAARRD Dr. Karl Rackette, EPO Dr. Patricio S. Faylon, PCAARRD Dr. Ray Coleiro, EPO Dr. Cecilia P. Reyes, NRCP The World Intellectual Property Office Ms. Renia C. Corocoto, NRCP The men and women of the Sapalo Velez Bundang & Mr. Jerry C. Serapion, PhilRice Bulilan Law Offices Engr. Rey Negre, IPOPHIL Atty. Anna Mariae Celeste V. Jumadla, former boss Ms. Rosa M. Fernandez, IPOPHIL Atty. Ronilo A. Beronio, former boss Ms. Virginia M. Aumentado, IPOPHIL Ms. Rudina Pescante, Patrick Miranda (Singapore)(2) This presentation was designed not to teach claim drafting, which requires at least one week training course, but to help interested participants to appreciate the art, which is necessary for effective chemical claim drafting.(3) Citing the source of slides in your public presentation/publication is humbly requested.(4) May this serve as an invitation to take the Patent Agent Qualifying Examinations (PAQE).(5) Enjoy!
  3. 3. Outline1.0 Patenting quick review 3 min2.0 Claims 10 min3.0 Scenario: My awesome eureka! 30 min4.0 The “chemical” claims 15 min5.0 End 1 min
  4. 4. 1.0 Patenting quick reviewOur questions:1.1 What is a patent?1.2 Why patent?1.3 What can be patented?1.4 What cannot be patented?1.5 What are the requirements of a patent?1.6 What are the parts of a patent document?
  5. 5. 1.1 What is a patent? “A Patent is a grant issued by thegovernment through the IntellectualProperty Office of the Philippines (IPPhilippines).” “It is an exclusive right granted for a product, process or an improvement of a product or process which is new, inventive and useful.” “A patent has a term of protection of twenty (20) years providing an inventor significant commercial gain.”Source: “A patent is a contract between the government and the inventor.” - Dr. Karl Rackette © 2012 by Caezar AE. Arceo Claim drafting crash course for the Sapalo Velez Bundang & Bulilan
  6. 6. 1.2 Why patent? “There is no reason anyone would want a computer in their home.” - Ken Olsen (1977) Founding Chair, Digital Equipment Corporation 1.3 What can be patented? Any technical solution of a problem in any field of human activity which is new, involves an inventive step and is industrially applicable shall be - Sec. 21, RA 8293 Patentable. It may be, or may relate to, a product, or process, or an improvement of any of the foregoing.
  7. 7. 1.4 What cannot be patented? EXCLUSIONS: An invention shall not be considered new if it forms part of a (1) Discoveries, scientific prior art. theories and mathematical methods; - Sec. 23, RA 8293 (2) Schemes, rules and methods - Rule 203, Patents IRR of performing mental acts, playing games or doing  Made available to the public business, and programs for anywhere in the world. computers;  Earlier applications. (3) Methods for treatment of the - Rule 204, Patents IRR human or animal body; (4) Plant varieties or animal breeds or essentially biological process for the Prohibited statements in the application: production of plants or (1) Contrary to “public order” or morality. animals. (2) Disparaging other products or (5) Aesthetic creations; and processes of any person other than the (6) Anything which is contrary to applicant. public order or morality. (3) Obviously irrelevant or unnecessary under the circumstances. - Sec. 22, RA 8293 - Rule 412, Patents IRR
  8. 8. 1.5 What are the requirements of a patent? Novelty 1 An invention shall not be Inventive step considered new if it forms part of a prior art. 2 An invention involves an - Sec. 23, RA 8293 inventive step if, having regard to prior art, it is not obvious to a person skilled in3 Industrial the art at the time of the filing date or priority date of the application claiming the applicability invention - Sec. 26, RA 8293An invention that can be produced andused in any industry shall be industriallyapplicable. © 2012 by Caezar AE. Arceo - Sec. 27, RA 8293 Claim drafting crash course for the Sapalo Velez Bundang & Bulilan
  9. 9. 1.6 What are the parts of a patent document? 4 Abstract 3 Claims 2 Specifications 1 Request for Grant of Patent (Application form) 5 Drawings © 2012 by Caezar AE. Arceo Claim drafting crash course for the Sapalo Velez Bundang & Bulilan
  10. 10. 1.6 What are the parts of a patent document? Title Abstract Authors and Affiliations Contact a Claims patent agent Abstract Specifications Introduction Review of Literature Methodology Request for Grant of Patent (Application Results and Discussion form) Summary, Conclusions, Recommendations Drawings Literature cited
  11. 11. 2.0 Patent claimsOur questions:2.1 What is a claim?2.2 Why claim?2.3 How to draft claims?
