Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

2013 - Identificación con técnica FISH de bacterias filamentosas en MBR

1,278 views

Published on

LLedias, M. (2013) Identificación con técnica FISH de bacterias filamentosas en un biorreactor de membranas de aguas residuales domésticas. Tesina final de Máster Ingeniería Ambiental. Universitat Politècnica de València.

www.aulabioindicacion.com

Published in: Science
  • Be the first to comment

2013 - Identificación con técnica FISH de bacterias filamentosas en MBR

  1. 1. IDENTIFICACIÓN CON TÉCNICA FISH DE BACTERIAS FILAMENTOSAS EN UN BIORREACTOR DE MEMBRANA DE AGUAS RESIDUALES DOMÉSTICAS TRABAJO FINAL DE MÁSTER EN INGENIERÍA AMBIENTAL Realizado por: Marta Lledías Aparici Dirigido por: Dr. José Luis Alonso Molina Dr. Gonzalo Cuesta Amat VALENCIA, SEPTIEMBRE 2013
  2. 2. AGRADECIMIENTOS En primer lugar quisiera agradecer especialmente a mis tutores José Luis Alonso y Gonzalo Cuesta su tutela, dedicación, inagotable paciencia y completa disponibilidad durante la duración de este trabajo. Gracias también al Instituto de Ingeniería del Agua y Medio Ambiente (IIAMA) por permitirme realizar con ellos este trabajo de investigación. Indiscutiblemente a Andrés Zornoza, infatigable investigador, por resolver mis dudas, crearme otras y por estar siempre dispuesto a ayudarme. A la EDAR Masía del Conde de Loriguilla, por facilitarnos los datos para la realización de este trabajo. A Inma, “Las Microbiólogas” y a todos los compañeros del laboratorio que han hecho que cada día de trabajo mereciera la pena. A Paulita, Vero, Alba y Clara por esos buenos ratos compartidos durante todo este tiempo. Y por supuesto a Chelo, Laura, Horacio, Verena, Javi y el pequeño Emilio, por estar siempre ahí. Gracias a todos.
  3. 3. 5 ÍNDICE 1 INTRODUCCIÓN...........................................................................................................................15 1.1 LAS AGUAS RESIDUALES, IMPORTANCIA DE SU TRATAMIENTO ..................................................................15 1.2 TRATAMIENTO SECUNDARIO. EL PROCESO BIOLÓGICO Y LOS FANGOS ACTIVOS............................................16 1.3 EL FLÓCULO ..................................................................................................................................16 1.4 LOS REACTORES BIOLÓGICOS DE MEMBRANA (MBR) ............................................................................17 1.5 COMPOSICIÓN DE LA MICROBIOTA.....................................................................................................18 1.6 LA IMPORTANCIA DE LAS BACTERIAS FILAMENTOSAS..............................................................................19 1.6.1 Phylum Chloroflexi................................................................................................................22 Morfotipo 0803 .............................................................................................................................................24 Morfotipo 0914 .............................................................................................................................................25 Morfotipo 0092 .............................................................................................................................................27 1.6.2 Phylum Proteobacterias/Alphaproteobacteria.....................................................................28 Morfotipo Nostocoida limícola......................................................................................................................28 1.7 IDENTIFICACIÓN DE MORFOTIPOS FILAMENTOSOS .................................................................................29 1.7.1 Microscopía convencional ....................................................................................................29 1.7.2 Técnica FISH para identificación de bacterias filamentosas.................................................30 1.8 PARÁMETROS OPERACIONALES DEL PROCESO DE DEPURACIÓN.................................................................33 2 OBJETIVOS...................................................................................................................................36 3 MATERIAL Y MÉTODOS................................................................................................................39 3.1 TOMA DE MUESTRAS ......................................................................................................................39 3.1.1 EDAR Masía del Conde, Loriguilla.........................................................................................39 3.2 MUESTREO...................................................................................................................................41 3.3 PARÁMETROS FÍSICO-QUÍMICOS Y VARIABLES OPERACIONALES ................................................................41 3.4 HIBRIDACIÓN IN SITU CON SONDAS MARCADAS CON FLUORÓFOROS (FISH) ...............................................42 3.4.1 Preparación de reactivos para FISH......................................................................................42 3.4.2 Tratamiento de los portaobjetos cubiertos de Teflón...........................................................45 3.4.3 Fijación y permeabilización de las muestras.........................................................................46 3.4.4 Aplicación de las muestras a los portaobjetos......................................................................48 3.5 SONDAS UTILIZADAS .......................................................................................................................48 3.6 HIBRIDACIÓN IN SITU ......................................................................................................................50 3.7 OBSERVACIÓN AL MICROSCOPIO .......................................................................................................51 3.8 IDENTIFICACIÓN Y CUANTIFICACIÓN DE MICROORGANISMOS FILAMENTOSOS ..............................................52 3.8.1 Técnica convencional............................................................................................................52 3.8.2 Técnica FISH..........................................................................................................................52
  4. 4. 6 3.9 ANÁLISIS ESTADÍSTICO.....................................................................................................................53 3.9.1 Tratamiento por ordenador..................................................................................................54 4 RESULTADOS ...............................................................................................................................58 4.1 CUANTIFICACIÓN E IDENTIFICACIÓN DE LOS MORFOTIPOS FILAMENTOSOS..................................................58 4.1.1 Microscopía Convencional....................................................................................................58 4.1.2 Método molecular FISH ........................................................................................................60 4.2 ESTADÍSTICA .................................................................................................................................64 5 DISCUSIÓN ..................................................................................................................................69 5.1 TÉCNICAS EMPLEADAS DE IDENTIFICACIÓN...........................................................................................69 5.2 ABUNDANCIA DE LOS MORFOTIPOS FILAMENTOSOS...............................................................................69 5.3 ESTADÍSTICA .................................................................................................................................72 6 CONCLUSIONES ...........................................................................................................................75 7 BIBLIOGRAFÍA..............................................................................................................................78 8 ANEXOS.......................................................................................................................................90 8.1 COMUNICACIÓN DE ACEPTACIÓN BIOMICROWORLD 2013:...................................................................91
  5. 5. 7 ÍNDICE DE FIGURAS Figura 1. Árbol filogenético del phylum Chloroflexi basado en las secuencias del gen 16S rRNA de los clones aislados (Yoon et al., 2010)..................................................24 Figura 2. Árbol filogenético del morfotipo filamentoso 0803 basado en el análisis comparativo de las secuencias del gen 16S rRNA (Kragelund et al., 2011)................25 Figura 3. Árbol filogenético del morfotipo 0914 basado en las secuencias del gen 16S rRNA (Speirs et al., 2010)...........................................................................................26 Figura 4. Árbol filogenético del morfotipo 0092 basado en las secuencias del gen 16S rRNA (Speirs et al., 2009)...........................................................................................27 Figura 5. Esquema simplificado del proceso de hibridación in situ con sondas marcadas con fluoróforos ...........................................................................................32 Figura 6. Diagrama del proceso..................................................................................40 Figura 7. Fijación de las muestras. .............................................................................47 Figura 8. Escala de valoración de la abundancia de bacterias filamentosas...............53 Figura 9. Abundancia de los morfotipos identificados por convencional......................60 Figura 10. Abundancia presentada por cada una de las sondas empleadas para la identificación mediante FISH ......................................................................................62 Figura 11.Ordenación del biplot basado en el ACC de la matriz Especies/Parámetros operacionales con un 28,35% de inercia. Dónde el Tipo 0092 (CFX223), C.”Monilibacter batavus” (MC2-649), Thiothrix (G123T), Tipo 0914 (CFX67a), Gammaproteobacterias (GAM42a). ............................................................................65 Figura 12.Ordenación del biplot basado en el ACC de la matriz Especies/Características del afluente con un 25,54% de inercia. Dónde el Tipo 0092 (CFX223), C.”Monilibacter batavus” (MC2-649), Thiothrix (G123T), Tipo 0914 (CFX67a), Gammaproteobacterias (GAM42a)............................................................66
  6. 6. 8 ÍNDICE DE TABLAS Tabla 1.Posibles identidades filogenéticas de los morfotipos filamentosos.................20 Tabla 2. Fechas de muestreo .....................................................................................41 Tabla 3. Parámetros fisicoquímicos ............................................................................41 Tabla 4. Parámetros operacionales ............................................................................42 Tabla 5. Sondas empleadas en la identificación de las bacterias filamentosas...........48 Tabla 6. Solución de hibridación según porcentaje de formamida...............................50 Tabla 7.Solución de lavado según porcentaje de formamida ......................................51 Tabla 8. Escala de valoración de organismos filamentosos ........................................53 Tabla 9. Morfotipos identificados por métodos convencionales...................................58 Tabla 10. Sondas empleadas y abundancias..............................................................60 Tabla 11. Resumen estadístico...................................................................................64 Tabla 12. Presiones Transmembrana MBR ................................................................90
  7. 7. 9 ABREVIATURAS Y ACRÓNIMOS TRHr : Tiempo de retención hidráulico en reactor CM : Carga másica Fex: Fangos en exceso SSLM: Sólidos Suspendidos del Licor Mezcla SSVLM: Sólidos Suspendidos Volátiles del Licor Mezcla %SSVLM: Porcentaje de Sólidos Suspendidos del Licor Mezcla pH: Ph en afluente DBO_afl: Demanda Biológica de Oxigeno en afluente DQO_afl: Demanda Química de Oxigeno en afluente NT_afl: Nitrógeno Total del afluente Cond_afl: Conductividad del afluente DQO_efl: Demanda Química de Oxigeno del efluente DBO_efl: Demanda Biológica de Oxigeno del efluente PT_efl:Fósforo Total del efluente CPT: Carga de Fósforo Total N_NH4_efl: Nitrógeno Amoniacal en efluente N_NO3_efl: Nitrato del efluente N_NO2_efl: Nitrito del efluente NT_efl: Nitrógeno Total del efluente CNT: Carga de Nitrógeno Total NKT_efl: Nitrógeno Kjeldahl Total en el efluente Turb_efl: Turbidez en el efluente Rdbo: Rendimiento Demanda Biológica de Oxigeno rDQO: Rendimiento Demanda Química de Oxigeno rPT: Rendimiento de Fósforo Total rNT: Rendimiento del Nitrógeno Total
  8. 8. 10 rNKT: Rendimiento de Nitrógeno Kjeldahl Total EDAR: Estación Depuradora de aguas Residuales MBR: Biorreactor de Membranas FISH: Hibridación in situ con sondas fluorescentes IF: Índice de abundancia de filamentos
  9. 9. 11 RESUMEN Estudios recientes sugieren que la concentración de bacterias filamentosas en los biorreactores de membrana (MBR) debe ser controlada por sus efectos negativos sobre el ensuciamiento de la membrana. Otros autores afirman que la elevada presencia de bacterias filamentosas no afecta la calidad del efluente o la permeabilidad de las membranas. La identificación de los filamentos basada en la identificación morfológica puede ser ambigua, por lo cual se hace necesario emplear métodos moleculares tales como la hibridación in situ (FISH) con sondas fluorescentes de oligonucleótidos dirigidos a diferentes especies filamentosas son necesarios para una identificación fiable. El objetivo del presente estudio fue determinar la abundancia de bacterias filamentosas en muestras de fangos precendentes de un MBR mediante FISH. En el análisis FISH se emplearon sondas marcadas de ácidos nucelicos del gen16 rRNA, cubriendo phylum, clase, género y especie. La abundancia de bacterias filamentosas en las 14 muestras de fango activo se midió de acuerdo con la escala subjetiva de Eikelboom, donde las observaciones se clasifican en una escala de 0 (ninguno) a 5 (crecimiento abundante). Muchos filamentos estaban presentes en el 100% de las muestras, lo que implica que el bulking sigue ocurriendo con frecuencia en las plantas con MBR que tratan aguas residuales urbanas. En 14 (100%) de las muestras, se observaron varias especies de filamentosas Chloroflexi (sonda GNSB941+CFX1223). Los miembros de Chloroflexi, son responsables de la degradación de los productos microbianos solubles (SMP) incluyendo carbohidratos y materiales celulares, lo que reduce la suciedad potencial de la membrana. Se observó que mostraron ser codominantes (IF>5) la población de Caldilinea (sonda caldi0678), el Tipo 0803 (sonda T0803-0654), el Tipo 0092 (sonda CFX197) y Candidatus “Monilibacter batavus”. El Tipo 0914 (sonda CFX67a) mostró que sus filamentos eran comunes (IF>3). El Tipo 0092 variante B (sonda CFX223) y Thiothrix (sonda G123T) se observaron en 10 de las muestras (FI<3). La abundancia del Tipo 0041/0675, Haliscomenobacter hydrossis (4 muestras con IF>2), y el Tipo 1851 (4 muestras con IF>5) se estimó por microscopía convencional. No se detectó señal de fluorescencia con las sondas TM7905 (Tipo 0041/0675), HHY (H. hydrossis), CHL1851 (Tipo 1851). El análisis canónico de correspondencia (ACC) se empleó para revelar las relaciones entre la aparición de bacterias filamentosas, parámetros operacionales y características del afluente. En el rango de estudio de la temperatura del reactor (Tr) (10-28ºC), un aumento en la temperatura derivó en una mayor abundancia de
  10. 10. 12 Thiothrix. Por el contrario, el Tipo 0092 y el Tipo 0914 mostraron una relación negativa con Tr. El biplot del ACC, mostró una relación positiva entre la abundancia de C. “M. batavus” y Thiothrix, la carga másica (CM) y los fangos en exceso (Fex). En el afluente el aumento en la disponibilidad de C y N contribuyó positivamente al cambio en la abundancia relativa de C.”M. batavus” y el Tipo 0092, mientras Thiothrix y Tipo 0914 lo hicieron negativamente .El Tipo 0914 se relacionó positivamente con el tiempo de retención hidráulico (TRH), al contrario que C. “M. batavus” y Thiothrix cuya relación con TRH fue negativa.
