Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Valencia, Diciembre 2013.
Estudio de las relaciones de las bacterias
filamentosas no ramificadas (Microthrix y tipo
0581) ...
Trabajo Final de Máster Ingeniería Ambiental
2
AGRADECIMIENTOS
“El científico no busca un resultado
inmediato. No espera q...
Trabajo Final de Máster Ingeniería Ambiental
3
RESUMEN
Las bacterias filamentosas no ramificadas (Microthrix y Tipo 0581) ...
Trabajo Final de Máster Ingeniería Ambiental
4
LISTADO DE ACRÓNIMOS
ACC Análisis de correspondencias canónicas
ACP Análisi...
Trabajo Final de Máster Ingeniería Ambiental
5
ÍNDICE
1.- INTRODUCCIÓN.......................................................
Trabajo Final de Máster Ingeniería Ambiental
6
4.- RESULTADOS................................................................
Trabajo Final de Máster Ingeniería Ambiental
7
INDICE DE ECUACIONES
Ecuación 1. Cálculo del coeficiente lineal de Pearson....
Trabajo Final de Máster Ingeniería Ambiental
8
INDICE DE GRÁFICOS
Gráfico 1. Volumen de Agua Depurada. EPSAR, 2012 ..........
Trabajo Final de Máster Ingeniería Ambiental
9
INDICE DE ILUSTRACIONES
Ilustración 1.hipótesis de utilización de LCFA por ...
Trabajo Final de Máster Ingeniería Ambiental
10
INDICE DE TABLAS
Tabla 1. Composición típica de A. Residual doméstica........
Trabajo Final de Máster Ingeniería Ambiental
11
Tabla 25.Listado de los parámetros físico-químicos del licor mezcla. ........
Trabajo Final de Máster Ingeniería Ambiental
12
1.- INTRODUCCIÓN
1.1.- Características de las aguas residuales
El agua es ...
Trabajo Final de Máster
Situación en la Comunidad Valenciana
A partir del informe de gestión de la EPSAR (Entidad Pública ...
Trabajo Final de Máster Ingeniería Ambiental
14
Legislación relativa a las aguas residuales
La legislación que hace refere...
Trabajo Final de Máster Ingeniería Ambiental
15
1.2.- Tratamiento de las aguas residuales
Una EDAR se encuentra habitualme...
Trabajo Final de Máster Ingeniería Ambiental
16
1.2.2.- El flóculo
El flóculo es la unidad ecológica y estructural de los ...
Trabajo Final de Máster Ingeniería Ambiental
17
Además podemos encontrar, aunque en raras ocasiones, hongos que pueden
pro...
Trabajo Final de Máster Ingeniería Ambiental
18
Tabla 5.Problemas típicos en los fangos activos causados por microorganism...
Trabajo Final de Máster Ingeniería Ambiental
19
1.4.- Importancia de las bacterias filamentosas
En todos los tipos de EDAR...
Trabajo Final de Máster Ingeniería Ambiental
20
Morfología
Se trata de un filamento largo (longitud 100-400 µm), fino (diá...
Trabajo Final de Máster Ingeniería Ambiental
21
concentraciones de OD de 2-3 mg/l (Ekama et al., 1996), pudiendo ser tóxic...
Trabajo Final de Máster Ingeniería Ambiental
22
Ilustración 1.hipótesis de utilización de LCFA por M.parvicella en plantas...
Trabajo Final de Máster Ingeniería Ambiental
23
(1994), una identidad de secuencia por debajo del 97% indica que se trata ...
Trabajo Final de Máster Ingeniería Ambiental
24
filamentos similares a M. parvicella en fangos industriales que muchas vec...
Trabajo Final de Máster Ingeniería Ambiental
25
Taxonomía
Se ha identificado el morfotipo 0581 dentro del phylum Chlorofle...
Trabajo Final de Máster Ingeniería Ambiental
26
microorganismos. Eikelboom (1975), estableció una nomenclatura basada en l...
Trabajo Final de Máster Ingeniería Ambiental
27
1.5.2.- Técnica FISH para la identificación de bacterias filamentosas
Para...
Trabajo Final de Máster Ingeniería Ambiental
28
La sonda que se utiliza en la técnica FISH está formada por una pequeña
se...
Trabajo Final de Máster Ingeniería Ambiental
29
2.- OBJETIVOS
Para conseguir un control efectivo de muchos de los problema...
Trabajo Final de Máster Ingeniería Ambiental
30
3.- MATERIAL Y MÉTODOS
3.1.- Descripción de la EDAR
Se tomaron muestras de...
Trabajo Final de Máster Ingeniería Ambiental
31
En la tabla 8 se puede observar la ficha técnica de la instalación:
Tabla ...
Trabajo Final de Máster Ingeniería Ambiental
32
normalizados (APHA, 2005) en las muestras de las distintas EDAR. El Índice...
Trabajo Final de Máster Ingeniería Ambiental
33
Ilustración 5. Pasos a realizar para la fijación de muestras según su pare...
Trabajo Final de Máster Ingeniería Ambiental
34
3.4.3.- Aplicación de las muestras a los portaobjetos
Los pasos para la ap...
Trabajo Final de Máster Ingeniería Ambiental
35
Tabla 9. Sondas utilizadas.
Sonda Secuencia (5’-3’) Organismo % FA1 Refere...
Trabajo Final de Máster Ingeniería Ambiental
36
Introducir el portaobjetos en posición horizontal dentro del tubo Falcón d...
Trabajo Final de Máster
Para la cuantificación de los microorganismos se realizó un barrido de todos los
pocillos del port...
Trabajo Final de Máster Ingeniería Ambiental
38
3.8.- Técnicas de Análisis Estadístico para muestras ambientales
3.8.1.- A...
Trabajo Final de Máster Ingeniería Ambiental
39
El coeficiente de Spearman se calcula con la fórmula expresada en la Ecuac...
Trabajo Final de Máster Ingeniería Ambiental
40
3.8.2.- Análisis Multivariante
El análisis multivariante es la parte de la...
Trabajo Final de Máster Ingeniería Ambiental
41
La posibilidad de comprobar si existe una relación estadísticamente
signif...
Trabajo Final de Máster Ingeniería Ambiental
42
4.- RESULTADOS
Los resultados obtenidos durante la realización del proyect...
Trabajo Final de Máster Ingeniería Ambiental
43
Tabla 14. Valores mínimos y máximos (rango), media y desviación estándar d...
Trabajo Final de Máster Ingeniería Ambiental
44
Como se ha comentado anteriormente, la similitud morfológica entre las
bac...
Trabajo Final de Máster Ingeniería Ambiental
45
Ilustración 11.A la izquierda vista con contraste de fases y a la derecha ...
Trabajo Final de Máster Ingeniería Ambiental
46
Por último, se empleó la sonda GNSB941+CFX1223 para la identificación de l...
Trabajo Final de Máster Ingeniería Ambiental
47
Muestra Línea A+B Línea C+D
Nº Fecha MPAall1410 MPA645 MPA60 MPA1260 GNSB9...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espum...