  12. 12. 2.1 What is a claim? “Patent claims are the part of a patent or patent application that defines the scope of protection granted by the patent. The claims define, in technical terms, the extent of the protection conferred by a patent, or the protection sought in a patent application.” - “...the extent of the protection conferred by a patent shall be determined by the claims...” Sec. 75, RA 8293 © 2012 by Caezar AE. Arceo Claim drafting crash course for the Sapalo Velez Bundang & Bulilan
  13. 13. 2.2 Why claim?
  14. 14. 2.2 Why claim?
  15. 15. 2.2 Why claim?
  16. 16. 2.2 Why claim?
  17. 17. 2.2 Why claim?(4) It is a MUST. “[T]he name of the game is the claim.” In re Hiniker Co., 150 F.3d 1362, 1369 (Fed.Cir.1998)
  18. 18. 2.3 How to draft claims?(1) Use the “Problem and solution approach” Step 1 Determine the closest prior art. Step 2 Evaluate the difference between the closest prior art and the claimed invention. Step 3 Formulate the technical problem. Step 4 Determine obviousness.
  19. 19. 2.3 How to draft claims?(2) Follow basic steps in claim drafting.Step 1 Evaluate the subject matter. Step 2 Identify basic elements of invention. Step 3 Prepare outline of subject Step 4 matter. Draft set of claims.Step 5 Prepare drawings/figures (whenever applicable). Step 6 Draft abstract of disclosure. Based on “Claim Drafting in the Field of Biotechnology” by Ms. Rosa M. Fernandez and Engr. Herminia T. Maniquiz, PCARRD presentation, 30-31 August 2007.
  20. 20. 2.3 How to draft claims?(3) Use appropriate claim drafting style.Philippine Patent No. 1-2004-000586:1. A seed treating machine for applying chemical treatment toseeds, comprising:(a) a seed delivery assembly, where seeds are contained and Preamble  Should contain a collected from source prior to a seed treating process; statement indicating(b) a cone assembly, where seeds from the said seed delivery assembly are allowed to pass through by gravity; and “the designation of(c) a spinning disk assembly, which distributes a chemical the subject matter of treatment to the seeds while being dropped from the said seed delivery assembly and through the said cone the invention” and assembly, said spinning disk assembly is rigidly fixed to the “technical the said seed delivery assembly; features of the priorcharacterized in that the said seed delivery assembly and thesaid cone assembly are detachably coupled to each other. art” (Rule 416)  Basically: Recites theThe “switch’. Characterizing portion prior art.Also can be used:  Should state the technicalwhereby features it is desired towherein protect (Rule 416)  In short: The invention. © 2012 by Caezar AE. Arceo Claim drafting crash course for the Sapalo Velez Bundang & Bulilan
  21. 21. 3.0 Scenario: My awesome eureka!!!Our simple question:3.1 Can you help me file a patent application?General instructions:(1) Group yourselves and grab your writing materials.(2) You may switch on your “specialist knowledge” for this exercise, provided, that you will accept my disclosures as true.(3) Listen to my disclosures and ask questions.(4) Prepare a matrix like this for presentation. Defend your position. Disclosure Patentable? Reason(s) If yes, list what to claim
  22. 22. Hello…I was wandering inside Makiling Forest andthis is what I found…
  23. 23. 3.1 Can you help me file a patent application?(1) Amazing morphology Leg! Leg! Leg! Leg! Two nuclei! Leg! Leg! Leg! Leg! 0.01 mm
  24. 24. 3.1 Can you help me file a patent application?(2) Amazing locomotion Unidirectional speed: Steering speed: 0.01 mm min-1 0.005 mm min-1 Note: I used a novel method of determining speed of this microorganism! 0.01 mm
  25. 25. 3.1 Can you help me file a patent application?(3) Amazing cell wall Pinch-proof!!! Novel compound: DNA CTGGTGAAGCCTTCACAGACCCTGTCCCTC CAGGTGCAGCTGCAGGAGTCGGGCCCAGGA Protein LVKPSQTLSLQVQLQESGPG
  26. 26. 3.1 Can you help me file a patent application?(4) Amazing chemical compounds produced TiO2Negrein, with unknown use Catibein, with anti- dengue properties ??? Unknown structure
  27. 27. 3.1 Can you help me file a patent application?(5) Amazing magical features If temperature drops to below 10 degrees Celsius, it turns to pink or red!!!