  11. 11. INTRODUCCIÓN
  12. 12. M. Lledías Máster en Ingeniería Ambiental 15 1 INTRODUCCIÓN 1.1 Las aguas residuales, importancia de su tratamiento El agua es un recurso finito y necesario para la vida, desde que el hombre ha ido tomando conciencia de ello ha puesto en práctica técnicas para hacer un uso más correcto del agua y preservar así la vida y el medio ambiente. Dado que para la evolución del hombre es necesario el uso de los recursos que nuestro planeta nos brinda, también es necesario evitar los daños colaterales que derivan del mismo, como puede ser la desaparición de especies vegetales y animales, la contaminación atmosférica o la contaminación de las aguas, tema que nos ocupa. El acceso al agua es un derecho y por tanto debe ser garantizado, sin duda, es nuestra responsabilidad el hacerlo de manera sostenible. Así, vista la facilidad con la que las actividades humanas contaminan el agua, se hizo imprescindible encontrar la manera de minimizar esta contaminación y tratar de “limpiar” esa agua. Según la Norma UNE-EN 1085, se entiende como agua residual aquella constituida por cualquier combinación de descargas de actividades domésticas, y de establecimientos industriales o comerciales, aguas de escorrentía superficial y de cualquier agua de infiltración de alcantarillados. Con objeto de proteger el medio ambiente y la salud humana se tratan las aguas residuales, para ello se emplean generalmente Estaciones Depuradoras de Aguas Residuales (EDAR) a las cuales llega el agua procedente de las ciudades (aguas urbanas) y de las industrias (aguas industriales), por medio del sistema de alcantarillado y de colectores; una vez en la EDAR el agua es sometida a procesos físico-químicos y biológicos con el objeto de que sus características al final del proceso sean lo más afines al medio que las va a recibir. Existe una legislación que regula qué características debe tener un agua tras haber pasado por la EDAR, quedando establecidos los parámetros de eliminación de contaminantes en forma de sólidos en suspensión, materia orgánica, microorganismos patógenos, compuestos inorgánicos, metales pesados y nutrientes. Es de vital importancia el llamado límite de vertido, que indica la cantidad máxima de determinados compuestos que debe contener esa agua para poder salir de la EDAR y considerar que esta depurada.
  13. 13. M. Lledías Máster en Ingeniería Ambiental 16 Generalmente las EDAR están compuestas por un tratamiento primario (eliminación de sólidos), secundario (biológicos) y terciario (desinfección) (Catalán, 1997) 1.2 Tratamiento secundario. El proceso biológico y los fangos activos El mecanismo más extendido para la eliminación de compuestos orgánicos en las aguas residuales y en la mayoría de las industriales es la biodegradación. En la depuración de aguas residuales existen diversos tratamientos biológicos, de los que destacamos los de cultivo en suspensión y dentro del mismo el tratamiento de fangos activos. En la actualidad se emplea con frecuencia este sistema de fangos activos, en el cual nutrientes y otros componentes son eliminados por la acción de microorganismos. Así los microorganismos emplean los contaminantes como fuente de carbono y/o como fuente de energía para su crecimiento, transformándolos en nueva biomasa, dióxido de carbono y otros compuestos inertes (Ferrer y Seco, 2007). En las EDAR se han desarrollado esquemas de proceso con otros objetivos además de la eliminación biológica de la materia orgánica, como son la nitrificación, la desnitrificación y la eliminación del fósforo. El proceso de fangos activos puede definirse como aquel tratamiento biológico de las aguas residuales en el que una mezcla de agua residual y de fangos activos es agitada y aireada, y posteriormente el fango activo se separa de las aguas residuales depuradas y se devuelve al proceso (UNE-EN 1085). 1.3 El flóculo Denominamos flóculo a la unidad estructural y funcional del fango activo compuesto por microorganismos (bacterias formadoras de flóculo y bacterias filamentosas), partículas orgánicas e inorgánicas del agua residual afluente y polímeros extracelulares. El flóculo puede considerarse el resultado de la combinación de las características biológicas y de las físicas. Ligado al flóculo se dan poblaciones de microorganismos como protozoos, rotíferos y nematodos que dan lugar a un equilibrio dinámico condicionado por la edad del fango, la composición del afluente, las variables operacionales o la presencia de tóxicos entre otros. En el proceso de depuración de aguas residuales la estructura y la actividad del flóculo son dos puntos imprescindibles para que sea adecuado.
  14. 14. M. Lledías Máster en Ingeniería Ambiental 17 En el flóculo se distinguen dos niveles estructurales: la microestructura y la macroestructura (Sezgin et al., 1978). La microestructura aparece debida los procesos de agregación y biofloculación, dando lugar a la formación de flóculos pequeños, esféricos, compactos y débiles. La macroestructura del flóculo está originada por las bacterias filamentosas, éstas forman unas estructuras a modo de esqueleto donde se fijan los flóculos, dando lugar a flóculos más fuertes, grandes y resistentes a la agitación. Es de vital importancia que la proporción de bacterias filamentosas del flóculo sea la adecuada, en caso contrario puede dar lugar a episodios de bulking o flóculo “punta de alfiler”. Cuando la cantidad de filamentosas es excesiva, éstas impiden el acercamiento de los flóculos, estando estos separados tanto la compactación como la sedimentación se dificultan. Si, por el contrario, la proporción de bacterias filamentosas es baja, los flóculos serán pequeños y débiles pudiendo aparecer en el efluente. 1.4 Los reactores biológicos de membrana (MBR) Un biorreactor de membrana (MBR) es un proceso de fangos activos donde la biomasa se separa del agua tratada mediante filtración de membrana, que sustituye a los clarificadores secundarios. Los procesos MBR son una mejora al proceso convencional de fangos activos. La introducción de una membrana como unidad de separación en estos últimos resuelve a priori el problema de la separación de la biomasa causado por las bacterias filamentosas ya que quedan retenidas en ella. Según Judd (2006) las ventajas adicionales son una menor producción de lodos que el proceso de fangos activos y que necesita una menor superficie de terreno para su construcción. Como resultado del largo tiempo de retención celular, los MBR requieren altas concentraciones de biomasa, esto significa que el sistema opera con carga másica baja para poder reducir la generación de biomasa (Judd, 2006). Por otro lado la alta concentración de biomasa dificulta la aireación (Krampe and Krauth., 2003). Son estas características las que favorecen el desarrollo de las bacterias filamentosas que siempre aparecen en altas concentraciones en los MBR, dando como resultado episodios de bulking filamentoso y formación de espumas. Estudios recientes sugieren que las concentraciones de bacterias filamentosas en MBR deben ser controladas por sus efectos negativos en el ensuciamiento de las membranas, bioensuciamiento (You and Sue., 2009; Meng et al., 2006), siendo este uno de los principales problemas y que provoca un aumento de los costos operativos derivados de la limpieza de las
  15. 15. M. Lledías Máster en Ingeniería Ambiental 18 membranas y del necesario reemplazo de éstas cuando dejan de ser operativas (Lyko et al., 2008; Khongnakorn et al., 2007). Con el aumento de la concentración de bacterias filamentosas, aumenta también la concentración en el fango activo de las sustancias poliméricas extracelulares (EPS) como resultado de la secreción bacteriana y de los productos microbiológicos solubles (SPM) (Zhang et al., 2010; Pan et al., 2010). Estudios recientes muestran, que la densidad de bacterias filamentosas no tienen un impacto significativo en el ensuciamiento de la membrana (Li et al., 2008) y que los sistemas MBR cuyo fango presenta bulking muestran un mejor rendimiento en la filtración y un ensuciamiento de membrana menor comparado con los MBR con fangos normales (Wang et al., 2010). 1.5 Composición de la microbiota La biomasa del fango activo está constituida por bacterias, protozoos, hongos, rotíferos, algas y nematodos. En el proceso de depuración de aguas los microorganismos juegan un papel fundamental. En el fango activo, los microorganismos más abundantes son las bacterias, que constituyen el 95% de la biomasa, participan principalmente en la eliminación de materia orgánica por distintas vías y en la eliminación de nutrientes. Sin las bacterias formadoras de flóculo y las bacterias filamentosas sería imposible la sedimentación y la obtención de un efluente clarificado y de calidad. Los protozoos son los siguientes en importancia, por su abundancia y su aportación al equilibrio de la biomasa de la que constituyen el 5%. Este grupo protista tiene como funciones principales la eliminación de patógenos y coliformes, el clarificado del efluente y la biofloculación. Los hongos no se consideran de importancia en el proceso de depuración ya que aún cuando las condiciones les permiten proliferar, rara vez compiten con las bacterias en la utilización de la materia orgánica disuelta. Las algas proporcionan oxígeno a las bacterias para que éstas puedan participar activamente en la eliminación de materia orgánica del agua residual en los sistemas de depuración (Ferrer y Seco, 2007). La proliferación excesiva de algas puede ocasionar graves problemas en las infraestructuras como atascos en las conducciones.
  16. 16. M. Lledías Máster en Ingeniería Ambiental 19 La cadena trófica de los sistemas de fangos activos está encabezada por los rotíferos y los nematodos, cuya función principal es depredar organismos inferiores. Los rotíferos eliminan bacterias dispersas y contribuyen a la formación del flóculo gracias a la secreción de mucus. Son indicadores de un buen funcionamiento del proceso de depuración. La presencia de elevadas cantidades de rotíferos y nematodos indica una edad del fango alta y por tanto cambios en la capacidad de depuración del fango activo. 1.6 La importancia de las bacterias filamentosas El papel de las bacterias filamentosas en algunos procesos de la EDAR aún no está muy definido, pero en cambio su papel físico en la formación del flóculo, su sedimentación y el foaming sin duda está bien documentado (Kragelund et al., 2007a, 2011; Miura et al., 2007). Las bacterias filamentosas están presentes en todos los tipos de EDAR con procesos de fangos activos, son responsables de la mayoría de problemas de bulking y foaming (Jenkins et al., 2004; Seviour and Nielsen, 2010). La excesiva abundancia de estas bacterias puede ser problemática para la operación de la planta y no existe una estrategia universal para limitar o prevenir este comportamiento problemático (Eikelboom, 2000; Jenkins et al., 2004; Kragelund et al., 2010). Se han identificado más de 30 morfotipos filamentosos en EDAR de aguas residuales urbanas (EIkelboom, 2000) y un número mayor ha sido detectado en plantas que reciben agua de origen industrial (Eikelboom y Geurkink, 2002; Eikelboom, 2006). Las bacterias filamentosas están involucradas en la degradación de la materia orgánica, son por tanto un miembro más de la comunidad biológica de los fangos activos y como tal deben considerarse. En la actualidad es sabido que tan solo algunos morfotipos filamentosos pueden ser identificados de forma fiable empleando manuales basados únicamente en su morfología y microscopía. Esta condición queda restringida a Candidatus ‘M.parvicella’, Thiothrix quizás algunas Mycolata y S. natans, pero poco más. Además un solo morfotipo filamentoso a menudo abarca varios organismos diferentes.(Seviour y Nielsen, 2010).