Upcoming SlideShare
Loading in …5
×

2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espumas con los parámetros Operacionales y Físico- Químicos

0 views

Published on

Tena, S. (2013) Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espumas con los parámetros Operacionales y Físico- Químicos en una EDAR de la Comunidad Valenciana. Trabajo final de Máster en Ingeniería Ambiental. Valencia: Universitat Politècnica de València.
www.abgc

Published in: Environment
  • Be the first to comment

  • Be the first to like this

2013 - Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espumas con los parámetros Operacionales y Físico- Químicos

  1. 1. Valencia, Diciembre 2013. Estudio de las relaciones de las bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espumas con los parámetros Operacionales y Físico- Químicos en una EDAR de la Comunidad Valenciana. Trabajo Final de Máster en Ingeniería Ambiental Realizado por: -Sergio Tena Sierra Dirigido por: -Dr. José Luis Alonso Molina -Dr. Luis Borrás Falomir
  2. 2. Trabajo Final de Máster Ingeniería Ambiental 2 AGRADECIMIENTOS “El científico no busca un resultado inmediato. No espera que sus ideas avanzadas sean fácilmente aceptadas. Su deber es sentar las bases para los que vendrán, señalar el camino” (Nikola Tesla) En primer lugar dar las gracias a Alba, no solo por su ayuda incondicional en este trabajo sino por enseñarme lo bonita que puede ser la vida si sabes sonreír y difrutar de cada instante. En segundo lugar agradecer a José Luis Alonso y Andrés Zornoza su ayuda y disposición y lo más importante contagiarme su motivación y su actitud hacia la investigación. A Luis Borrás por su ayuda y su disposición. A la Entidad Pública de Saneamiento de Aguas Residuales de la Comunidad Valenciana (EPSAR) por facilitar los datos para la realización de este estudio. A mi familia por sus esfuerzos, sus ánimos y su ayuda.
  3. 3. Trabajo Final de Máster Ingeniería Ambiental 3 RESUMEN Las bacterias filamentosas no ramificadas (Microthrix y Tipo 0581) generan importantes problemas de foaming y bulking, dificultando la operación de las EDAR y comprometiendo la calidad del efluente. La correcta identificación de estas bacterias es imprescindible para poder abordar el problema de la forma más eficaz. La gran similitud morfológica entre Microthrix y Tipo 0581 hace que, mediante microscopía de contraste de fases, solamente puedan diferenciarse por su diferente respuesta a la tinción gram (positiva para Microthrix y negativa para Tipo 0581). Por ello, se hace importante la utilización de técnicas moleculares como FISH para corroborar los resultados obtenidos mediante la microscopía convencional. En este estudio se lleva a cabo la identificación y cuantificación de la población de Microthrix y tipo 0581 presentes en el fango activo de la EDAR de la Cuenca del Carraixet (Comunidad Valenciana) durante un período de un año. Se analiza además la dinámica poblacional de estas bacterias y las posibles relaciones entre las variables operacionales y físico- químicas que pueden afectar a su actividad y crecimiento. En el análisis FISH se emplearon sondas marcadas de ácidos nucelicos del gen 16S rRNA. Actualmente, no existe una sonda específica para Tipo 0581, de modo que en este estudio se emplea una sonda a nivel de phylum (para el phylum Chloroflexi, al que pertenece esta bacteria). No se conoce bibliografía publicada sobre la ecofisiología del Tipo 0581, por lo que se trata de un campo nuevo de investigación. Por otra parte, dentro del género Microthrix se ha realizado la identificación de las diferentes especies de las que se dispone de una sonda específica (M. parvicella y M. calida). Este es el primer estudio que se lleva a cabo en España en que se identifica M. calida en fangos activos. La abundancia de bacterias filamentosas en las 46 muestras de fango activo se midió de acuerdo con la escala subjetiva de Eikelboom, donde las observaciones se clasifican en una escala de 0 (ninguno) a 5 (crecimiento abundante). En todas las muestras se observaron bacterias filamentosas de los grupos objeto de estudio. Los valores para la sonda de Microthrix son máximos (IF=5) desde la primera muestra (del día 10/12/08) hasta la muestra del día 08/07/09, a partir de la cual disminuyen al tiempo en que empieza a detectarse el morfotipo 0581. En muchos casos, el resultado de la sonda general de Microthrix coincide con el de las sonda de M. parvicella, lo que indica que es este el morfotipo filamentoso más abundante dentro del género Microthrix. Siendo Microthrix calida la que resulta en abundancias menores, aunque está presente en la mitad de las muestras. Los resultados del análisis estadístico revelan un comportamiento diferente entre las especies dentro del género Microthrix y entre estas, y el Tipo 0581. Esta dinámica poblacional está influenciada sobre todo por la temperatura, el nivel de oxígeno disuelto, la carga de aceites y grasas, y de ácidos grasos volátiles. El Tipo 0581 presenta necesidades diferentes a las de la mayoría de bacterias del género Microthrix para los diferentes parámetros, esto explica el hecho de que sus máximas abundancias no coincidan en el mismo tiempo y espacio en la EDAR.
  4. 4. Trabajo Final de Máster Ingeniería Ambiental 4 LISTADO DE ACRÓNIMOS ACC Análisis de correspondencias canónicas ACP Análisis de componentes principales AG Aceites y Grasas AGV Ácidos Grasos Volátiles CM Carga Másica DBO Demanda Biológica de Oxígeno DNA Ácido desoxirribonucleico DQO Demanda Química de Oxígeno EDAR Estación Depuradora de Aguas Residuales EF Edad del Fango EPS Sustancias Poliméricas Extracelulares EPSAR Entidad Pública de Saneamiento de Aguas Residuales FISH Hibridación in situ con sondas fluorescentes he habitante equivalente IF índice de filamentos IVF Índice volumétrico de Fango LAO Organismo Acumulador de Lípidos LCFA Ácidos grasos de cadena larga OD Oxígeno Disuelto PAO Bacterias Acumuladoras de Polifosfato SSLM Sólidos Suspendidos del Licor Mezcla SSVLM Sólidos Suspendidos Volátiles del Licor Mezcla TRH tiempo de retención hidráulico
  5. 5. Trabajo Final de Máster Ingeniería Ambiental 5 ÍNDICE 1.- INTRODUCCIÓN..................................................................................................12 1.1.- Características de las aguas residuales.............................................................12 1.2.- Tratamiento de las aguas residuales.................................................................15 1.2.1.- Fangos activos ...........................................................................................15 1.2.2.- El flóculo ...................................................................................................16 1.2.3.- Problemas de separación en los fangos activos originados por microorganismos.................................................................................................17 1.3.- Parámetros operacionales del proceso de depuración ......................................18 1.4.- Importancia de las bacterias filamentosas ........................................................19 1.4.1.- Candidatus Microthrix parvicella................................................................19 1.4.2.- Candidatus Microthrix calida......................................................................22 1.4.3.- Tipo 0581...................................................................................................24 1.5.-Identificación de morfotipos filamentosos ........................................................25 1.5.1.- Microscopía convencional..........................................................................25 1.5.2.- Técnica FISH para la identificación de bacterias filamentosas....................27 2.- OBJETIVOS............................................................................................................29 3.- MATERIAL Y MÉTODOS......................................................................................30 3.1.- Descripción de la EDAR...................................................................................30 3.2.- Muestreo..........................................................................................................31 3.3.- Variables físico-químicas y parámetros operacionales......................................31 3.4.- Hibridación in situ con sondas marcadas con fluoróforos (FISH).....................32 3.4.1.- Preparación de reactivos para FISH...........................................................32 3.4.2.- Tratamiento de los portaobjetos cubiertos con Teflón ................................33 3.4.3.- Aplicación de las muestras a los portaobjetos ............................................34 3.5.- Sondas utilizadas.............................................................................................34 3.6.- Hibridación “in situ” .......................................................................................35 3.7.- Observación al microscopio .............................................................................36 3.8.- Técnicas de Análisis Estadístico para muestras ambientales ............................38 3.8.1.- Análisis bivariante.....................................................................................38 3.8.2.- Análisis Multivariante ...............................................................................40