  28. 28. 3.1 Can you help me file a patent application?Sample answerDisclosure Patentable? Reason(s) If yes, list what to claim1. Morphology No Naturally occurring2. Locomotion Speed, Naturally occurring ability: No Tool: Yes Perhaps novel method Method of determining speed3. Cell Wall Features: No “Pinch proof” is a natural characteristic of a naturally occurring organism Compound: Perhaps novel Allegedly novel compound, Perhaps compound depending on the patent agent; Better: with industrial application4. Chemical Negrein: No No industrial compound application yet Catibein: Yes Medical use Catebein’s use; better if structure is already available5. “Magic” No No industrial application yet
  29. 29. 4.0 The “chemical” claimsOur questions:4.1 What are “chemical” inventions?4.2 How are “chemical” inventions protected?4.3 What can be claimed in “chemical” inventions?4.4 What cannot be claimed in “chemical” inventions?4.5 How to draft “chemical” claims?
  30. 30. 4.1 What are “chemical” inventions?(1) They are not mechanical inventions. ^_^  Relatively tough to claim.  Differences between chemical and non-chemical (mechanical) claims:Type/format Brief description Chemical Non-chemicalJepson claims Basic two-part claim type √ √Beauregard Generally used to circumvent √claims unpatentability of softwareMarkush claims Claims species/groups √Means-plus- Apparatus and its functional √function featuresProduct-by- Chemical product as a product of a √process processSwiss type Equivalent of “second medical use” √ format in the Philippines
  31. 31. 4.1 What are “chemical” inventions?(2) They encompass a broad range of inventions. Based on “Claim Drafting in the Field of Biotechnology” by Ms. Rosa M. Fernandez and Engr. Herminia T. Maniquiz, PCARRD presentation, 30-31 August 2007.
  32. 32. 4.2 How to protect “chemical” inventions?(1) File a patent application before publication.  Necessary if you intend to file through PCT, or in countries that require absolute novelty.  Applicable if you intend to upload your sequences or compound structures in public databases.  Practical re: “First to file rule”.(2) Test and claim within the group, class, or category.  Applicable for chemical compounds (re: Markush claim).  May be applicable for microoganisms with potential antimicrobial use (i.e., within the genus instead of species)(3) Deposit microorganisms.  Budapest Treaty.  Find a suitable (read: cost-effective) depositary institution.
  33. 33. 4.3 What can be claimed in “chemical” inventions?Three types of claims based on the subject matter1. Claims to a physical entity Entity Classes/sub-classes Examples Products Chemical compounds, Insecticide compositions, Has broader compositions proteins commercial Microorganisms Vectors for plant application transformation (conventional patent agent Apparatus Machine used to Gene gun view). manufacture the products2. Claims to an activity Entity Classes/sub-classes Examples Process Chemical production Biopesticide production Method of application of a “Ballistic” biopesticide chemical product Use First use Biopesticide Second use Biopesticide as foliar spray3. Combination of both.  “Product-by-process”
  34. 34. 4.4 What cannot be claimed in “chemical” inventions?(1) Method of treating human or animal bodies.  Methods of surgery or therapy and diagnostic methods.  Any treatment or diagnostic method that will be carried out on the living human or animal body.(2) Lacking “industrial applicability”.  Method of contraception vs. “purely cosmetic treatment of a human by administration of a chemical product” - p. 55, Ch IV, 4.3, Manual of Substantive Examination Practice
  35. 35. 4.4 What cannot be claimed in “chemical” inventions?(3) Anything that is contrary to morality or public order.  Example 1: Abortion pill vs. medical drug.  Example 2: Dynamite to kill people vs. blast mountains for mining purposes.  Example 3: Stem cell to create human parts vs. treat diseases.  Example 4: Sex enhancement drugs vs. medicine for sexual dysfunction.