  17. 17. M. Lledías Máster en Ingeniería Ambiental 20 Las posibles identidades filogenéticas de los morfotipos filamentosos se recogen en la tabla1. Tabla 1.Posibles identidades filogenéticas de los morfotipos filamentosos Morfotipo Posible identidad filogenética Bibliografía Haliscomenobacter hydrossis Haliscomenobacter hydrossis (Bacteroidetes) Otras especies del phylum Bacteroidetes Especies dentro del phylum ‘Chloroflexi’ (Wagner et al., 1994a; Kindaichi et al., 2004; Okabe et al., 2005; Weller et al., 2000) (Bjornsson et al., 2002; Kragelund et al., 2007a) Microthrix parvicella Candidatus ‘Microthrix parvicella’ (Actinobacteria) Candidatus ‘Microthrix calida’ (Actinobacteria) (Erhart et al l., 1997) (Levantesi et al., 2006) Nostocoida limícola (morfotipos) Candidatus ‘Nostocoida limicola’ (Actinobacteria) Numerosas especies de Alphaproteobacteria, p.e. Meganema Perideroedes Especies dentro del phylum Firmicutes Especies dentro del phylum Planctomycetes Especies dentro del phylum Chloroflexi Especies de Thiothrix (Gammaproteobacteria) (Blackall et al., 2000) (Kragelund et al., 2005, 2006; Levantesi et al., 2004) (Liu et al., 2000) (Liu et al., 2001) (Schade et al., 2002) (Kragelund et al., 2006; Levantesi et al., 2004) Nocardioformes/Myc olata Especies de Gordonia y G. amarae (Actinobacteria) Especies de Skermania y S.piniformis (Actinobacteria) Especies desconocidas (Soddell, 1999) (Soddell and Seviour, 1998) (Kragelund et al., 2007a) Thiothrix Especies de Thiothrix (Gammaproteobacteria) Especies dentro del phylum ‘Chloroflexi’ sin crecimiento adherido (Kanagawa et al., 2000) (Kragelund et al., 2007a)
  18. 18. M. Lledías Máster en Ingeniería Ambiental 21 Tipo 0041/0675 Especies dentro del phylum ‘Chloroflexi’ Relacionadas con Curvibacter (Betaproteobacteria) Candidatas de la división TM7 (Kragelund et al., 2007a) (Thomsen et al., 2006b) (Hugenholtz et al., 2001; Thomsen et al., 2002) Tipo 0092 Especies dentro del phylum Bacteroidetes Haliscomenobacter hydrossis ‘Chloroflexi’ (Bradford et al., 1996) (Speirs et al., 2009) Tipo 021N Especies de Thiothrix (Gammaproteobacteria) Candidatus “Meganema Perideroedes” Alphaproteobacteria Especies dentro del phylum Firmicutes Especies dentro del phylum ‘Chloroflexi’ (Kanagawa et al.,2000) (Levantesi et al., 2004; Thomsen et al., 2006b) (Liu et al., 2000) (Blackall et al., 2000; Schade et al., 2002) Tipo 0803 Especies del phylum Betaproteobacteria Desconocidas (Bradford et al., 1996) Tipo 1701 Relacionadas con Curvibacter (Betaproteobacteria) Candidatas de la división TM7 (TM7) Desconocidas (Thomsen et al., 2006b; Thomsen et al., 2002) Tipo 1851 Kouleothrix aurantica (‘Chloroflexi’) Especies dentro del phylum Chloroflexi Relacionadas con Curvibacter (Betaproteobacteria) (Beer et al., 2002;Kohno et al., 2002; Kragelund et al., 2007a) (Bjornsson et al., 2002) (Thomsen et al., 2006b)
  19. 19. M. Lledías Máster en Ingeniería Ambiental 22 1.6.1 Phylum Chloroflexi Los organismos del phylum Chloroflexi, previamente conocidos como “bacterias verdes no sulfúreas” (Woese et al., 1987; Garrity & Holt et al., 2001) fueron asociados en un primer momento a hábitats extremos como ambientes hipersalinos (Nubel et al., 2001) donde aparecían como organismos anóxicos fototrofos (Hanada et al., 2002; Nubel et al., 2002). Posteriormente también se detectaron en los sedimentos superficiales del fondo marino (Huber et al., 2006) y en el suelo húmedo de la tundra alpina (Costello y Schmidt, 2006). Además se ha comprobado que estas bacterias filamentosas son muy abundantes tanto en EDAR de aguas residuales urbanas como de aguas residuales de origen industrial por lo que se pueden prever cantidades elevadas de estos filamentos en el proceso de depuración de fangos activos (Beer et al., 2002; Björnsson et al., 2002; Kragelund et al., 2007; Speirs et al., 2009). Los filamentos Chloroflexi pueden constituir hasta el 30% del biovolumen total en las plantas de eliminación de nutrientes (Beer et al., 2006; Kong et al., 2008; Morgan–Sagastume et al., 2008a; Nielsen et al., 2010c) y es a menudo el phylum de organismos filamentosos más abundante. Este phylum, juega un papel importante en la formación del flóculo (Kragelund et al., 2011) y en la aparición de episodios de bulking de forma ocasional (Jenkins et al., 2004; Kragelund et al., 2006). Dentro del phylum Chloroflexi se describieron cuatro clases bien diferenciadas: Anaerolineae, Dehalococcoidetes, Chloroflexi y Thermomicrobia (Hugenholz & Stackebrandt, 2004) siendo la más abundante en los fangos activos la clase Anaerolineae (Hugenholtz et al., 1998; Sekiguchi et al., 1999; Björnsson et al., 2002; Juretschko et al., 2002). Los filamentos bacterianos fototróficos termofílicos fueron incluidos en la clase Chloroflexi: Chloroflexus (Pierson and Castenholz, 1974), Oscillochloris (Gorlenko and Pivovarova, 1977) y Roseiflexus (Hanada et al., 2002). Dentro de la clase Dehalococcoidetes se aislaron bacterias anaerobias con actividad deshalogenasa en acuíferos contaminados por sustancias cloradas (Grostern & Edwards, 2006). Los filamentos termofílicos pertenecían a la clase Thermomicrobia (Oyaizu et al., 1987; Hensel et al., 1989). Recientemente se ha demostrado que la subdivisión Anaerolineae comprende dos clases, Anaerolineae y Caldilineae, que fueron aisladas de fango granular anaeróbico termofílico (Sekiguchi et al., 2003; Yamada et al., 2006).
  20. 20. M. Lledías Máster en Ingeniería Ambiental 23 Estudios realizados en EDAR de origen municipal basados en la técnica FISH para la cuantificación de bacterias filamentosas han demostrado que el 9-17% del total de los filamentos del phylum Chloroflexi pertenecen al género Caldilinea (Yoon et al., 2010). Estudios ecofisiológicos (Kindaichi et al., 2004; Okabe et al., 2005; Kragelund et al., 2007; Miura et al., 2007; Miura& Okabe et al., 2008) revelan que el phylum Choloflexi constituye un grupo de bacterias filamentosas especializadas nutricionalmente consumidoras de carbohidratos, como glucosa y N-acetilglucosamina, y aminoácidos. Algunos de los filamentos pueden consumir ácidos grasos de cadena corta como piruvato y butirato pero nunca acetato (Kragelund et al., 2006; Nielsen et al., 2009). Los filamentos del phylum Chloroflexi pueden ser considerados como bacterias especializadas capaces de degradar macromoléculas complejas como polisacáridos y proteínas (Nielsen et al., 2009). La incorporación de sustratos solubles por parte de las bacterias filamentosas del phylum Chloroflexi solo es observable bajo condiciones aerobias por lo que el metabolismo fermentativo observado en cultivos puros probablemente no juega un papel importante en los fangos activos (Nielsen et al., 2009). La superficie de los filamentos pertenecientes a este phylum parece ser más hidrofílica que la superficie de otras bacterias filamentosas del fango activo (Kragelund et al., 2006, Nielsen et al., 2009). Los filamentos suelen contener pequeños gránulos de polihidroxialcanoatos y se ha detectado actividad exoenzimática (Kragelund et al., 2007a). El phylum Choloflexi engloba muchos tipos de morfotipos Eikelboom como el tipo 0092, desclasificada del phylum Bacteriodetes y del género Flavobacterium, (Speirs et al., 2009), el tipo 1851 (Beer et al., 2002; Kragelund et al., 2007), probablemente también el tipo 0041 con crecimiento epifítico (Kragelund et al., 2007) y el morfotipo 0581 desclasificado del phylum Actinobacteria (Zornoza et al., 2006). El árbol filogenético del phylum Chloroflexi se muestra en la figura1.
  21. 21. M. Lledías Máster en Ingeniería Ambiental 24 Figura 1. Árbol filogenético del phylum Chloroflexi basado en las secuencias del gen 16S rRNA de los clones aislados (Yoon et al., 2010). Morfotipo 0803 El morfotipo Eikelboom 0803 ha sido asociado al género Caldilinea (Kragelund et al., 2011) dentro del phylum Chloroflexi y no en la subdivisión Rubrivivax de las betaproteobacterias como se había considerado previamente (Bradford et al., 1996). El tipo 0803 constituye alrededor del 20% del total de la población del phylum Chloroflexi y junto con el morfotipo 0092 constituyen la fracción dominante de dicho phylum (Kragelund et al., 2011). El morfotipo 0803 se localiza principalmente en la superficie de los flóculos, donde es posible observarlos asociados a granos de arena (Eikelboom, 2000;
  22. 22. M. Lledías Máster en Ingeniería Ambiental 25 Jenkins et al., 2004). En estudios posteriores se observó que no siempre se dan estas circunstancias, y no están asociados a granos de arena ni localizados en la superficie del flóculo (Kragelund et al., 2011). Los filamentos del morfotipo 0803 se caracterizan por ser cortos (<50 μm) y rectos con un diámetro de 0,8 – 1,1 μm y pueden aparecer asociados a partículas inorgánicas y formando rosetas. Son normalmente filamentos Gram negativos pero ocasionalmente la tinción Gram puede ser variable. Con la tinción Neisser los filamentos aparecen como negativos aunque ocasionalmente aparecen con gránulos positivos (Kragelund et al., 2011). Este morfotipo filamentoso consume glucosa con oxígeno, nitrito y nitrato como aceptores de electrones, por lo que podría ser desnitrificante. Además podría jugar un papel importante en la conversión de macromoléculas por la elevada expresión exonzimática observada (Kragelund et al., 2011). El árbol filogenético del morfotipo filamentoso 0803 basado en las secuencias del gen 16S rRNA se muestra en la figura 2. Figura 2. Árbol filogenético del morfotipo filamentoso 0803 basado en el análisis comparativo de las secuencias del gen 16S rRNA (Kragelund et al., 2011). Morfotipo 0914 El morfotipo filamentoso Eikelboom 0914 es identificado como un miembro del phylum Chloroflexi del subgrupo 1 (Speirs et al., 2010). El morfotipo es descrito como un filamento con un diámetro de 1-1,2 μm y una longitud inferior a 50 μm que se localiza
  23. 23. M. Lledías Máster en Ingeniería Ambiental 26 tanto dentro como fuera del flóculo. Son bacterias Gram negativas y responden de forma negativa a la tinción Neisser. No presenta vaina ni crecimiento epifítico (Jenkins et al., 2004). Los morfotipos filamentosos 0803 y 0914 se consideraban a nivel convencional dos formas de un mismo organismo (Eikelboom et al., 2000), cuando un morfotipo 0803 aparecía, el tipo 0914 desaparecía y viceversa, por lo que se creía que eran dos formas complementarias del mismo filamento bacteriano. Posteriormente el morfotipo 0803 y el morfotipo 0914 fueron considerados dos organismos diferentes siendo la clave identificativa la presencia de gránulos irregulares de azufre in situ en el morfotipo 0914 (Jenkins et al., 2004). El árbol filogenético basado en las secuencias genéticas del 16S rRNA del morfotipo 0914 y otros miembros del phylum Chloroflexi se muestra en la figura 3. Figura 3. Árbol filogenético del morfotipo 0914 basado en las secuencias del gen 16S rRNA (Speirs et al., 2010).