  6. 6. Trabajo Final de Máster Ingeniería Ambiental 6 4.- RESULTADOS.......................................................................................................42 4.1.- Cuantificación e identificación de bacterias filamentosas del género Microthrix y Tipo 0581.................................................................................................................42 4.1.1.- Microscopía convencional..........................................................................42 4.1.2.- Técnica molecular FISH .............................................................................44 4.2.- Comparación microscopía convencional-FISH.................................................49 4.3.- Análisis estadístico entre las bacterias filamentosas del género Microthrix y el Tipo 0581 y los parámetros operacionales y físico-químicos....................................55 4.3.1.- Análisis Bivariante. Coeficiente de correlación de Spearman .....................56 4.3.2.- Análisis Multivariante. Análisis de correspondencias canónicas................64 5.- DISCUSIÓN...........................................................................................................76 5.1.- Técnica convencional versus FISH ...................................................................76 5.2.- Dinámica poblacional ......................................................................................77 5.3.- Variables del afluente ......................................................................................79 5.4.- Variables del licor mezcla ................................................................................80 5.5.- Variables operacionales ...................................................................................82 6.- CONCLUSIONES ..................................................................................................85 7.- BIBLIOGRAFIA .....................................................................................................86 ANEXO I. Relación de las fechas de muestreo. ...........................................................90 ANEXO II. Parámetros físico-químicos y variables de estudio....................................91 ANEXO III. Variables físico-químicas y operacionales utilizadas en el análisis estadístico...................................................................................................................93 ANEXO IV. Preparación de los reactivos para la técnica FISH ....................................95
  7. 7. Trabajo Final de Máster Ingeniería Ambiental 7 INDICE DE ECUACIONES Ecuación 1. Cálculo del coeficiente lineal de Pearson. .................................................38 Ecuación 2. Cálculo del coeficiente de correlación de Spearman. ................................39
  8. 8. Trabajo Final de Máster Ingeniería Ambiental 8 INDICE DE GRÁFICOS Gráfico 1. Volumen de Agua Depurada. EPSAR, 2012 ................................................13 Gráfico 2. Índice de Filamentosa de Microthrix en la linea A+B...................................49 Gráfico 3. Índice de filamentosa de Microthrix convencional y sonda general en la linea A+B.............................................................................................................................50 Gráfico 4.Índice de filamentosa de Microthrix en la linea C+D....................................51 Gráfico 5. Índice de filamentosa de Microthrix convencional y sonda general en la linea C+D ............................................................................................................................52 Gráfico 6.Índice de filamentosa de tipo 0581 en la línea A+B.......................................53 Gráfico 7.Índice de filamentosa de tipo 0581 en la línea C+D ......................................53 Gráfico 8. Comparativa de Microthrix frente al tipo 0581 en la línea A+B....................54 Gráfico 9.Comparativa de Microthrix frente al tipo 0581 en la línea C+D. ...................54 Gráfico 10. Análisis canónico de correspondencia para las bacterias filamentosas estudiadas y variables del afluente de la línea A+B de la EDAR Carraixet. .................65 Gráfico 11. Análisis canónico de correspondencia para las bacterias filamentosas estudiadas y variables del afluente de la línea C+D de la EDAR Carraixet. .................66 Gráfico 12. Análisis canónico de correspondencia para las bacterias filamentosas estudiadas y variables del afluente del conjunto de ambas líneas de la EDAR Carraixet. ...................................................................................................................................67 Gráfico 13.Gráfico de análisis canónico de correspondencia para las bacterias filamentosas estudiadas y variables del licor mezcla de la línea A+B de la EDAR Carraixet.....................................................................................................................68 Gráfico 14. Análisis canónico de correspondencia para las bacterias filamentosas estudiadas y variables del licor mezcla de la línea C+D de la EDAR Carraixet............69 Gráfico 15.Análisis canónico de correspondencia para las bacterias filamentosas estudiadas y variables del licor mezcla del conjunto de ambas líneas de la EDAR Carraixet.....................................................................................................................70 Gráfico 16.Análisis canónico de correspondencia para las bacterias filamentosas estudiadas y variables operacionales de la línea A+B de la EDAR Carraixet. ..............71 Gráfico 17.Análisis canónico de correspondencia para las bacterias filamentosas estudiadas y variables operacionales de la línea C+D de la EDAR Carraixet. ..............72 Gráfico 18.Análisis canónico de correspondencia para las bacterias filamentosas estudiadas y variables operacionales del conjunto de ambas líneas de la EDAR Carraixet.....................................................................................................................73
  9. 9. Trabajo Final de Máster Ingeniería Ambiental 9 INDICE DE ILUSTRACIONES Ilustración 1.hipótesis de utilización de LCFA por M.parvicella en plantas de fangos activos con alternancia de fases anaerobia-aerobia. Nielsen et al., 2002.........................22 Ilustración 2.Árbol filogenético del género Microthrix. Levantesi et al., 2006. ...............23 Ilustración 3. Línea de tratamiento de agua y fango de la EDAR del CARRAIXET. EPSAR........................................................................................................................30 Ilustración 4.Esquema simplificado del proceso de hibridación in situ con sondas marcadas con fluoróforos............................................................................................32 Ilustración 5. Pasos a realizar para la fijación de muestras según su pared celular. .....33 Ilustración 6. Índice de filamentosas ...........................................................................37 Ilustración 7.Matriz de covarianzas ACC....................................................................40 Ilustración 8: Imágenes con contraste de fases. A la izquierda Microthrix, a la derecha Tipo 0581. Aumento 1000x. Se observa la similitud morfológica entre ambas bacterias. ...................................................................................................................................43 Ilustración 9: Imágenes con contraste de fases de la reacción a la tinción Gram. A la izquierda Microthrix, gram positiva; a la derecha Tipo 0581, gram negativa. Aumento 1000x. Mediante la tinción Gram es posible diferenciar estas bacterias por microscopía convencional...............................................................................................................43 Ilustración 10.A la izquierda vista convencional y a la derecha FISH con la sonda GNSB941+CFX1223 del mismo campo de la muestra. En el caso de la imagen FISH sí puede apreciarse la presencia de los filamentos dentro del flóculo. Aumento: 1000x. .44 Ilustración 11.A la izquierda vista con contraste de fases y a la derecha vista FISH del mismo campo con la sonda MPAall-1410. Aumento: 1000x.........................................45 Ilustración 12.Árbol filogenético del phyllum Actinobacteria. Nielsen et al,2008.........45 Ilustración 13.árbol filogenético del phyllum Chloroflexi. Nielsen et al, 2008..............46