  36. 36. 4.5 How to draft “chemical” claims?(1) Spot the invention! Shortcut: Identify the closest prior art. For a process invention, the closest prior art is usually a similar process. For a method of use invention, the closest prior art is usually a disclosure of a similar use of the same product, or the same use of a structurally similar product. For a product invention, the closest prior art is usually another product having the same intended use or purpose. This product will normally also have the greatest number of technical features in common with the invention. - p. 78, Annex 2 to Ch IV, 9, Manual of Substantive Examination Practice
  37. 37. 4.5 How to draft “chemical” claims?(2) Follow appropriate claim set format. Preamble Independent claim  Also known as (1) main claim; (2) mother claim.  The most important claim in the set. Characterizing portion Dependent claims  Include all the features of any other claim(s).  Contain a reference to the other claim. (i.e., “according to claim 1”, etc)
  38. 38. 4.5 How to draft “chemical” claims?(3) Follow appropriate claim style.Type/format Brief description Chemical Non-chemicalJepson claims Basic two-part claim type √ √Beauregard Generally used to circumvent √claims unpatentability of softwareMarkush claims Claims species/groups √Means-plus- Apparatus and its functional √function featuresProduct-by- Chemical product as a product of a √process processSwiss type Equivalent of “second medical use” √ format in the Philippines
  39. 39. 4.5 How to draft “chemical” claims?(3) Follow appropriate claim style.Type/format Brief description Chemical Non-chemicalJepson claims Basic two-part claim type √ √Beauregard Generally used to circumvent √claims About Jepson of software unpatentability claims:Markush claims Claims species/groups √ (1) Basic claim construction acceptable in the Philippines.Means-plus- (2) Rule 416(a) its functional Apparatus and and (b) on Patents define the two-part form √function features a claim should adopt “wherever appropriate.” whichProduct-by- Chemical product as a product of a √process Example: processSwiss type Equivalent of “second medical use” √ “1. A continuous on-line steam purity monitoring system for format in the Philippines geothermal power generation plants comprising the steps of xxx, whereby the sodium concentration in the steam is used as an indication of purity.” (Philippine Pat. No. 1-2007-000448)
  40. 40. 4.5 How to draft Markush claims: claims? About “chemical” (1) Usually used in chemical patents although also(3) Follow appropriate claim style. applicable in other fields. (2) A "Markush claim" can be considered as a shortened formulation of a claim. (Rule 605, Rules on Patents)Type/format (3) Markush grouping is allowable only if all alternatives Brief description Chemical Non-chemical have a common property or activity AND a commonJepson claims Basic two-part claim type √ √ structure is present. (Rule 605, Rules on Patents)Beauregard Generally used to circumvent √claims unpatentability of softwareMarkush claims Claims species/groups √Means-plus- Apparatus and its functional √function features Examples:Product-by- Chemical product as a product of a √process process “1. A composition comprising a copper compound and a dimerised thiourea derivative of FormulaSwiss type Equivalent of “second medical use” √ format in the Philippines wherein the two substituents R, which may... (Manual of Substantive Examination and Practice)
  41. 41. 4.5 How to draft “chemical” claims? About Product-by-Process claims:(3) Follow appropriate claiminstyle. inventions, as a chemical (1) Usually used medical product can be characterized as the product of a process. Acceptable if compound is new.Type/format Brief description #1: Only when a process used is (2) Application Chemical Non-chemicalJepson claims Basic two-part claim typethe case of microorganisms. repeatable, as in √ √ (3) Application #2: A recombinant vector, being a chemicalBeauregard Generally used to circumvent √ product, may be characterized by (i) its formula, (ii) asclaims unpatentability of software the product of a process, (iii) a combination ofMarkush claims √ Claims parameters, or (iv) composition of sub-parts. (p. 161, species/groupsMeans-plus- Ch. 7, Manual of Substantive Examination Practice) Apparatus and its functional √function featuresProduct-by- Chemical product as a product of a √process processSwiss type Equivalent of “second medical use” √Example: format in the Philippines“1. Product prepared by reacting the reaction product of A and B with substances X and Y.” (p. 137, Ch. 7, Manual of Substantive Examination Practice)
  42. 42. 4.5 How to draft Swiss-type claims:claims? About “chemical” (1) Equivalent of “second medical use” claim format in the(3) Follow appropriate claim style. Philippines. (2) Allowed even if the compound is already known and the medical use is also known, but a second medical use wasType/format Brief description before. not disclosed Chemical Non-chemical (3) Some acceptable formats:Jepson claims Basic two-part claim type √ √ (a) compound X for use as a medicamentBeauregard Generally (b) compound X for use as an analgesic used to circumvent √claims unpatentability of software for use in curing disease Y (c) compound X √ (d) medicament containing the compound XMarkush claims Claims species/groups (e) use of X for preparing a medicamentMeans-plus- Apparatus and its functional √function features Example:Product-by- Chemical product as a product of a √process process of an oculosurface selective glucocorticoid for the “1. UseSwiss type Equivalent ofof a topical ophthalmic composition for treating preparation “second medical use” √ format in dry eye conditions, xxx wherein the oculosurface chronic the Philippines selective glucocorticoid comprises rimexolone and wherein the composition contains rimexolone at a concentration of 0.001 to less than 0.1 w/v%.” (Phil. Pat. 1-2005-501206)
  43. 43. 5.0 Any questions?And...thank you! © 2012 by Caezar Angelito Estioko Arceo