  24. 24. M. Lledías Máster en Ingeniería Ambiental 27 Morfotipo 0092 El morfotipo 0092 ha sido desclasificado del phylum Bacteriodetes (Wagner et al., 1994) para introducirlo dentro del phylum Chloroflexi (Speirs et al., 2009). Este morfotipo aparece en plantas de fangos activos de todo el mundo, ha sido asociado a edades de fango elevadas (> 15 días) y a sistemas de eliminación de fosfatos (EBPR) donde la biomasa es reciclada repetidamente entre la zona anaerobia y la zona aerobia (Jenkins et al., 2004). El morfotipo 0092 ha sido descrito en un amplio rango de condiciones, se ha comprobado la presencia de esta bacteria filamentosa en condiciones aerobias, anaerobias y anóxicas (Wanner et al., 1989). Son descritos como filamentos cortos que se extienden desde el flóculo con un diámetro entre 0,8 y 1 μm. Presentan respuesta negativa a la tinción Gram y positiva a la tinción Neisser (Jenkins et al., 2004). Se han identificado dos variantes (A y B) del morfotipo filamentoso 0092 diferenciándose en el diámetro del filamento (Speirs et al., 2009). El árbol filogenético basado en las secuencias genéticas del 16S rRNA del morfotipo 0092 y otros representantes del phylum Chloroflexi se muestra en la figura 4. Figura 4. Árbol filogenético del morfotipo 0092 basado en las secuencias del gen 16S rRNA (Speirs et al., 2009)
  25. 25. M. Lledías Máster en Ingeniería Ambiental 28 1.6.2 Phylum Proteobacterias/Alphaproteobacteria Las filamentosas alfaproteobacterias han sido observadas y descritas en numerosos estudios previos al año 2006, en los cuales estas bacterias han mostrado ser muy comunes en EDAR de aguas industriales y a menudo causantes de serios problemas de bulking (Dionisi et al., 2002; Eikelboom and Geurkink, 2002; Levantesi et al., 2004; Thomsen et al., 2006a; Van der Waarde et al., 2002), y basandose en la secuencia del gen 16S rRNA de seis muestras de bacterias no cultivadas y una especie aislada, se han descrito como constituyendo 7 grupos filogenéticos relativamente distantes: ‘Candidatus Combothrix italica’, ‘Candidatus Catenimonas italica’, ‘Candidatus Spheronema italicum’, ‘Candidatus Monilibacter batavus’, ‘Candidatus Alysiomicrobium bavaricum’ (Levantesi et al., 2004) y Meganema perideroedes (Thomsen et al., 2006a). Todas las especies tienen una morfología parecida al Tipo 021N, o a Nostocoida limícola, y pueden ser identificadas a nivel de especie con la aplicación de la técnica FISH. Respecto a la fisiología de las distintas especies no se tiene demasiado conocimiento, por ello no se han desarrollado aún estrategias de control para combatir este grupo de filamentosas (Kragelund et al., 2006) Kragelund et al (2006), dividieron las especies en dos grupos de fisiología similar según los datos del sustrato utilizado. El Grupo 1 compuesto por “Ca. Monilibacter batavus” y “Ca. Sphaeronema italicum”, que principalmente utilizan ácidos grasos de cadena corta. El Grupo 2 “Ca. Alysiomicrobium bavaricum”, “Ca. Alysiosphaera europaea” y Meganema perideroedes, es más versátil y capaz de utilizar carbohidratos, aminoácidos y etanol además de ácidos grasos de de cadena corta. Morfotipo Nostocoida limícola Existen tres grupos diferenciados de Nostocoida limícola, I, II y III, que difieren en su diámetro celular (Eikelboom and Van Buijsen, 1983). Tras una secuenciación del gen 16s rRNA de los tres grupos de Nostocoida limícola, cada grupo mostró pertenecer a un phylum bacteriano distinto (Blackall et al., 2000, Liu, J.R. et al., 2000, Liu, W.T. et al., 2000). La diversidad filogenética entre los miembros del morfotipo N. limícola II es la más extensa, conteniendo miembros de los phylum Actinobacterias (Blackall et al., 2000), Chloroflexi (Shade et al., 2002) y la clase Alfaaproteobacteria (Levantesi et al., 2004). El morfotipo N. limícola perteneciente a las alfaproteobacterias, que previamente se mostró predominante en plantas industriales (Kragelund et al., 2006, Kragelund et al., 2005, Levantesi et al., 2004, Snaidr et al., 2002, Thomsen et al.,
  26. 26. M. Lledías Máster en Ingeniería Ambiental 29 2006a) y poco común en las EDAR de aguas domésticas (Seviour et al., 2002) contiene 6 clusters filogenéticos alejados relacionados. Incluyendo cinco especies no cultivadas Candidatus ‘Combothrix italica’, Candidatus ‘Alysiophaera europaea’, Candidatus. ‘Monilibacter batavus’ y Candidatus ‘Sphaeronema italicum’ (Levantesi et al., 2004). Se describe con formas desde esférica a ovoide y discoidal, con un tamaño entre 1,0-1,4 μm., sus septos son generalmente visibles. Se localizan extendiéndose desde el flóculo al licor mezcla. Responde a la tinción de Gram de forma variable, también es variable su reacción a la tinción de Neisser pero tiñe todo el filamento. 1.7 Identificación de morfotipos filamentosos 1.7.1 Microscopía convencional Los métodos clásicos tienen su base en la observación de la apariencia microscópica de los microorganismos para determinar las características morfológicas, así como el uso de tinciones que ponen de manifiesto algunas de las características identificativas de los microorganismos. La nomenclatura basada en la observación microscópica de las características morfológicas, la estableció Eikelboom (1975) y otros autores (Jenkins et al., 2004) la actualizaron posteriormente. La clasificación de Eikelboom (1975) y de Jenkins et al.,2004, se basa en los siguientes caracteres morfológicos: presencia o ausencia de ramificaciones, movilidad, forma del filamento (irregular, curvo, enrollado, etc.), color, ubicación respecto al flóculo, existencia de crecimiento epifítico, vaina, septos, constricciones celulares, dimensiones celulares, dimensiones del filamento, forma celular ( cuadrada, rectangular, ovalada, etc.), presencia de biopolímeros de azufre y gránulos de polifosfato, reacciones de tinción (Gram y Neisser) y formación de rosetas y gonidios. Los métodos convencionales son de gran ayuda para la observación de microorganismos en EDAR de aguas residuales, sin embargo la información que aportan sobre la identidad exacta de los filamentos observados no es fiable, razón por la cual se designa a los filamento bajo los términos “tipo” o “morfotipo” en vez de especie. Actualmente se sabe que un morfotipo específico puede incluir varias especies y que varios morfotipos puedan representar una sola especie.
  27. 27. M. Lledías Máster en Ingeniería Ambiental 30 El uso de técnicas convencionales para la identificación y cuantificación conlleva algunas dificultades:  Una misma especie puede mostrar polimorfismos o diferentes especies parecer iguales.  Aquellos filamentos ubicados en el interior del flóculo son difíciles de identificar y cuantificar.  Estructura abierta de los flóculos.  Elevada población de filamentos.  Esta metodología es subjetiva y depende del nivel de entrenamiento y experiencia del que la lleva a término. Los métodos clásicos son un complemento de las técnicas moleculares, proporcionando a éstas datos de interés sobre las características del flóculo y la presencia de protozoos y otros microorganismos asociados. A pesar de considerar la microscopía convencional como una herramienta imprescindible en el control del proceso de depuración, a nivel microbiológico tan sólo un número reducido de bacterias filamentosas han podido ser identificadas según sus características morfológicas, así en la actualidad la identificación de las bacterias del fango activo no se puede limitar únicamente al método convencional (Nielsen et al., 2009). 1.7.2 Técnica FISH para identificación de bacterias filamentosas Para la identificación y cuantificación de microorganismos filamentosos, se emplean los métodos moleculares (Blackall, 1994; Bradford et al., 1996; Erhart et al., 1997; Kanagawa et al., 2000; Wagner et al., 1994), en concreto la técnica FISH ha sido especialmente productiva para conseguir dicho objetivo (Nielsen et al., 2009) La mayoría de los morfotipos filamentosos de Eikelboom reciben una identificación alfanumérica, es decir no han sido nombrados siguiendo las reglas del Código Internacional de Nomenclatura, se debe principalmente a que muchos de ellos muestran una morfología celular diferente a la que presentan en los fangos activos. El empleo de técnicas moleculares de caracterización y secuenciación del gen 16S rDNA
  28. 28. M. Lledías Máster en Ingeniería Ambiental 31 que empieza a distinguir la posición taxonómica de los morfotipos de bacterias filamentosas, está cambiando esta situación. La hibridación in situ con sondas u oligonucleótidos 16S rDNA/23S rDNA marcadas con fluoróforos (FISH) ha sido una técnica común para la detección e identificación de microorganismos en diferentes ambientes microbianos, en los que se incluyen comunidades de bacterias como las presentes en los sistemas biológicos de depuración con fangos activos (Amann et al., 1995). Esta técnica basada en la hibridación directa de la bacteria diana con una sonda complementaria de una región del gen 16S o 23S rRNA. El elevado número de moléculas de rRNA (103 -105 ) es una ventaja en la aplicación de la técnica de hibridación al aumentar su sensibilidad (Amann, 1994). Una secuencia de DNA (sonda) puede unirse con una secuencia de RNA complementaria (16S rRNA o 23S rRNA) y se produce un híbrido DNA: RNA. La sonda está marcada con una molécula fluorescente de tal forma que los híbridos formados se pueden detectar fácilmente con un microscopio de epifluorescencia. La especificidad de las sondas puede ser ajustada a diferentes niveles taxonómicos como son dominio, phylum, clase, familia, género o especie para la identificación de las bacterias presentes en el fango activo. Las sondas deben ser lo suficientemente específicas para unirse únicamente a la bacteria que se quiere identificar. Para asegurar la especificidad, los dos parámetros determinantes son la temperatura y la concentración de formamida en el tampón de hibridación (Alonso et al., 2009). La formamida hace que disminuya la temperatura de unión de las sondas mediante el debilitamiento de los puentes de hidrógeno, es decir, disminuye la temperatura de fusión de los híbridos DNA: RNA en 0,72ºC por cada 1% de formamida utilizada y permite realizar la hibridación a 46ºC (Alonso et al., 2009). La sonda que se utiliza en la técnica FISH está formada por una pequeña secuencia de nucleótidos de cadena sencilla, en cuyo extremo, normalmente 5’, se marca un fluoróforo, como puede ser rodamina o fluoresceína. Un esquema simplificado del proceso de hibridación in situ con sondas marcadas con fluoroforos se puede ver en la figura 5
  29. 29. M. Lledías Máster en Ingeniería Ambiental 32 Figura 5. Esquema simplificado del proceso de hibridación in situ con sondas marcadas con fluoróforos El empleo de la técnica de hibridación con sondas marcadas con fluoróforos in situ (FISH), presenta una serie de ventajas frente a otras técnicas de detección e identificación, son:  Permite detectar varias especies o géneros en una misma muestra, utilizando una sonda para cada especie, género o grupo, marcada con fluoróforos distintos.  No parecen existir sustancias inhibidoras que interfieran en la reacción de hibridación.  Puede determinar directamente la abundancia de los microorganismos detectados.  No necesita cultivo previo de la bacteria ni extracción de los ácidos nucleicos (Nielsen et al., 2009).  Las preparaciones pueden conservarse durante mucho tiempo (años).  Se mantiene la morfología de la célula (Nielsen et al., 2009). A pesar de todas las ventajas citadas de la técnica molecular FISH, se aprecian en ella algunas limitaciones:  La identificación a través de FISH está supeditada a la disponibilidad de la sonda requerida.  Se han desarrollado sondas para varias especies filamentosas importantes, pero aún no para todas las especies que puedan aparecer en el fango activo.
  30. 30. M. Lledías Máster en Ingeniería Ambiental 33  Podría afectar a las características morfológicas de las especies filamentosas.  Las bacterias filamentosas con bajo contenido ribosomal no dan una señal fluorescente clara con la sonda.  Puede ocurrir que una sonda específica para una especie de una señal fluorescente con otras especies, si sus composiciones de rRNA son muy parecidas. Tales resultados positivos falsos pueden ser prevenidos mediante la aplicación de sondas competidoras.  No aporta información sobre características importantes del fango, tales como la población de protozoos o las características del flóculo. 1.8 Parámetros operacionales del proceso de depuración Los parámetros más utilizados para el control de las depuradoras de aguas residuales son la carga másica (CM) y la edad del fango (EF) (Zornoza et al., 2011). La carga másica es un parámetro que trata de representar la relación existente entre la carga orgánica alimentada al reactor y los microorganismos presentes en él. Dada la dificultad de cuantificar los microorganismos presentes, suele definirse como la relación entre la DBO5 y los sólidos suspendidos volátiles del licor mezcla diarios en el reactor, o incluso puede definirse relacionando dicha DBO con los sólidos suspendidos totales del licor mezcla, por ello es muy importante al hablar de carga másica establecer a qué concentración de sólidos está referida (Ferrer y Seco, 2007). La edad del fango relaciona la masa de fango en el reactor con la masa de fangos eliminada diariamente, por lo que depende principalmente del régimen de purgas (Zornoza et al., 2011). Para la determinación de ambos parámetros es necesario tener en cuenta la inercia del sistema de fangos activos, es decir, la inercia de las poblaciones microbianas y la estructura flocular (Zornoza et al., 2011). Ambos parámetros han estado relacionados de forma proporcional e inversa, pero recientemente se ha demostrado que esta relación no siempre tiene lugar EDAR a escala real (Zornoza et al., 2011).