  10. 10. Trabajo Final de Máster Ingeniería Ambiental 10 INDICE DE TABLAS Tabla 1. Composición típica de A. Residual doméstica................................................12 Tabla 2. Concentraciones medias de entrada y de salida de las depuradoras y rendimientos medios de depuración obtenidos en la Comunidad Valenciana.........13 Tabla 3. Límite de vertido. MAGRAMA 2012. .............................................................14 Tabla 4.Límites adicionales de vertido en zonas sensibles. MAGRAMA, 2012. ............14 Tabla 5.Problemas típicos en los fangos activos causados por microorganismos. Fuente: Ferrer, J. y Seco, A., 2007. ...........................................................................................18 Tabla 6. Ventajas de la técnica FISH. ...........................................................................28 Tabla 7.Limitaciones de la técnica FISH. .....................................................................28 Tabla 8. Ficha técnica de la instalación. Fuente: EPSAR...............................................31 Tabla 9. Sondas utilizadas...........................................................................................35 Tabla 10. : Solución de hibridación según porcentaje de formamida. ..........................35 Tabla 11. Solución de lavado según porcentaje de formamida.....................................36 Tabla 12. Escala de valoración de organismos filamentosos. .......................................37 Tabla 13, Valores mínimos y máximos (rango), media y desviación estándar de la abundancia de las bacterias identificadas por microscopía convencional en la línea A+B de la EDAR Carraixet..................................................................................................42 Tabla 14. Valores mínimos y máximos (rango), media y desviación estándar de la abundancia de las bacterias identificadas por microscopía convencional en la línea C+D de la EDAR Carraixet..................................................................................................43 Tabla 15. Valores mínimos y máximos (rango), media y desviación estándar de abundancia de las bacterias identificadas por microscopía convencional en el conjunto de las dos líneas de agua de la EDAR Carraixet. .........................................................43 Tabla 16: Resultados de abundancia con las diferentes sondas FISH para las dos líneas de la EDAR Carraixet..................................................................................................47 Tabla 17. Valores mínimos y máximos (rango), media y desviación estándar de las sondas hibridadas en las muestras de la línea A+B en la EDAR Carraixet...................48 Tabla 18. Valores mínimos y máximos (rango), media y desviación estándar de las sondas en la EDAR Carraixet Línea C+D.....................................................................48 Tabla 19. Valores mínimos y máximos (rango), media y desviación estándar de las sondas en el conjunto de las dos líneas de agua de la EDAR Carraixet........................49 Tabla 20. Correlaciones Spearman entre las bacterias filamentosas estudiadas y los parámetros físico-químicos del afluente......................................................................57 Tabla 21.Correlaciones Spearman entre las bacterias filamentosas estudiadas y los parámetros físico-químicos del licor mezcla................................................................59 Tabla 22.Correlaciones Spearman entre las bacterias filamentosas estudiadas y los parámetros operacionales. ..........................................................................................61 Tabla 23.Relación de muestras estudiadas ..................................................................90 Tabla 24. Listado de los parámetros físico-químicos del afluente. ...............................91
  11. 11. Trabajo Final de Máster Ingeniería Ambiental 11 Tabla 25.Listado de los parámetros físico-químicos del licor mezcla. ..........................92 Tabla 26.Listado de los parámetros operacionales.......................................................92 Tabla 27. Media, desviación estándar (SD) y rango (mínimo-máximo) de los parámetros físico-químicos del afluente......................................................................93 Tabla 28. Media, desviación estándar (SD) y rango (mínimo-máximo) de los parámetros físico-químicos del licor mezcla................................................................93 Tabla 29. Media, desviación estándar (SD) y rango (mínimo-máximo) de los parámetros operacionales. ..........................................................................................94
  12. 12. Trabajo Final de Máster Ingeniería Ambiental 12 1.- INTRODUCCIÓN 1.1.- Características de las aguas residuales El agua es un recurso fundamental en el desarrollo de la vida, por lo que la conservación de su calidad debe de constituir uno de los principales objetivos de esta sociedad. Por ello, tras su utilización, tanto en los hogares como en las industrias, ha de someterse a un proceso de depuración que le devuelva la calidad necesaria para poder volver al medio natural sin perjudicarlo. Para llevar a cabo el proceso de depuración del agua se dispone de una completa infraestructura con una red de alcantarillado y colectores a través de los cuales el agua es conducida a las Estaciones Depuradoras de Aguas Residuales (EDAR), donde se les aplica el correspondiente tratamiento. Las principales características de las aguas residuales domésticas son: Tabla 1. Composición típica de A. Residual doméstica. Concentración (mg/l) Fuerte Media Débil Sólidos totales 1200 720 350 Sólidos disueltos totales 850 500 250 Fijos 525 300 145 Volátiles 325 200 105 Sólidos Suspendidos totales 350 220 100 Fijos 75 55 20 Volátiles 275 165 80 Sólidos Sedimentables (ml/l) 20 10 5 Demanda Bioquímica de Oxígeno, 5 días 20ºC (DBO5, 20º) 400 220 110 Carbono Orgánico Total (CCT) 290 160 80 D.Q.O. (Demanda Química de Oxígeno) 1000 500 250 Nitrógeno total como N2 85 40 20 Nitrógeno Orgánico 35 15 8 Amoniaco Libre 50 25 12 Nitritos 0 0 0 Nitratos 0 0 0 Fósforo (total como P) 15 8 4 Orgánico 5 3 1 Inorgánico 10 5 3 Cloruros 100 50 30 Alcalinidad (como CaCO3) 200 100 50 Aceites y grasas 150 100 50 Fuente: Metcalf and Eddy,2000.
  13. 13. Trabajo Final de Máster Situación en la Comunidad Valenciana A partir del informe de gestión de la EPSAR (Entidad Pública de Saneamiento de Aguas Residuales) del año 2012 se extrae la información relativa al tratamiento de aguas residuales en la Comunidad Valenciana: en la actualidad se encuentran en funcionamiento un total de 458 EDAR, tratando un volumen total de 450,16 hm agua, que corresponde a 6.126.617 habitantes equivalentes (he). El coste por metro cúbico de agua tratada es de 0.33 euros. A continuación se muestra una gráfica con la evolución del volumen de agua tratada en los últimos 19 años: Gráfico Como puede observarse ha tenido lugar un incremento en la cantidad de agua tratada, aunque no de forma regular, en estos 19 años. Aunque en los últimos años se observa una disminución en la el actual contexto de crisis económica en que ha disminuido el número de industrias y, por lo tanto, el volumen de aguas residuales generadas por las mismas, afectando al total global. En la siguiente tabla se muestran los valores medios de la concentración de algunos parámetros así como de los rendimientos de depuración: Tabla 2. Concentraciones medias de entrada y de salida de las depuradoras y rendimientos medios de depuración obtenidos en la Comunidad Valenciana Parámetro SS Entrada (mg/l) 260 Salida (mg/l) 8 Rendimiento (%) 96 (1)Valor límite establecido en la Directiva del Consejo 91/271 CEE. 0 100 200 300 400 500 600 1993 1994 1995 1996 hm3/año Volumen de agua depurada Ingeniería Ambiental Situación en la Comunidad Valenciana A partir del informe de gestión de la EPSAR (Entidad Pública de Saneamiento de Aguas Residuales) del año 2012 se extrae la información relativa al tratamiento de en la Comunidad Valenciana: en la actualidad se encuentran en funcionamiento un total de 458 EDAR, tratando un volumen total de 450,16 hm agua, que corresponde a 6.126.617 habitantes equivalentes (he). El coste por metro cúbico de agua tratada es de 0.33 euros. A continuación se muestra una gráfica con la evolución del volumen de agua tratada en los últimos 19 años: Gráfico 1. Volumen de Agua Depurada. EPSAR, 2012 Como puede observarse ha tenido lugar un incremento en la cantidad de agua tratada, aunque no de forma regular, en estos 19 años. Aunque en los últimos años se observa una disminución en la cantidad de agua depurada, que puede relacionarse con el actual contexto de crisis económica en que ha disminuido el número de industrias y, por lo tanto, el volumen de aguas residuales generadas por las mismas, afectando al tabla se muestran los valores medios de la concentración de algunos parámetros así como de los rendimientos de depuración: . Concentraciones medias de entrada y de salida de las depuradoras y rendimientos medios de depuración obtenidos en la Comunidad Valenciana. Límite SS(1) DBO5(1) Límite DBO5(1) DQO 300 572 ≤35 8 ≤25 33 ≥90 97 ≥70 93 (1)Valor límite establecido en la Directiva del Consejo 91/271 CEE. EPSAR 2012. 