Kynsna and Monotropa Uniflora

259 views

Published on

Published in: Travel
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
259
On SlideShare
0
From Embeds
0
Number of Embeds
26
Actions
Shares
0
Downloads
3
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Kynsna and Monotropa Uniflora

  1. 1. Summer 2011<br />Cole Steber<br />Knysnaand Monotropauniflora<br />
  2. 2. Johannesburg, South Africa<br />
  3. 3. Knysna, South Africa<br />
  4. 4.
  5. 5. Knysna Volunteer House<br />
  6. 6. Two separate worlds<br />
  7. 7. The People<br />
  8. 8. Knysna Hospital<br />
  9. 9. The “Theatre”<br />
  10. 10. The Township<br />
  11. 11. Sinetemba<br />
  12. 12. Mad About Art<br />
  13. 13. Tackle Africa<br />
  14. 14. Fun Day<br />
  15. 15. Exploring Knysna<br />
  16. 16. Goodbye South Africa<br />
  17. 17. Summer Research Project with monotropauniflora<br />Microsatellite Primer Development<br />Sampling trip<br />Back in Danville…<br />
  18. 18. Microsatellite(n): sequence composed of tandem repeat units usually two to five nucleotides in length<br />(TC)12<br />CTAGGAGAGGTATATATGGGTCTTAAAATGTTTTAGATCATTATTTCAGATCTAAGTTCTCTCTCTCTCTCTCTCTCTCTCTCCACTTGAAGAACTCTAGACCTCTCTGTCCCTTCTCTTTTGATTTTGAGGTGGTTCCA<br />
  19. 19. Microsatellite as a Tool<br />Fine scale population analyses <br />Highly variable<br />DNA Polymerase stutters<br />Repeat units added or deleted<br />DNA repair mechanisms not 100% effective<br />http://studentreader.com/files/repeat_microsatellite.png<br />
  20. 20. Monotropauniflora(Indian Pipe)<br />Uniflora has large variation in color and in blooming periods<br />Variation is evident across sympatric and allopatric populations<br />
  21. 21. Characteristics<br />Heterotrophic<br />Grows 10-30 cm<br />Predominantly underground<br />Mycorrhizal Associates<br />Russula<br />Lactarius<br />
  22. 22. Plant and Fungus Relationship<br />90% of plants have some association with mycorrhizal fungi<br />Mutualism <br />
  23. 23. Explanation for Variation<br />Speciation<br />Temporal reproductive isolation<br />Cryptic speciation through mycorhizal fungal associate interactions<br />Null hypothesis: No genetic differentiation among blooming periods<br />
  24. 24. Final Progress<br />Future Research:<br /> Genotyping the populations of extracted DNA<br />Study associations of mycorrhizal associates<br />
  25. 25. Genetic Fingerprint<br />Combine 10 different loci to get one fingerprint per individual.<br />
  26. 26. Field Biology in New England<br />
  27. 27. To the Coast<br />
  28. 28. In Search of Beach Plum<br />
  29. 29. Pristine Landscape<br />
  30. 30. The G-Gnomes<br />
  31. 31. Long Island, New York<br />
  32. 32. A Perfect Sunset <br />
  33. 33. Jersey Shore<br />
  34. 34. Exploration of the Medical Field<br />Assisted career decision making <br />Exploration of Scientific Research<br />Learned how scientific process works<br />Gained an appreciation for conservation and nature<br />Summer Enrichment<br />
  35. 35. To the James Grahm Brown Foundation and all my mentors who assisted and made my summer experience possible<br />A Sincere Thank You<br />

×