  31. 31. OBJETIVOS
  32. 32. M. Lledías Máster en Ingeniería Ambiental 36 2 OBJETIVOS El control efectivo de muchos de los problemas que aparecen en el proceso de depuración se basa en la identificación de los microorganismos que lo causan y en la modificación de las condiciones que favorecen su crecimiento. El crecimiento excesivo de bacterias filamentosas puede interferir en el funcionamiento correcto del sistema de fangos activos produciendo problemas como la sedimentación deficiente del fango o la formación de espumas. El principal objetivo de este trabajo es la identificación y cuantificación de los morfotipos de bacterias filamentosas presentes en la EDAR de Loriguilla (Valencia), cuyo sistema de depuración se basa en el uso de biorreactores de membrana (MBR). Se plantean los siguientes objetivos:  Aplicar los métodos de microscopía convencional para la identificación de morfotipos de bacterias filamentosas presentes en muestras procedentes de una depuradora con sistema MBR de la Comunidad Valenciana (Loriguilla), como paso previo a la aplicación de la técnica FISH facilitando la elección de las sondas más adecuadas.  Aplicar la técnica FISH a las muestras para determinar la presencia de bacterias filamentosas e identificarlas.  Determinar la abundancia de las bacterias filamentosas detectadas por FISH mediante la aplicación de la escala subjetiva de Eikelboom  Estudiar las posibles relaciones existentes entre los parámetros operacionales y físico-químicos de la EDAR y la abundancia de las bacterias filamentosas identificadas.
  33. 33. MATERIAL Y MÉTODOS
  34. 34. M. Lledías Máster en Ingeniería Ambiental 39 3 MATERIAL Y MÉTODOS 3.1 Toma de muestras Se tomaron muestras del licor mezcla de la EDAR de Loriguilla (Valencia) con una frecuencia quincenal durante un año. A continuación se muestra el esquema de funcionamiento y algunos datos de interés. 3.1.1 EDAR Masía del Conde, Loriguilla La EDAR de la Masía del Conde está situada en Loriguilla, municipio de la comarca del Camp de Turia de Valencia. Actualmente da servicio únicamente al municipio de Loriguilla. Las obras de ampliación de esta ·EDAR finalizaron en el año 2008, está diseñada para tratar un caudal medio de 1.000 m3/día y un caudal punta de 100 m3/h. La tipología de las aguas tratadas es urbana, aunque también da servicio a los desarrollos industriales del municipio. El sistema consiste en (Figura 6) un tratamiento biológico mediante aireación prolongada con fangos activados, en el que se produce una nitrificación-desnitrificación, y un sistema de clarificación con membranas de microfiltración (MBR), gracias al cual se consigue alcanzar los niveles de depuración que permiten la reutilización de las aguas para riego de parques y jardines; esperando un efluente con DBO5<10 mg/l; SS<5mg/l y turbidez< 2 NTU. Para el tratamiento de los fangos se dispone de un sistema de espesamiento y otro de deshidratación mediante centrífuga. Se cuenta también con un sistema de desodorización para la línea de fangos. Ficha técnica: LINEA DE AGUA PRETRATAMIENTO TRATAMIENTO SECUNDARIO TRATAMIENTO TERCIARIO DESINFECCIÓN Tamizado Aireación prolongada Ultrafiltración Ultravioletas Desarenador Eliminación de nitrógeno Desengrasador Eliminación de fósforo LÍNEA DE FANGO ESPESADOR DESHIDRATACIÓN Gravedad Centrífuga
  35. 35. M. Lledías Máster en Ingeniería Ambiental 40 Figura 6. Diagrama del proceso Sus características son: Caudal Nominal Medio (de proyecto): 1000 m3 /día Caudal diario: 300 m3 Población servida: 2.041 he Caudal Punto horario: 100 m3 /h Sistema de Pre-tratamiento Compacto Tanque Anóxico en HA 215 m3 Reactor Biológico en HA 460 m3 Reactor Biológico de Membranas, MBR Espesamiento de fangos en HA 75 m3 Deshidratación de fangos, centrífuga Desinfección UV y conexión sistema de riego Potencia total instalada 189 (kW) Coordenadas UTM (ETRS 89 huso 30) X: 709875 Y:4373567 Z:96
  36. 36. M. Lledías Máster en Ingeniería Ambiental 41 3.2 Muestreo El muestreo se realizó siempre en el mismo lugar a la salida del reactor biológico. Se tomaron 1500ml de licor mezcla con un recipiente de plástico, de estas muestras se tomaron alícuotas para su fijación que se realizó antes de las 24 horas. Los muestreos se realizaron cada quince días durante el año 2012. El muestreo comenzó en febrero y finalizó en noviembre de 2012 (tabla 2). Las muestras fueron de carácter simple realizadas de forma puntual. Para el transporte y conservación de las muestras fue necesario mantener las condiciones aerobias de la muestra, lo cual se logró con la cámara de aire que queda sobre el licor mezcla Tabla 2. Fechas de muestreo FECHA Nº MUESTRA 07/02/2012 M1 14/02/2012 M2 28/02/2012 M3 13/03/2012 M4 02/04/2012 M5 26/04/2012 M6 08/05/2012 M7 22/05/2012 M8 05/06/2012 M9 28/06/2012 M10 10/07/2012 M11 26/09/2012 M12 03/10/2012 M13 20/11/2012 M14 3.3 Parámetros físico-químicos y variables operacionales Los parámetros físico-químicos se determinaron siguiendo los procedimientos normalizados (APHA, 2005). Los parámetros fisicoquímicos medidos en cada una de las muestras, se recogen en la tabla X Tabla 3. Parámetros fisicoquímicos Parámetros Unidades Abreviatura LICOR MEZCLA Sólidos Suspendidos del Licor Mezcla mg l-1 SSLM Sólidos Suspendidos Volátiles del Licor Mezcla mg l-1 SSVLM Porcentaje de Sólidos Suspendidos del Licor Mezcla % %SSVLM
  37. 37. M. Lledías Máster en Ingeniería Ambiental 42 AFLUENTE pH en afluente Ud. pH Demanda Biológica de Oxigeno en afluente mg l-1 DBO_afl Demanda Química de Oxigeno en afluente mg l-1 DQO_afl Nitrógeno Total del afluente mg l-1 NT_afl Conductividad del afluente µS/cm Cond_afl EFLUENTE Demanda Química de Oxigeno del efluente mg l-1 DQO_efl Demanda Biológica de Oxigeno del efluente mg l-1 DBO_efl Fósforo Total del efluente mg P l-1 PT_efl Carga de Fósforo Total g PT / Kg SSVLM. d CPT Nitrógeno Amoniacal en efluente mg N l-1 N_NH4_efl Nitrato del efluente mg N l-1 N_NO3_efl Nitrito del efluente mg N l-1 N_NO2_efl Nitrógeno Total del efluente mg l-1 NT_efl Carga de Nitrógeno Total g NT / Kg SSVLM. d CNT Nitrógeno Kjeldahl Total en el efluente mg l-1 NKT_efl Turbidez en el efluente ntu Turb_efl RENDIMIENTOS Rendimiento Demanda Biológica de Oxigeno % rDBO Rendimiento Demanda Química de Oxigeno % rDQO_ Rendimiento de Fósforo Total % rPT Rendimiento del Nitrógeno Total % rNT Rendimiento de Nitrógeno Kjeldahl Total % rNKT Las variables operacionales determinadas durante la campaña de muestreo se recogen en la tabla 4. Tabla 4. Parámetros operacionales Parámetros Unidades Abreviatura Tiempo de retención hidráulico en el reactor Horas (h) TRHr Carga másica kgDBO5/kgSSVLM.d CM Fangos en exceso Kg.d Fex Temperatura del reactor °C Tr 3.4 Hibridación in situ con sondas marcadas con fluoróforos (FISH) 3.4.1 Preparación de reactivos para FISH A continuación se describe el protocolo de preparación de los reactivos necesarios en los procesos de fijación, lavado e hibridación.
  38. 38. M. Lledías Máster en Ingeniería Ambiental 43  Paraformaldehido (para fijación) Calentar 65 ml de agua bidestilada hasta 60ºC. Añadir 4 g de paraformaldehido (PFA). Añadir 1 gota de una solución de NaOH 2M y agitar rápidamente hasta que la solución se haya clarificado. Quitar de la fuente de calor y añadir 33 ml de PBS 3X. Ajustar el pH a 7,2 con HCl. Eliminar cualquier resto de cristales por filtración a través de 0,2 µm. Enfriar rápidamente a 4ºC y conservar a esta temperatura.  Tampón fosfato salino (para fijación) ─ Concentración PBS 1X NaCl.............…..…..7,60 g NaH2PO4∙H2O....... 1,38 g NaH2PO4∙H2O....... 1,78 g Agua destilada.......1000 mL pH 7,2 ─ Concentración PBS 3X NaCl.................... 22,8 g NaH2PO4∙H2O.... 4,1 g Na2HPO4∙H2O..... 5,3 g Agua destilada .... 1000 ml PH 7,2 Preparación: Primero disolver los fosfatos y luego el cloruro sódico. Esterilizar por filtración 0,45 µm ó 0,2 µm y conservar a 4ºC.
  39. 39. M. Lledías Máster en Ingeniería Ambiental 44  Solución de gelatina (para preparación de portaobjetos) Gelatina.................................... 0,1% Sulfato potásico cromato ........ 0,01% (Sigma ref. C-5926, 12H20) Calentar previamente el agua destilada hasta 60ºC. Fundir la gelatina (100 mg 0,1% + 10 mg sal de cromato 0,01%) en 100 ml de agua destilada. Enfriar a 50ºC para sumergir los portaobjetos.  Solución de limpieza de portaobjetos FISH (para preparación de portaobjetos) Etanol con 10% KOH  Etanol (para deshidratación) 50% 80% 100%  Cloruro sódico 5M (para tampón de hibridación y tampón de lavado) Cloruro sódico.......... 292.2 g Agua destilada.......... 1000 ml Disolver el NaCl en 800 ml de agua destilada y ajustar el volumen hasta 1 litro. Distribuir en alícuotas. Esterilizar en autoclave 121ºC durante 15 minutos y por filtración.  EDTA 0,5M (cuando la concentración de formamida es mayor o igual a 20%) EDTA 2H2O.....................186,1 g Agua destilada................ hasta 1000 mL
  40. 40. M. Lledías Máster en Ingeniería Ambiental 45 Preparación: pesar el EDTA y añadir a 800 mL de agua destilada. Ajustar el pH a 8,0 con NaOH (el reactivo no se disuelve hasta ajustar el pH a 8,0). Completar hasta 1000 mL con agua destilada. Esterilizar en autoclave 121ºC durante 15 minutos y por filtración.  Tris-HCl pH 8.0 (tampón de hibridación y tampón de lavado) Tris Base ........................ 121,1 g H-Cl.................................. 42 ml de HCl concentrado Agua destilada................ hasta 1000 ml Preparación: pesar el Tris y añadir a 800 ml de agua destilada. Añadir 42 ml de HCl concentrado y completar hasta 1000 ml con agua destilada. Esterilizar en autoclave 121ºC durante 15 minutos y filtración.  SDS 10% (para tampón de hibridación y tampón de lavado) SDS ........................ 10 g Agua destilada....... Hasta 100 ml Esterilizar por filtración.  Agua Milli-Q  Reactivo de montaje para evitar la pérdida de fluorescencia. Vectashield 3.4.2 Tratamiento de los portaobjetos cubiertos de Teflón Todos los portaobjetos utilizados en la técnica FISH se han de lavar y desengrasar. Previamente a su empleo se les debe dar un baño en una solución de gelatina y de sulfato de potasio y cromo para favorecer la adhesión de la muestra. A continuación se detallan los pasos a seguir para el tratamiento de los portaobjetos: o Lavar con solución de limpieza. o Enjuagar con agua destilada.