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 Año Volumen de agua depurada Ingeniería Ambiental 13 A partir del informe de gestión de la EPSAR (Entidad Pública de Saneamiento de Aguas Residuales) del año 2012 se extrae la información relativa al tratamiento de en la Comunidad Valenciana: en la actualidad se encuentran en funcionamiento un total de 458 EDAR, tratando un volumen total de 450,16 hm3 de agua, que corresponde a 6.126.617 habitantes equivalentes (he). El coste por metro cúbico de agua tratada es de 0.33 euros. A continuación se muestra una gráfica con la Como puede observarse ha tenido lugar un incremento en la cantidad de agua tratada, aunque no de forma regular, en estos 19 años. Aunque en los últimos años se cantidad de agua depurada, que puede relacionarse con el actual contexto de crisis económica en que ha disminuido el número de industrias y, por lo tanto, el volumen de aguas residuales generadas por las mismas, afectando al tabla se muestran los valores medios de la concentración de . Concentraciones medias de entrada y de salida de las depuradoras y rendimientos medios de Límite DQO ≤125 ≥75 EPSAR 2012. 2009 2010 2011 2012
  14. 14. Trabajo Final de Máster Ingeniería Ambiental 14 Legislación relativa a las aguas residuales La legislación que hace referencia a las aguas residuales y a su tratamiento es: Directiva 91/271/CEE cuyo objetivo es proteger el medio ambiente de los efectos negativos de los vertidos de las aguas residuales urbanas y procedentes de algunos sectores industriales. Fue modificada por la Directiva 98/15/CE, en la que se establece la obligación de disponer de sistemas colectores y tratar las aguas residuales, así como los límites de vertido de los contaminantes procedentes de EDAR. Además, indica los plazos para construir depuradoras y los tamaños de las poblaciones que deben de contar con una. Asimismo establece mecanismos y frecuencias de muestreo y análisis de las aguas residuales, basando el control en los siguientes parámetros: sólidos en suspensión, DBO5, DQO, fósforo y nitrógeno. Directiva 2000/60/EC del Parlamento Europeo, cuyo objetivo es proteger el estado ecológico de las masas de agua continentales, aguas de transición, aguas costeras y aguas subterráneas. La Directiva 91/271/CEE fue transpuesta al ordenamiento español a través del Real Decreto Ley 11/1995 de 20 de Diciembre, en el se definen los criterios para la clasificación de los puntos de vertido en “zona sensible” y “zona menos sensible” de los cuales dependen los requisitos de vertido. Este Real Decreto fue desarrollado por el Real Decreto 509/1996, modificado por el Real Decreto 2116/1998, en el que se desarrolla la normativa aplicable para el control de las aguas residuales urbanas en España. En las siguientes tablas se recogen los requisitos de vertido mencionados anteriormente: Tabla 3. Límite de vertido. MAGRAMA 2012. Tabla 4.Límites adicionales de vertido en zonas sensibles. MAGRAMA, 2012. Concentración Porcentajes de Reducción DBO5 25 mg/l de O2 70-90 % DQO 125 mg/l de O2 75 % Sólidos en suspensión 35 mg/l 90 % Concentración Porcentajes de Reducción h-e<100.000 P total 2 mg/l 80 % N Total 15 mg/l 70-80 % h-e>100.000 P Total 1 mg/l 80 % N Total 10 mg/l 70-80 %
  15. 15. Trabajo Final de Máster Ingeniería Ambiental 15 1.2.- Tratamiento de las aguas residuales Una EDAR se encuentra habitualmente compuesta por las siguientes etapas de tratamiento en serie (Bouzas, 2010): Pretratamiento: separación de materiales voluminosos (mediante enrejados y tamices), de arenas (mediante un desarenador) y de aceites y grasas (mediante una trampa de grasas). Se eliminan los materiales que pueden perjudicar instalaciones posteriores (por ejemplo: obstruyendo bombas, etc.). Tratamiento primario: eliminación de materia en suspensión y de los contaminantes asociados. Tratamiento secundario o biológico: eliminación de materia orgánica biodegradable por la acción de la biomasa presente. Tratamientos avanzados o terciarios: eliminación de patógenos así como de parte de los contaminantes que no se hayan eliminado en etapas anteriores (materia orgánica, sólidos suspendidos, nitrógeno y fósforo). 1.2.1.- Fangos activos Existen diferentes tipos de tratamientos para las aguas residuales, la elección de uno u otro está en función, sobre todo, de las características del agua y de la exigencia de calidad del efluente. El tipo de tratamiento más utilizado es el de fangos activos, desarrollado en 1913-1914 en Inglaterra por Mr. Edward Ardern y Mr. William Lockett. Se trata de un tratamiento biológico de cultivo en suspensión donde una masa activa de microorganismos se encarga de estabilizar un residuo orgánico por vía aerobia (García, 1996). Con la siguiente reacción se representa el mecanismo de depuración en este tipo de sistemas: Materia orgánica + Microorganismos + O2 → Microorganismos + CO2 + H2O + Energía Las etapas del tratamiento biológico son: oxidación biológica (en el reactor biológico con aireación mecánica), separación (habitualmente por gravedad en un decantador) y recirculación de parte de los lodos al reactor biológico para conseguir el tiempo de retención celular necesario, asegurando la efectividad del tratamiento. Este tratamiento supone el desarrollo de un cultivo microbiológico capaz de degradar y flocular la materia orgánica presente en el agua residual (González, et al., 2006).
  16. 16. Trabajo Final de Máster Ingeniería Ambiental 16 1.2.2.- El flóculo El flóculo es la unidad ecológica y estructural de los fangos activos. Se encuentra formado por una población heterogénea de microorganismos, que cambia continuamente con el tiempo como respuesta a la variación de la composición del agua residual y a las condiciones ambientales y operacionales (Soddell y Seviour, 1990). Para que el proceso de depuración sea llevado a cabo con éxito, en el tanque de aireación o reactor biológico debe formarse un flóculo con el tamaño suficiente para soportar las turbulencias del agua del sistema de agitación y sedimentar posteriormente en el decantador secundario, para obtener un sobrenadante fluido y claro. Los microorganismos del flóculo se mantienen unidos gracias a una matriz extracelular de naturaleza variable, que contiene material polisacárido, altos niveles de proteínas, DNA y sustancias húmicas y fúlmicas (Kerley y Foster, 1995; Frölund et al.; 1995). Estos polímeros extracelulares (EPS) son segregados por las denominadas bacterias formadoras de flóculos. Estos agregados están formados por microorganismos (bacterias, hongos, protozoos y algún metazoo), materia inorgánica y orgánica (≈ 60-90% de la misma es volátil) y pueden alcanzar tamaños de entre 0,05 y 1,0 mm. Además de bacterias formadoras de flóculos, también se encuentran bacterias filamentosas que, aunque no contribuyen a la formación del flóculo, en pequeñas proporciones dan fuerza a su estructura para evitar su disgregación. Las bacterias filamentosas actúan como un entramado que da consistencia al flóculo de manera que se pueden formar flóculos grandes y compactos que resisten la turbulencia del sistema de agitación. La presencia moderada de filamentos también ayuda a capturar y mantener atrapadas pequeñas partículas durante la sedimentación. A continuación se citan los microorganismos que forman la estructura del flóculo: Las bacterias, que comprenden el 95% de la biomasa. Principalmente intervienen en la eliminación de materia orgánica y en la eliminación de nutrientes. Además, tanto las bacterias formadoras de flóculo como las filamentosas son imprescindibles para la correcta sedimentación del fango y la consecuente obtención de un efluente clarificado y de calidad. El segundo grupo más numeroso son los protozoos, constituyendo el 5% de la biomasa. Son necesarios en los fangos activos ya que eliminan coliformes y patógenos, además de otras bacterias, ayudando a clarificar el efluente y contribuyen a la floculación de la biomasa (Ferrer y Seco, 2007).
  17. 17. Trabajo Final de Máster Ingeniería Ambiental 17 Además podemos encontrar, aunque en raras ocasiones, hongos que pueden proliferar, pero que no suelen competir con las bacterias por la utilización de materia orgánica disuelta, por tanto no se consideran relevantes para el proceso de depuración. Las algas son organismos fotosintéticos y el papel que pueden jugar en los sistemas de depuración es el de proporcionar oxígeno en los sistemas extensivos. Pero hay que tener en cuenta que, al tratarse de organismos autótrofos no consumen materia orgánica, si no que incrementan su contenido (Ferrer y Seco, 2007). El último grupo son los metazoos, como los rotíferos, que junto con los nematodos, constituyen la cima de la cadena trófica en el sistema de fangos activos. Elevadas cantidades de rotíferos en el sistema indican una alta edad del fango. Existen dos niveles de estructura en los flóculos del fango activo (Sezgin et al., 1978): Microestructura: la confieren procesos de agregación microbiana y biofloculación. Esta es la base de la formación del flóculo. Macroestructura: la proporcionan microorganismos filamentosos. Estos organismos forman una red o espina dorsal sobre la que se fijan los flóculos dando lugar a flóculos más grandes y resistentes. Cuando las bacterias formadoras del flóculo y las filamentosas crecen en equilibrio se forma el flóculo ideal, que es compacto, denso, grande y sedimenta bien, permitiendo obtener un sobrenadante claro y un fango concentrado. En cambio, si se produce un crecimiento masivo de filamentosas se impide el acercamiento de los flóculos, dificultando su compactación y sedimentación, esto se conoce como hinchazón de fangos o “Bulking”. Si, por el contrario, la proporción de filamentosas es demasiado baja los flóculos son pequeños y débiles por lo que no sedimentan bien, dando lugar a un sobrenadante turbio, esta situación se denomina “flóculo punta de alfiler”, en el siguiente apartado se explican los diferentes problemas que pueden darse cuando no se produce ese equilibrio en el crecimiento de las bacterias. 1.2.3.- Problemas de separación en los fangos activos originados por microorganismos En la mayoría de EDAR se produce la separación de los sólidos del agua tratada mediante sedimentación en un decantador. Este proceso puede presentar importantes problemas, comprometiendo la calidad del efluente, y se deben principalmente a fallos en la formación de la microestructura o de la macroestructura del flóculo. En la siguiente tabla se describen los diferentes problemas que se pueden dar:
  18. 18. Trabajo Final de Máster Ingeniería Ambiental 18 Tabla 5.Problemas típicos en los fangos activos causados por microorganismos. Fuente: Ferrer, J. y Seco, A., 2007. Crecimiento disperso No se produce la biofloculación, por lo que los microorganismos quedan dispersos, dando lugar a un efluente turbio. “Bulking” viscoso Fallo en la microestructura por un exceso de polímeros extracelulares. Los microorganismos aparecen entre grandes cantidades de materia extracelular, lo que confiere al fango activo una consistencia gelatinosa, produciéndose problemas de compactación y sedimentación. Flóculo punta de alfiler Fallo en la macroestructura por ausencia o baja proporción de microorganismos filamentosos. Los flóculos son frágiles produciéndose ruptura de los mismos, por lo que no sedimentan y salen con el efluente. “Bulking” filamentoso Fallo en la macroestructura por un exceso de microorganismos filamentosos impidiendo la compactación y sedimentación de los flóculos. “Foaming” o formación de espumas Normalmente asociado a bacterias filamentosas, como Nocardia spp y Microthrix parvicella. La hidrofobicidad de estos microorganismos hace que grandes cantidades de sólidos del fango activo floten formando espuma en la superficie de los elementos del tratamiento, pudiendo salir con el efluente. 1.3.- Parámetros operacionales del proceso de depuración Los parámetros más utilizados para el control de las depuradoras de aguas residuales son la carga másica (CM) y la edad del fango (EF) (Zornoza et al., 2011). La carga másica es un parámetro con el que se representa la relación existente entre la carga orgánica alimentada al reactor y los microorganismos presentes en él. Dada la dificultad de cuantificar los microorganismos presentes, suele definirse como la relación entre la DBO5 y los sólidos suspendidos volátiles del licor mezcla diarios en el reactor, o incluso puede definirse relacionando dicha DBO5 con los sólidos suspendidos totales del licor mezcla, por ello es muy importante al hablar de carga másica establecer a qué concentración de sólidos está referida (Ferrer y Seco, 2007). La edad del fango relaciona la masa de fango en el reactor con la masa de fangos eliminada diariamente, por lo que depende principalmente del régimen de purgas. Para la determinación de ambos parámetros es necesario tener en cuenta la inercia del sistema de fangos activos, es decir, la inercia de las poblaciones microbianas y la estructura flocular. Ambos parámetros han estado relacionados de forma proporcional e inversa, pero recientemente se ha demostrado que esta relación no siempre tiene lugar en una EDAR a escala real (Zornoza et al., 2011).
  19. 19. Trabajo Final de Máster Ingeniería Ambiental 19 1.4.- Importancia de las bacterias filamentosas En todos los tipos de EDAR con procesos de fangos activos están presentes las bacterias filamentosas y se ha demostrado que son responsables de la mayoría de problemas de bulking y foaming (Jenkins et al., 2003; Seviour y Nielsen, 2010). La excesiva abundancia de estas bacterias puede producir problemas en la operación de la planta y actualmente no existe una estrategia universal que permita limitar o prevenir este comportamiento (Eikelboom, 2000; Jenkins et al., 2003; Kragelund et al., 2010). Se han identificado más de 30 morfotipos filamentosos en EDAR de aguas residuales urbanas (EIkelboom, 2000). En plantas que reciben agua de origen industrial este número es todavía mayor (Eikelboom y Geurkink, 2002; Eikelboom, 2006). Las bacterias filamentosas están involucradas en la degradación de la materia orgánica, son por tanto un miembro más de la comunidad biológica de los fangos activos. Las bacterias filamentosas que con más frecuencia generan problemas de bulking son Alphaproteobacteria (“Nostocoida”-like), Gammaproteobacteria (Thiothrix y Tipo 021N), Actinobacteria (Candidatus “Microthrix”, Mycolata) y Chloroflexi (Tipo 1851, Tipo 0041 y Tipo 0092) (Nielsen et al., 2008). Además, M. parvicella y Nocardia son los tipos de filamentosas que más comúnmente producen fenómenos de foaming, junto con otros tipos de filamentosas como son Nostocoida Limicola II, III, Tipo 021N, Tipo 0092, Tipo 0041/0675, Tipo 0581 y Tipo 0803 (Aygun, et al., 2013). A continuación se describen los microorganismos filamentosos objeto de este estudio: Candidatus Microthrix parvicella, Candidatus Microthrix calida y Tipo 0581. 1.4.1.- Candidatus Microthrix parvicella Microthrix parvicella es un filamento muy común en los fangos activos, estando presente en diferentes condiciones de operación y en distintas configuraciones de la planta. Son muchos los estudios que han demostrado que este organismo se relaciona frecuentemente con los problemas de bulking y foaming (Jenkins et al., 2003; Wanner et al., 1994; Martins et al., 2003). Pasveer (1969) fue el primer investigador en describirlo. Esta bacteria solamente se ha detectado en fangos activos, ya que otras bacterias similares a Microthrix parvicella presentes en ambientes como sedimentos marinos, suelos y ambientes marinos presentan menos de un 92% de similitud en la secuencia 16S rRNA, por lo que solo están lejanamente relacionadas con Microthrix (Rossetti et al., 2005).