  41. 41. M. Lledías Máster en Ingeniería Ambiental 46 o Secar al aire (dejar escurrir todo 1 día, protegiendo del polvo ambiental cubriendo los portaobjetos con papel aluminio). o Cubrir con gelatina por inmersión en la solución de gelatina 0,1% con cromato sulfato potásico 0,01% (preparada en el momento, temperatura 60ºC). o Secar al aire. 3.4.3 Fijación y permeabilización de las muestras Para llevar a cabo la técnica FISH fue necesario fijar las bacterias. Este primer paso es necesario para que la estructura celular se mantenga rígida y estática y se conserve su morfología favoreciendo la penetración de las sondas. Las células deben ser permeabilizadas, para ello se utilizan detergentes como el SDS (sodio dodecil sulfato). Para la fijación de las muestras se utilizó un reactivo diferente según la pared celular de la bacteria (Gram positiva y Gram negativa). En el caso de las bacterias Gram negativas la permeabilización se realizó con paraformaldehido. Una vez fijadas las muestras, se conservan a -20ºC. Los pasos y reactivos para la fijación y permeabilización se describen en detalle a continuación para bacterias Gram negativas: o Lavar 1ml de flóculo con 500μl de PBS 1X (7000 r.p.m durante 3 minutos). o Añadir 3 vols de PFA (750 μl) a 1 vol (250 μl) de muestra y mantener a 4ºC durante 1-3 h. (mínimo 1h- máximo 18h). o Concentrar las células por centrifugación (7000 r.p.m durante 3 minutos) y eliminar fijador. o Lavar las células con PBS 1X (500 μl). o Resuspender las células con con PBS 1X (500 μl) y etanol absoluto (500 μl) y mantener a -20ºC Los pasos a realizar en función del tipo de bacteria a fijar, se describen en la figura 7, en este caso se destaca la fijación para bacterias Gram negativas.
  42. 42. M. Lledías Máster en Ingeniería Ambiental 47 Figura 7. Fijación de las muestras.
  43. 43. M. Lledías Máster en Ingeniería Ambiental 48 3.4.4 Aplicación de las muestras a los portaobjetos Los pasos para la aplicación de las muestras son los siguientes: o Poner un volumen entre 3 y 5 μl de muestra fijada al portaobjetos FISH. En este caso se ha puesto un volumen de 4 μl en cada pocillo del portaobjetos. o Secar al aire. o Deshidratar en etanol 50% durante 3 minutos por inmersión. o Deshidratar en etanol 80% durante 3 minutos por inmersión. o Deshidratar en etanol 100% durante 3 minutos por inmersión o Secar al aire. 3.5 Sondas utilizadas Las diferentes sondas utilizadas en las hibridaciones se recogen en la tabla 5, así como su secuencia de nucleótidos del extremo 5’ al 3’ y el porcentaje de formamida óptimo a utilizar. Las sondas marcadas con el fluoróforo TAMRA (rodamina, cuya longitud de onda de absorción es de 565nm y de emisión de 580nm, rojo) fueron las siguientes: Caldi-0678, T0803-0654, T0803ind-0642, CFX197, CFX223, CFX67a, CFXMIX (CFX1223+GNSB941), G123T, HHY, TM7905. Mpa645, MC2-649, ALF1B, BET 42 a, y GAM 42a. Sólo una sonda se marcó con FAM (Fluoresceína) cuya longitud de onda absorción es de 494 nm y de emisión de 518nm (verde): CFX67b. Tabla 5. Sondas empleadas en la identificación de las bacterias filamentosas Sonda Especificidad Secuencia % FA* Referencia Caldilinea Caldi-0678 Género Caldilinea TTCCACCACTACACCGGG 30 Kragelund et al. (2011) Comp1-Caldi- 0678 Sonda competidor 1 TTTCACCACTACACCGGG - Kragelund et al. (2011) Comp2-Caldi- 0678 Sonda competidor 2 TTCCACCGCTACACCGGG - Kragelund et al. (2011) Tipo 0803 T0803-0654 Morfotipo 0803 ACACC CTCTCACYRCCT 30 Kragelund et al. (2011)
  44. 44. M. Lledías Máster en Ingeniería Ambiental 49 T0803ind-0642 Morfotipo 0803 CTGCCTCAAGCTACTCAG 30 Kragelund et al. (2011) h1 T0803ind- 0607 Helper AGTTAAGCCAGGAGATTT - Kragelund et al. (2011) h2 T0803ind- 0625 Helper TTTCCAACGACCCCTCCC - Kragelund et al. (2011) h3 T0803ind- 0662 Helper GAATTCTACACCCCTCTC - Kragelund et al. (2011) h4 T0803-0680 Helper ATTCCACCACTACACCGG - Kragelund et al. (2011) TIPO 0092 CFX197 Variante A TCCCGGAGCGCCTGAACT 40 Speirs et al. (2009) CFX197comp Sonda competidora TCCCGAAGCGCCTGAACT - Speirs et al. (2009) CFX223 Variante B GGTGCTGGCTCCTCCCAG 35 Speirs et al. (2009) CFX223 H202 Helper AGCGCCTGAGCTTCAGTCATC - Speirs et al. (2009) CFX223 H241 Helper CGTTACCTTACCAACTAGCTGATGG - Speirs et al. (2009) TIPO 0914 CFX67a Tipo 0914 TTCCGAAGATCAGGTTCG 35 Speirs et al. (2010) CFX67-H46 Helper TTCGACTTGCATGTGTTARGC - Speirs et al. (2010) CFX67 comp Sonda competidora TTCCGAAGATCGGGTTCG - Speirs et al. (2010) CFX67b Tipo 0914 TTCCGAAGATTAGGTTCG 35 Speirs et al. (2010) CFX67-H95 Sonda helper CCGTRCGCCACTAACCYT - Speirs et al. (2010) Phylum Chloroflexi CFX1223 Phylum Chloroflexi CCATTGTAGCGTGTGTGTMG 35 Björnsson et al. (2002) CFX1223- H1206 Helper CCCWGGAYATAAAGGCC - Speirs et al. (2010) CFX1223- H1243 Helper TTTAGCAACYYATTGTACCGR - Speirs et al. (2010) GNSB914 Phylum Chloroflexi AAACCACACGCTCCGCT 35 Gich et al. (2001) GNSB914-H927 Helper GCTTGTGCGGGCCC - Speirs et al. (2010) GNSB941-H958 Helper TTCTTCGYGTTGCATCGAATT - Speirs et al. (2010) TIPO 1851 CHL1851 Tipo 1851 AATTCCACGAACCTCTGCCA 35 Beer et al.(2002) β Proteobacteria BET42a β Proteobacteria GCCTTCCCACTTCGTTT 35 Manz et al. (1992) γ Proteobacteria GAM42a γ Proteobacteria GCCTTCCCACATCGTTT 35 Manz et al. (1992) Microthrix parvicella Mpa645 Microthrix parvicella CCGGACTCTAGTCAGAGC 20 Erhart et al. (1997b) C. “Monillibacte r batavus” MC2-649 C. “Monillibacter batavus” CTCTCCCGGACTCGAGCC 35 Snaidr et al. (2002) Haliscomeno bacter hydrossis HHY Haliscomenob acter hydrossis GCCTACCTCAACCTGATT 20 Wagner et al. (1994) TIPO 0041/0675 TM7905 TIPO 0041/0675 CCGTCAATTCCTTTATGTTTTA 20 Hugenholtz et al. (2001) Thiothrix spp. G123T Thiothrix spp. CCTTCCGATCTCTATGCA 40 Kanagawa et al. (2000) *Porcentaje de formamida óptimo para la hibridación.
  45. 45. M. Lledías Máster en Ingeniería Ambiental 50 3.6 Hibridación in situ Para el proceso de hibridación se deben seguir los siguientes pasos y emplear los reactivos que se detallan a continuación: En primer lugar se prepara la solución de hibridación con formamida en un microtubo de 2 ml. La cantidad de reactivos dependerá del porcentaje óptimo de formamida que a su vez dependerá de la sonda utilizada (tabla 6). Tabla 6. Solución de hibridación según porcentaje de formamida Reactivo % DE FORMAMIDA 10% 20% 25% 30% 35% 40% 45% NaCl 5M 360μl 360μl 360μl 360μl 360μl 360μl 360μl HCl-Tris 1M 40μl 40μl 40μl 40μl 40μl 40μl 40μl Formamida 200μl 400μl 500μl 600μl 700μl 800μl 900μl H2O MiliQ 1398μl 1198μl 1098μl 998μl 898μl 798μl 698μl SDS 10% 2μl 2μl 2μl 2μl 2μl 2μl 2μl Volumen Final 2000 μl 2000 μl 2000 μl 2000 μl 2000 μl 2000 μl 2000 μl o Poner 9 μl de la solución de hibridación + 1 μl de sonda en cada pocillo y repartir homogéneamente por todo el campo. En el caso de que junto con la sonda se tengan que añadir sondas competidoras y/o helper se deberá hacer una combinación de todos ellos con la sonda hasta alcanzar la cantidad de 1 μl. A partir de la puesta en contacto con la sonda hay que evitar el contacto con la luz para evitar la pérdida de fluorescencia del fluoróforo. o Poner un trozo de papel de celulosa dentro de un tubo Falcon de 50ml y echar sobre el papel la solución de hibridación sin sonda que sobra, este paso es necesario para crear una atmósfera húmeda. o Introducir el portaobjetos dentro del tubo Falcon de 50ml en posición horizontal. o Incubar a 46ºC durante al menos 1h 30 min.
  46. 46. M. Lledías Máster en Ingeniería Ambiental 51 o Para eliminar el exceso de sonda que no ha hibridado y la formamida de los portaobjetos se prepara 50 ml de solución de lavado mezclando los reactivos presentes en la siguiente tabla dependiendo del porcentaje de formamida que ha sido utilizado en la solución de hibridación (tabla 7) Tabla 7.Solución de lavado según porcentaje de formamida Reactivo % DE FORMAMIDA 10% 20% 25% 30% 35% 40% 45% NaCl 5M 4500μl 2150μl 1490μl 1020μl 700μl 460μl 300μl EDTA 0,5M - 500μl 500μl 500μl 500μl 500μl 500μl HCl-Tris 1M 1000μl 1000μl 1000μl 1000μl 1000μl 1000μl 1000μl H2O MiliQ 44,45ml 46,3ml 47,94ml 47,43μl 47,75ml 47,06μl 48,15ml SDS 10% 50 μl 50μl 50μl 50μl 50μl 50μl 50μl Volumen Final 50 ml 50 ml 50 ml 50 ml 50 ml 50 ml 50 ml o Sacar de la estufa y rápidamente lavar los portaobjetos e introducirlos dentro del tubo con la solución de lavado, los tubos se forran con papel de aluminio para protegerlos de la luz. Incubar en un baño a 48ºC durante 15-20 minutos. o Lavar con agua MilliQ. o Secar al aire en la oscuridad. o Si no se observa al microscopio inmediatamente, guardar el porta a -20ºC. 3.7 Observación al microscopio Una vez realizada la hibridación in situ con las sondas específicas, es posible proceder a la observación con el microscopio y a la toma de imágenes. Para poder observar las muestras con el microscopio de epifluorescencia se precisa la aplicación de Vectaschield, líquido de montaje que evita la pérdida de fluorescencia. Se debe disponer una pequeña cantidad de este líquido en la zona central del portaobjetos y colocar encima un cubreobjetos, a continuación con ayuda de una punta se ejerce una pequeña presión sobre éste para que el líquido de montaje
  47. 47. M. Lledías Máster en Ingeniería Ambiental 52 se extienda de forma uniforme por toda la muestra, ya se puede observar el pocillo con los objetivos de 60X o 1000X (con aceite de inmersión). El microscopio utilizado para la observación de las muestras ha sido un Olympus BX 50 con los filtros: U-MWIB (Fluoresceína, FAM) y U-MWIG (Rodamina, TAMRA). Las fotografías en color se realizaron con una cámara digital Olympus DP 10 acoplada al microscopio 3.8 Identificación y cuantificación de microorganismos filamentosos Uno de los objetivos del presente estudio fue identificar y cuantificar los morfotipos filamentosos presentes. Las dos técnicas utilizadas en la identificación y cuantificación de las bacterias filamentosas en el presente estudio fueron: 3.8.1 Técnica convencional Las técnicas convencionales se emplearon únicamente como análisis preliminar para la elección de las sondas previa a la aplicación de la técnica FISH. La observación de los filamentos bacterianos del flóculo mediante métodos clásicos se realizó antes de las 48 horas posteriores a la toma de muestras. En un número reducido de muestras y con carácter informativo se estimó la densidad de filamentos aplicando la escala subjetiva (0-5) propuesta por Eikelboom (2000,2006) y Jenkins et al (2004). 3.8.2 Técnica FISH Para la cuantificación de los microorganismos se realizó un barrido de todos los pocillos del portaobjetos con el microscopio de epifluorescencia una vez realizado el proceso de hibridación in situ. La valoración de la abundancia de las bacterias filamentosas se realizó aplicando la escala subjetiva de Eikelboom (2000,2006), (tabla 8).