  20. 20. Trabajo Final de Máster Ingeniería Ambiental 20 Morfología Se trata de un filamento largo (longitud 100-400 µm), fino (diámetro 0,6-0,8 µm), no ramificado y sin vaina, ni septos visibles, que no presenta movimiento. No suele tener crecimiento adherido y puede encontrarse libre en la fase líquida, dentro de los flóculos o alrededor de los mismos, aunque normalmente está dentro del flóculo. Su apariencia enrollada y su reacción Gram positiva hacen que sea fácil de reconocer mediante microscopio. Además, presenta filamentos con gránulos que tienen una reacción gránulo-Neisser fuertemente positiva (Zornoza et al., 2006). A pesar de ello, hay que tener en cuenta que la morfología de esta bacteria varía en función de los sustratos utilizados (Zonronza et al., 2006). Este polimorfismo está muchas veces relacionado con la capacidad de adaptación de la especie (Margalef, 1998) y hace que puedan existir variantes de esta bacteria que en realidad sean la misma especie, definidas por Eikelboom como “distintos ecotipos”. Taxonomía Debido a la falta de una caracterización fenotípica detallada, M. parvicella no es un nombre taxonómicamente válido. Por lo que desde un punto de vista taxónomica se describe como Candidatus M. parvicella, aunque se suele emplear M. parvicella porque es el nombre que se utiliza en la industria del tratamiento del agua para referirse a este microorganismo (Rossetti et al., 2005). Se ha conseguido aislar en cultivos puros en muy pocas ocasiones (Van Veen, 1973; Eikelboom, 1975; Slijkhuis, 1983; Blackall et al., 1994; Tandoi et al., 1998). El análisis filogenético de algunos de ellos muestra que Candidatus M. parvicella se asocia a un miembro de una profunda ramificación de la clase Actinobacteria dentro del phylum de Actinobacteria. Características de crecimiento La velocidad de crecimiento de M.parvicella es de entre 0,3-1,4 d-1, por lo que se necesitan elevados tiempos de retención celular para su supervivencia en la EDAR. Es por ello que para disminuir su presencia es importante evitar la recirculación de las espumas en el sistema (Rossetti et al., 2005). Se ha comprobado que la fuente preferente de nitrógeno para estas bacterias es el amonio (Tsai et al., 2003). Por otra parte, la concentración de oxígeno disuelto afecta de forma importante al crecimiento de M. parvicella. Se trata de un organismo microaerófilo que prolifera en EDAR convencionales con bajas concentraciones de oxígeno disuelto (OD), espaciales o temporales, y en plantas con eliminación de nutrientes, operando con zonas anóxicas y aerobias. De hecho, se demostró que la continua aireación de los fangos activos elimina M. parvicella cuando se alcanzan
  21. 21. Trabajo Final de Máster Ingeniería Ambiental 21 concentraciones de OD de 2-3 mg/l (Ekama et al., 1996), pudiendo ser tóxicas para estas bacterias concentraciones de OD mayores a 6 mg/l (Slijkhuis, 1983). Esta bacteria presenta un crecimiento mayor a bajas temperaturas, de hecho se elimina a 29ºC (Rossetti et al., 2005). Por ello, es más frecuente su presencia en invierno y primavera que en verano y otoño (Kruit et al., 2002). Los rangos de carga másica en los que es más frecuente encontrar este morfotipo son 0,2-0,05 kg DBO/kgSSVLMd (Jenkins et al., 2003). Algunos estudios muestran que los filamentos de M. parvicella son más hidrofóbicos que los de la mayoría de las demás bacterias del fango activo (Nielsen et al., 2002). Una superficie hidrofóbica puede atraer lípidos, ácidos grasos de cadena larga (LCFA) y otras sustancias no polares, lo que resulta ventajoso cuando se compite por este tipo de sustrato (Rossetti et al., 2005). Esta bacteria posee actividad lipasa en su superficie celular (Nielsen et al., 2002), lo que permite mejorar su habilidad para tomar productos de lisis y LCFA de los lípidos asociados con la superficie celular. Es capaz de usar LCFA y sus esteres como fuente de carbono y de energía y el exceso de carbono se almacena como gránulos de lípido. Sin embargo, no utiliza ácidos orgánicos o azúcares para su crecimiento (Martins, 2003). Por otra parte, no pueden tomar fósforo en condiciones aerobias, lo que excluye esta bacterias del grupo de las PAO (Wagner et al., 2002). Su versatilidad metabólica favorece su proliferación en los sistemas de fangos activos (Rossetti et al. ,2005). Es importante destacar que M. parvicella es el primer organismo presente en los fangos activos que tiene la habilidad fisiológica de acumular lípidos, por lo que puede ser descrita como un organismo acumulador de lípidos (LAO) (Nielsen et al., 2002). En la figura 1 se muestra un esquema con la hipótesis de utilización de LCFA por M.parvicella en plantas de fangos activos con alternancia de fases anaerobia-aerobia. Esta bacteria toma los LCFA tanto en condiciones aerobias como anaerobias, empleando el material almacenado para crecer cuando el nitrato o el oxígeno están disponibles como aceptores de electrones (Andreasen and Nielsen 1997; Rossetti et al., 2005; Nielsen 2008). Esto representa una ventaja competitiva para Microthrix parvicella respecto a las formadoras de flóculo, que sólo pueden tomar los LCFA en condiciones aerobias.