  48. 48. M. Lledías Máster en Ingeniería Ambiental 53 Tabla 8. Escala de valoración de organismos filamentosos FI Abundancia Descripción 0 “Ninguno” Ningún filamento presente 1 “Pocos” Pocos filamentos y de forma ocasional en el flóculo 2 “Algunos” Filamentos en aproximadamente la mitad de los flóculos 3 “Comunes” Filamentos en todos los flóculos con baja densidad (1-5/flóculo) 4 “Muy comunes” Filamentos en todos los flóculos con densidad media (5-20/ flóculo) 5 “Abundantes” Filamentos en todos los flóculos con alta densidad (>20/ flóculo) La escala utilizada para valorar la abundancia de las bacterias filamentosas se muestra en la figura 8. Figura 8. Escala de valoración de la abundancia de bacterias filamentosas 3.9 Análisis estadístico En el análisis estadístico primeramente se realizó un resumen estadístico donde se tabularon los valores mínimos, máximos, la media y la desviación estándar de cada una de las variables operacionales y físico-químicas. Posteriormente se realizó un análisis de correspondencia canónica (ACC). Se trata de una técnica multivariante que permite representar en un espacio
  49. 49. M. Lledías Máster en Ingeniería Ambiental 54 geométrico de pocas dimensiones las proximidades existentes entre un conjunto de objetos condicionado por una serie de variables predictoras. Permite a los ecologistas relacionar la abundancia de especies (variables independientes) con las variables del entorno (variables dependientes o explicativas) (Ter Braak, 1986). Se empleó este análisis puesto que, contrariamente al análisis de componentes principales, no se trata de una técnica exploratoria (Ramette, 2007). Además proporciona mejores conclusiones, realiza un análisis directo del gradiente, nos permite conocer los valores óptimos e incluso con gradientes cortos ofrece buenos resultados. El ACC utiliza el modelo unimodal para modelar la respuesta de la especie a la variación ambiental como una simplificación matemática para permitir la estimación de un gran número de parámetros y la identificación de un pequeño número de ejes de ordenación (Ramette, 2007). Este modelo de especies parece, sin embargo, ser robusto incluso cuando algunas especies muestran respuestas bimodales, intervalos desiguales o máximos desiguales a lo largo de gradientes ambientales (ter Braak y Smilauer, 2002). Por lo tanto, es particularmente adaptado para la interpretación y ordenación ambiental de tablas de abundancia y ocurrencia de especies (Ramette, 2007). 3.9.1 Tratamiento por ordenador Para realizar el ACC se utilizó el programa XLSTAT-ADA 2012, donde se introdujo la matriz de datos previamente normalizados (log (variable+1)) y se especificaron las variables deseadas en cada caso para realizar el ACC. El test de permutación realizado sugirió la conveniencia de utilizar un método unimodal (ACC). El programa genera un gráfico “biplot” en el cual aparecen puntos y flechas que representan la ordenación de las variables respecto a dos ejes. Cada punto representa a una especie, la distancia entre el símbolo en el diagrama aproxima la disimilaridad de la distribución de la abundancia relativa de dicha especie a través de los lugares. Especies cuyos puntos que las representan aparecen próximos en el gráfico significa, que a menudo son especies que aparecen juntas (ocurren conjuntamente), y por tanto, aparecerán en lugares que representan las mismas condiciones ambientales, y ellas presentan óptimos similares para todas las variables ambientales. Cada flecha marca la dirección esperada de mayor incremento de los valores de la variable medioambiental a la que representa, es lo que se conoce como
  50. 50. M. Lledías Máster en Ingeniería Ambiental 55 dirección del gradiente. La longitud de la misma se refiere a su variabilidad. La flecha se inicia desde el promedio (ponderado) de la variable ambiental, y los valores aumentan hacia la punta de la flecha y disminuyen en la dirección opuesta. Los ángulos entre dos flechas indican la correlación entre las variables ambientales que representan, por tanto, un ángulo agudo indica correlación alta positiva, y un ángulo cercano a 180° indica correlación alta negativa; un ángulo próximo a 90° indicaría que su correlación es aproximadamente 0. Los puntos especie pueden ser proyectados perpendicularmente sobre la línea imaginaria superpuesta al vector que representa a una variable particular. Dichas proyecciones pueden ser utilizadas para aproximar el óptimo de dicha especie con respecto a dicha variable ambiental. De esta forma, las especies cuya proyección está más cercana a la punta de la flecha del vector que representa a la variable indica que prefiere valores más altos de dicha variable (es decir, que su óptimo son valores más altos de dicha variable). Al contrario sucedería si proyecta sobre el lado opuesto a la flecha en esa línea imaginaria, que tendría como óptimo valores más bajos de dicha variable.
  51. 51. RESULTADOS
  52. 52. M. Lledías Máster en Ingeniería Ambiental 58 4 RESULTADOS Los resultados que se presentan a continuación corresponden tanto a la identificación como a las abundancias de los morfotipos detectados en las muestras analizadas por el método molecular FISH, así como al análisis estadístico realizado entre dichos morfotipos filamentosos y los parámetros físico-químicos y operacionales del proceso de depuración con sistema MBR. Se incluyen también los resultados obtenidos en la identificación preliminar por métodos convencionales como apoyo al estudio. 4.1 Cuantificación e identificación de los morfotipos filamentosos. 4.1.1 Microscopía Convencional Las bacterias filamentosas se identificaron gracias a características morfológicas distintivas. No obstante algunos morfotipos tienen un gran parecido y no permiten una identificación por estos métodos como organismos diferentes. Es el caso de los morfotipos 0803/0914 y 0041/0675. Existen otros morfotipos cuya identificación reviste especial dificultad por presentar una morfología muy variable o por sus reducidas dimensiones. Los morfotipos de bacterias filamentosas identificados por métodos convencionales se muestran en la tabla 9. *Morfotipos que revisten gran dificultad de identificación. Tabla 9. Morfotipos identificados por métodos convencionales Morfotipo Filamentoso Presente TIPO 0803/0914 Si Nocardioformes No TIPO 0041/0675 Si TIPO 021N Si TIPO 0961 Si TIPO 0092 Si* N. limicola Si TIPO 0581 Si* TIPO 1851 Si H. hydrossis Si*
  53. 53. M. Lledías Máster en Ingeniería Ambiental 59 A continuación se muestran imágenes de las bacterias filamentosas identificadas por métodos convencionales, observadas con microscopía de contraste de fases a 1000 aumentos (100X) (Imagen 1). Imagen 1. Bacterias filamentosas identificadas por métodos convencionales, microscopía de contraste de fases 1000X. 1. Haliscomenobacter hydrossis, 2. Nostocoida limícola, 3. Tipo 0092, 4 Tipo 0041/0675, 5. Tipo 0803/0914, 6. Tipo 021N, 7. Tipo 0961, 8. Monilibacter Batavus, 9. Tipo 1851. Con fines únicamente informativos, se estimó la abundancia de los morfotipos identificados por métodos convencionales de algunas de las muestras. (figura 9)
  54. 54. M. Lledías Máster en Ingeniería Ambiental 60 Figura 9. Abundancia de los morfotipos identificados por convencional El empleo de métodos convencionales de identificación sirvió de ayuda en la selección de las sondas adecuadas para la identificación por el método molecular FISH. 4.1.2 Método molecular FISH Una vez identificadas las bacterias presentes por métodos convencionales, se procedió a la hibridación con las sondas disponibles más adecuadas. Las sondas empleadas para la identificación de los morfotipos de bacterias filamentosas empleando la técnica FISH y su Índice de Abundancia de Filamentosas (IF), se muestran en la tabla 10. Tabla 10. Sondas empleadas y abundancias Bacteria Filamentosa Sonda IF Tipo 1851 CHL 1851 0 C."Monilibacter batavus" MC2-649 4-5 Microthrix parvicella mpa645 1 Caldilinea Caldi-0678 5 Tipo 0803 T0803-0654 5 Tipo 0803 T0803ind-0642 0 Tipo 0092 (variante A) CFX197 5 Tipo 0092 (variante B) CFX223 <3 Tipo 0914 CFX67a <3
  55. 55. M. Lledías Máster en Ingeniería Ambiental 61 Tipo 0914 CFX67b 0 Chloroflexi CFX1223 5 Betaproteobacteria BET42a 0 Gammaproteobacteria GAM42a <3 Thiothrix sp. G123T <2.5 Tipo 0041/0675 TM7905 0 Halyscomenobacter hydrossis HHY 0 Los recuentos correspondientes a cada día de muestreo para cada sonda empleada en la identificación con el método molecular FISH, se muestran en la figura 10.
  56. 56. M. Lledías Máster en Ingeniería Ambiental 62 Figura 10. Abundancia presentada por cada una de las sondas empleadas para la identificación mediante FISH
  57. 57. M. Lledías Máster en Ingeniería Ambiental 63 A continuación se muestran imágenes de las bacterias filamentosas identificadas por mediante FISH (Imagen 2). Imagen 2. Bacterias filamentosa identificadas mediante FISH. 1a y b. Candidatus `Molinibacter batavus´ (sonda MC2-649), (FISH, contraste Fases), 1000X; 2a y b. Phylum Chloroflexi (sondas GNSB 941 y CFX 1223), 1000X; 3a y b. Bacterias filamentosas del Tipo 0092 variante A phylum Chloroflexi (sonda CFX197, (FISH, contraste Fases), 1000X; 4. Bacterias filamentosas del género Caldilinea phylum Chloroflexi (sonda Caldi-0678), 1000X.
  58. 58. M. Lledías Máster en Ingeniería Ambiental 64 La aparición del Tipo 0041/0675, Haliscomenobacter hydrossis (4 muestras con IF>2), y el Tipo1851 (4 muestras con IF>5) fue estimada por microscopia convencional. No se detectó señal de fluorescencia en las hibridaciones con las sondas TM7905 (Tipo 0041/0675), HHY (H. hydrossis), CHL1851 (Tipo 1851). 4.2 Estadística Inicialmente se realizó un Resumen Estadístico donde se tabularon los valores mínimos, máximos, la media y la desviación estándar de cada una de las variables operacionales y físico-químicas (tabla 11). Para los cálculos estadísticos se empleó el programa XLSTAT-ADA 2012 con el que se realizó un Análisis de Correspondencia Canónica (ACC) para determinar las relaciones entre la aparición de bacterias filamentosas, los parámetros operacionales y las características del afluente, se incluyeron únicamente aquellas pruebas de hibridación en las que se obtuvo variabilidad durante el estudio: Thiothrix sp., Gammaproteobacterias, C.”M.batavus”, Tipo 0092 y Tipo 0914. Los resultados fueron los siguientes. Tabla 11. Resumen estadístico Abreviatura Rango Media D. estándar TRHr 47.10-65.73 56.96 6.41 CM 0.01-0.02 0.01 0.00 Fex 180.26-2326.45 1004.73 814.88 LICOR MEZCLA SSLM 10264.00-17166.00 12800.21 2026.66 SSVLM 7720.00-12990.00 9749.00 1511.31 %SSVLM 74.08-80.50 77.39 2.36 AFLUENTE pH 8.04-8.36 8.19 0.09 DBO_afl 180.00-290.00 234.28 37.15 DQO_afl 371.00-636.00 521.14 85.74 NT_afl 60.10-79.70 69.61 6.30 Cond_afl 2680.00-2830.00 2780.93 58.14 EFLUENTE DQO_efl 16.00-25.00 19.00 2.98 DBO_efl 4.00-10.00 7.50 1.83 PT_efl 3.42-6.06 4.41 0.96 CPT 0.00-0.00 0.00 0.00 N_NH4_efl 0.12-4.65 2.01 1.31 N_NO3_efl 2.13-6.80 4.64 1.08 N_NO2_efl 0.12-0.36 0.22 0.06 NT_efl 9.01-13.20 10.49 1.28 CNT 0.00-0.01 0.00 0.00 NKT_efl 3.94-8.42 5.63 1.40
  59. 59. M. Lledías Máster en Ingeniería Ambiental 65 Turb_efl 0.44-1.10 0.80 0.18 RENDIMIENTOS rDBO 95.00-97.78 96.78 0.77 rDQO_ 94.88-97.30 96.26 0.82 rPT 14.20-54.53 38.26 11.81 rNT 81.49-88.34 84.91 1.47 rNKT 88.25-94.27 91.93 1.80 En el rango de estudio de la temperatura del reactor (Tr) (10-28ºC), un aumento en la temperatura derivó en una mayor abundancia de Thiothrix. Por el contrario, el Tipo 0092 y el Tipo 0914 mostraron una relación negativa con Tr.(figura 11) Figura 11.Ordenación del biplot basado en el ACC de la matriz Especies/Parámetros operacionales con un 28,35% de inercia. Dónde el Tipo 0092 (CFX223), C.”Monilibacter batavus” (MC2-649), Thiothrix (G123T), Tipo 0914 (CFX67a), Gammaproteobacterias (GAM42a). El biplot del ACC de Especies/Parámetros operacionales, mostró una relación positiva entre la abundancia de C. “M. batavus” y Thiothrix, la carga másica (CM) y los fangos en exceso (Fex). El Tipo 0914 se relacionó positivamente con el tiempo de retención hidráulico (TRH), al contrario que C. “M. batavus” y Thiothrix cuya relación con TRH fue negativa. (figura 11). En el afluente el aumento en la disponibilidad de C y
  60. 60. M. Lledías Máster en Ingeniería Ambiental 66 N contribuyó positivamente al cambio en la abundancia relativa de C.”M. batavus” y el Tipo 0092, mientras Thiothrix y Tipo 0914 lo hicieron negativamente (figura 12). Figura 12.Ordenación del biplot basado en el ACC de la matriz Especies/Características del afluente con un 25,54% de inercia. Dónde el Tipo 0092 (CFX223), C.”Monilibacter batavus” (MC2-649), Thiothrix (G123T), Tipo 0914 (CFX67a), Gammaproteobacterias (GAM42a).
  61. 61. DISCUSIÓN
  62. 62. M. Lledías Máster en Ingeniería Ambiental 69 5 DISCUSIÓN 5.1 Técnicas empleadas de identificación Los métodos convencionales de detección e identificación de morfotipos filamentosos, son una gran ayuda para la observación de bacterias filamentosas en fangos activos de EDAR, a pesar de lo cual no son una herramienta fiable debido a su bajo nivel de especificidad. Es deseable el uso complementario de la técnica FISH para conocer la verdadera abundancia y ecofisiología de los morfotipos filamentosos. A pesar de realizarse hibridaciones con distintas sondas teniendo en cuenta la identificación previa por métodos convencionales, esta no siempre se produjo. Se atribuye este resultado a diversas causas, entre otras a niveles insuficientes de ribosomas en las bacterias presentes en las muestras estudiadas, a la falta de información de algunos morfotipos de bacterias filamentosas que impide una identificación más correcta y a la no existencia de sondas específicas de todos los morfotipos para la aplicación de las técnicas moleculares FISH para todos los morfotipos. El hecho de no hibridar con la sonda elegida, no implica necesariamente que no existan bacterias filamentosas de ese morfotipo en la muestra. 5.2 Abundancia de los morfotipos filamentosos Las bacterias filamentosas del phylum Chloroflexi hibridadas con la sonda CFXmix (CFX1223+GNSB941) presentaron una abundancia elevada (IF= 5), abundantes”) durante todo el periodo de muestreo. Miura et al., (2007) reportaron que la abundancia de Chloroflexi en MBR era superior a la que se daba en el sistema de fangos activos, indicando que era debido a que las condiciones del MBR propiciaban su crecimiento. Otros estudios han apuntado que los filamentos del phylum Chloroflexi son abundantes en EDAR tanto de origen municipal como de origen industrial constituyendo un porcentaje elevado del total de la biomasa de los fangos activos (Kragelund et al., 2011). Los filamentos del género Caldilinea hibridados con la sonda específica Caldi- 0687 también aparecieron en todas las muestras de la EDAR con índices de filamentos elevados (IF=5. Los miembros del género Caldilinea y clase Caldilineae constituyen entre un 9 y un 12 % de la comunidad bacteriana del phylum Chloroflexi, según la técnica molecular FISH (Yoon et al., 2010; Kragelund et al., 2011).
  63. 63. M. Lledías Máster en Ingeniería Ambiental 70 El morfotipo 0803 hibridado con la sonda específica T0803-0654 para aguas urbanas, fue detectado en todas las muestras de la EDAR con abundancia elevada (IF=5). La elevada presencia de este morfotipo filamentoso coincide con las referencias de otros autores (Kragelund et al., 2011) en las que se calcula que el morfotipo 0803 constituye alrededor del 20 % de la población de Chloroflexi. La hibridación con la sonda específica para aguas industriales T0803ind, como era de esperar dio un resultado de IF=0. El morfotipo 0914 se detectó con abundancias menores que el morfotipo 0803 en la EDAR. La sonda CFX76b no hibridó con ningún filamento bacteriano presente en las muestras de las EDAR. Mientras que la sonda CFX67a mostró resultados variables a lo largo del periodo de muestreo, desde IF=0, hasta IF=5. Speirs et al. (2010) observaron en su estudio sobre el morfotipo 0914, que de las veintiséis depuradoras estudiadas sólo en cuatro de ellas la sonda CFX67b hibridó con los filamentos presentes en las muestras mientras que en diecisiete de las EDAR la sonda CFX67a dio señal positiva. Según Speirs et al. (2010) y Andújar et al. (2012), el filamento bacteriano que hibride con la sonda CFX67b presenta una menor incidencia en las EDAR. El morfotipo 0092 en su variante A (sonda CFX197) mostró una abundancia elevada durante todo el periodo (IF=5), su aparición dominante junto al tipo 0803 coincide con las referencias de otros autores (Kragelund et al., 2011) en las que se indica que ambos morfotipos pueden aparecer de forma conjunta siendo ambos la fracción dominante del phylum Chloroflexi. La variante B (sonda CFX223) mostró una abundancia variable a lo largo del periodo de muestreo, desde IF=0 hasta IF=3 aunque por lo general su abundancia fue “pocos”. El morfotipo Microthrix parvicella, se detectó (sonda MPA645) con una abundancia de “pocos” o “ninguno”, este morfotipo es conocido por causar bulking y foaming sus bajos niveles eran esperables ya que no se dio ningún episodio de este tipo y las condiciones de operación con tiempos de retención cortos y alto OD (>2mg/l) no favorecen su crecimiento (Rossetti et al., 2005), aunque en los sistemas MBR estos episodios son menos comunes que en fangos activos. La abundancia de bacterias filamentosas tiene una gran importancia, diversos estudios (Waite, 1999; Wilén et al., 2003; Lee et al., 2005; Li et al., 2008a) mostraron que las bacterias filamentosas están estrechamente relacionadas con el tamaño del
  64. 64. M. Lledías Máster en Ingeniería Ambiental 71 flóculo y la dimensión fractal. El crecimiento de los microorganismos filamentosos podría conducir a un tamaño mayor de flóculo (Wilén et al., 2003; Meng et al., 2006) y los fangos con menor contenido en bacterias filamentosas, tienden a tener una estructura más “compacta”, mientras un excesivo crecimiento de las bacterias filamentosas podría derivar en flóculos dispersos e irregulares (Waite, 1999; Li et al., 2008a). Los EPS comprenden básicamente una variedad de materiales poliméricos entre los cuales las proteínas y los carbohidratos son los dos componentes principales (Li et al., 2012). Algunos autores (Zahng et al., 2010; Pan et al., 2010) sostienen que a medida que aumenta la concentración de las bacterias filamentosas, hay un aumento de los EPS y de los productos microbianos solubles (SPM). Otros autores (You et al., 2009; Meng et al., 2006) asocian la concentración de bacterias filamentosas con el bioensuciamiento de la membrana. Por el contrario Li et al., (2008) y Parada et al., (2012) afirman en sus estudios que la densidad de filamentosas no tiene un impacto significativo en el bioensuciamiento de la membrana. Reforzando esta afirmación, Miura et al., (2007) reportó que los miembros del phylum Chloroflexi son metabólicamente versátiles y pueden utilizar preferentemente glucosa y N-acetil glucosamina (componente del peptidoglicano de la pared celular de las bacterias) bajo condiciones óxicas y anóxicas. Esto sugiere que los miembros de Chloroflexi son ecológicamente significativos en los MBR que tratan aguas urbanas y son responsables de la degradación de los SPM incluyendo carbohidratos y material celular, lo que en consecuencia reduce el potencial ensuciamiento. En el MBR analizado los datos de presión transmembrana (tabla 12, Anexo) correspondientes a parte del periodo de estudio muestran que la membrana no sufrió grandes variaciones de presión. Las bacterias filamentosas dominantes en el MBR analizado mantuvieron una abundancia elevada (IF= 5) constante y son miembros de Chloroflexi, que debido a su capacidad enzimática extracelular de hidrólisis de moléculas de elevado peso molecular (polisacáridos) podría disminuir el bioensuciamiento de las membranas. Tan solo un número reducido de estudios han comparado operando en paralelo la comunidad microbiana entre MBR y el sistema convencional fangos activos (CAS), y todos revelaron diferencias significativas entre las estructuras comunitarias generales (Luxmy et al. 2000; Hall et al., 2010; Wan et al. 2011). Parece que los MBR seleccionan una comunidad microbiana más estable en comparación con sistemas CAS, donde se observa una mayor dinámica (Hall et al. 2010; Wan et al. 2011).
  65. 65. M. Lledías Máster en Ingeniería Ambiental 72 Además, se han encontrado un amplio conjunto de secuencias bacterianas no cultivadas y nuevas en un MBR (Wan et al. 2011), lo que refleja la actual falta de conocimiento sobre las poblaciones microbianas presentes en los MBR. 5.3 Estadística El rango normal de temperatura en fangos activos es de 8 a 25ºC, se puede generalizar que los organismos filamentosos crecen más rápido a medida que la temperatura aumenta dentro de este rango hasta los 35ºC, entre los 35 y 40ºC los organismos filamentosos se estresan progresivamente, creciendo frecuentemente en estado disperso (Jenkins et al.,2004). Dado que muchos de estos organismos son mesofilicos, su crecimiento cesa cerca de los 40ºC, sin embargo el Tipo 0914 parece ser termotolerante desde que Norris et al. (2000) observo su crecimiento en fangos activos a temperaturas de 50ºC. Eikelboom (2000) sugiere que el Tipo 0092 es dominante a temperaturas por encima de los 15ºC. Siguiendo estas premisas parece lógico que Thiothrix se vea favorecida por el rango alto de temperatura del reactor, mientras que la correlación con la temperatura del Tipo 0092 no coincide con los resultados de estos autores, es posible que la diferencia en los métodos estadísticos empleados sea la causante de esta discrepancia. La falta de estudios que relacionen estos morofotipos con los parámetros operacionales de un sistema MBR nos impide establecer una pauta específica de comportamiento. Yi et al., (2012) en su estudio sobre la estructura poblacional de la comunidad microbiana (MCS) y su dinámica en fangos activos utilizó el ACC, en sus resultados i del ACC lla concentración de DBO en el afluente juega el papel más importante en los cambios del MCS, seguido de la concentración de SST del afluente, además en el efluente las concentraciones de SST y de PT se vieron afectadas significativamente por el cambio en la MCS. En nuestro estudio también hemos observado como las variaciones de la DBO y DQO del afluente propiciaban el crecimiento de distintos morfotipos, estableciéndose así una relación positiva con C.”Monilibacter batavus” y el Tipo 0092 y negativa con Thiothrix y el Tipo 0914. Unos valores de carga de DBO altos podrían influir en la diversidad microbiana reduciendo la competición entre los microorganismos heterótrofos (Tan et al., 2008), el cual podría afectar ligeramente a MCS generales. En los MBR se ven favorecidas las bacterias de crecimiento lento, favorecidas por las condiciones de limitación de nutrientes impuesta por los prolongados tiempos de retención de la biomasa característicos de los MBR (Chen y Lapara, 2006; Lapara et al., 2002)
  66. 66. 73 CONCLUSIONES
  67. 67. 74
  68. 68. M. Lledías Máster en Ingeniería Ambiental 75 6 CONCLUSIONES Los morfotipos filamentosos del phylum Chloroflexi (tipo 0803, 0914 y 0092) identificados con la técnica FISH comprendían el grupo dominante en el reactor biológico. El morfotipo secundario identicado ha sido Candidatus ”Monilibacter batavus” . El resto de morfotipos filamentosos mostraron abundancias variables a lo largo del estudio. Los morfotipos identificados del phylum Chloroflexi no han presentado variaciones estacionales en su abundancia durante el período del estudio de Febrero a Noviembre. En el MBR estudiado no se han presentado incrementos significativos de la presión transmembrana. Las bacterias filamentosas del phylum Chloroflexi con valores de FI altos podrían disminuir el bioensuciamiento de las membranas al consumir las proteínas y carbohidratos que dan lugar al bioensuciamiento. Los métodos convencionales de identificación de bacterias filamentosas son una ayuda en la identificación pero no son fiables en la especificidad, y deben emplearse de forma conjunta con la técnica FISH para un mejor control del proceso de depuración.
  69. 69. BIBLIOGRAFÍA

×