  22. 22. Trabajo Final de Máster Ingeniería Ambiental 22 Ilustración 1.hipótesis de utilización de LCFA por M.parvicella en plantas de fangos activos con alternancia de fases anaerobia-aerobia. Nielsen et al., 2002. 1.4.2.- Candidatus Microthrix calida Hace relativamente poco tiempo, se aisló Candidatus Microthrix calida, procedente de un fango activo industrial (Levantesi et al., 2006). Morfología La morfología de esta bacteria es muy similar a la de M. parvicella, tratándose de filamentos enrollados no ramificados y muchas veces enmarañados. La longitud de los filamentos es variable, los septos no son visibles y no presenta movilidad ni vaina. El diámetro de la célula suele estar comprendido entre 0,3-0,7µm (Levantesi et al., 2006) y normalmente no muestra un crecimiento adherido significante. Puede encontrarse libre en la fase líquida, dentro de los flóculos o alrededor de los mismos, aunque su ubicación más habitual es dentro del flóculo. Son Gram positivas, aunque con una reacción más débil que M. parvicella (Levantesi et al., 2006) presentando una respuesta negativa o ligeramente positiva (cuando contienen pequeños gránulos de polifosfato) a la tinción Neisser. Taxonomía Se encuentra dentro de las Actinobacteria, aunque tres de sus cepas se han asociado con el género Acidimicrobium (Nielsen et al., 2008). Y, tal y como ocurre con M. parvicella, no existe una caracterización fenotípica detallada, por lo que se nombra como Candidatus Microthrix calida. El análisis de la secuencia 16S rRNA revela un máximo de similitud del 96.7% entre M. parvicella y M. calida (Nielsen et al., 2008) y, según Stackebrandt y Goebel
  23. 23. Trabajo Final de Máster Ingeniería Ambiental 23 (1994), una identidad de secuencia por debajo del 97% indica que se trata de especies distintas. Características de crecimiento Crece a una temperatura superior a M. parvicella, presentando un crecimiento adecuado entre los 15-36,5ºC y a un pH superior o igual a 7.8. No se desarrolla en los medios de cultivo utilizados normalmente para M. parvicella (Levantesi et al., 2006). Algunas de las propiedades cinéticas y metabólicas son comunes para ambas especies (M. calida y M. parvicella): velocidad de crecimiento lenta, utilización de LCFA y elevada capacidad de almacenamiento. La principal diferencia es, como se ha comentado anteriormente, el rango de temperatura para su crecimiento, lo que explica su diferente distribución (Levantesi et al., 2006). Algunos estudios sugieren que Candidatus Microthrix calida no es muy común y que probablemente no provoca problemas de bulking. La falta de información es debida a que, al contrario que ocurre con M.parvicella, no hay estudios in situ con esta bacteria que muestren su ecofisiología. A continuación, se muestra el árbol filogenético del género Microthrix, basado en análisis comparativos de las secuencias del gen 16S rRNA. Ilustración 2.Árbol filogenético del género Microthrix. Levantesi et al., 2006. Actualmente se dispone de sondas FISH para todas las especies conocidas de Microthrix (Levantesi et al., 2006). Al principio, solamente estaba disponible la sonda MPA645 para M. parvicella (Erhart et al., 1997), pero al descubrirse la presencia de
  24. 24. Trabajo Final de Máster Ingeniería Ambiental 24 filamentos similares a M. parvicella en fangos industriales que muchas veces no hibridaban con dicha sonda, se desarrollaron dos sondas más: MPAall-1410, que es una prueba más general de Microthrix y MPA-T1-1260, especifica para Candidatus Microthrix calida. Además, se desarrollaron también las sondas MPA60, MPA223 que, junto con la MPA645, son sondas altamente específicas para los filamentos identificados morfológicamente como M. parvicella en los fangos activos, mientras que otra sonda, la MPA650 necesita utilizarse junto a dos sondas competidoras para alcanzar la especificidad adecuada. 1.4.3.- Tipo 0581 El tipo 0581 se encuentra entre las bacterias filamentosas responsables de problemas de bulking y foaming cuya filogenia y ecología se desconocen, aún a pesar de tratarse de un microorganismo frecuente en los fangos activos. Morfología Se ha demostrado que el morfotipo 0581 está relacionado con los fenómenos de foaming (Soddell, 1999) y bulking (Blackall, 1999) en las EDAR con fangos activos. De hecho, según Lemmer et al. (2004) es la filamentosa dominante en el 10% de las EDAR con problemas de espumas en Alemania. Presenta una gran similitud morfológica con Microthrix parvicella, por lo que mediante microscopia convencional solamente es posible diferenciarlas por su distinta respuesta a las tinciones: este morfotipo es Gram negativo, a diferencia de Microthrix parvicella, Gram positiva y, respecto a la tinción Neisser, es débilmente positiva para el tipo 0581 y positiva para M .parvicella (Araújo dos Santos et al., 2011; Zornoza et al., 2006). Sin embargo, según Rossetti et at. (2005) se podrían generar cambios en la superficie celular de algunas bacterias filamentosas frente a vertidos químicos, dando lugar a reacciones anómalas a las tinciones, lo que se traduce en una mayor dificultad a la hora de diferenciar estos morfotipos visualmente idénticos. Por lo que, en estos casos, la determinación filogenética es clave para diferenciar ambos morfotipos (Zornoza et al., 2006). Se trata de un filamento fino (0,5-0,8 µm) curvado y enrollado, con una longitud de entre 100 y 200 µm. Puede situarse dentro del flóculo o libre en el espacio interflocular. Tal y como ocurre con M. parvicella, no presenta septos visibles, ni vaina, ni crecimiento adherido y carece también de movilidad (Jenkins et al., 2003). Esta gran similitud con M. parvicella hace plantearse la hipótesis de si el Tipo 0581 ha pasado desapercibido hasta ahora por haber sido confundido con Microhtrix (Zornoza et al., 2006).
  25. 25. Trabajo Final de Máster Ingeniería Ambiental 25 Taxonomía Se ha identificado el morfotipo 0581 dentro del phylum Chloroflexi (Zornoza et al., 2006) y, a pesar de presentar unas características morfológicas similares a M. parvicella, el morfotipo 0581 no está relacionado con los Actinomicetos (que son los clásicos formadores de foaming), incluidos en el phylum Actinobacteria (Alonso et al., 2009). En estudios más recientes se ha encontrado que algunos morfotipos 0581 presentan una señal positiva al hibridar con sondas (Mix LGC (LGC354A+LGC354B+LGC354C)) del phylum Firmicutes, indicando que pueden existir, al menos, dos tipos diferentes de la Tipo 0581 (Araújo dos Santos et al., 2011). Sin embargo, esto difiere de los resultados obtenidos con el estudio llevado a cabo por Zornoza et al. (2006), donde el morfotipo 0581 no hibridó con las siguientes sondas que se utilizan para caracterizar bacterias a nivel de phylum: Firmicutes, Proteobacteria, Actinobacteria, , Planctomycetes, Verrumicrobia, Bacteoidetes y TM7, en cambio, sí hibridó con las sondas del phylum Chloroflexi (Zonronza et al., 2006). Por lo tanto, todavía no está bien definida la clasificación de la Tipo 0581. Además las bacterias que pertenecen al phylum Firmicutes son Gram positivas y los filamentos del Tipo 0581 son Gram negativos. Actualmente no se dispone de ninguna sonda específica para la Tipo 0581, por lo que los estudios con la técnica FISH de este morfotipo se están haciendo con hibridación a nivel de phylum. Características de crecimiento Dado que la bibliografía respecto a este filamento es escasa, no se tiene apenas información sobre su metabolismo ni condiciones favorables para su crecimiento. Lo que sí se ha podido comprobar es que el rango de carga másica en el que es más frecuente encontrar este morfotipo es entre 0,1-0,05 kg DBO/kgSSVLMd (Jenkins et al., 2003) y se encuentran en condiciones de alternancia de oxígeno. Estas características coinciden con las del morfotipo M. parvicella, por lo que cabe esperar que compitan por el mismo nicho ecológico (Zornoza et al., 2006). 1.5.-Identificación de morfotipos filamentosos La detección de los microorganismos filamentos presentes en el sistema de fangos activos es importante para la identificación de los problemas que pueda haber y para encontrar posibles soluciones. 1.5.1.- Microscopía convencional Los métodos clásicos se basan en la observación microscópica de las muestras para determinar las características morfológicas, así como en el uso de tinciones que ponen de manifiesto algunas de las características diferenciales de los
  26. 26. Trabajo Final de Máster Ingeniería Ambiental 26 microorganismos. Eikelboom (1975), estableció una nomenclatura basada en la observación microscópica de las características morfológicas, que actualizaron posteriormente otros autores (Jenkins et al., 2004). Los caracteres morfológicos en los que se basa la clasificación de Eikelboom (1975), y de Jenkins et al., (2004) son: presencia o ausencia de ramificaciones, movilidad, forma del filamento (curvo, irregular, enrollado, etc.), ubicación respecto al flóculo, existencia de crecimiento epifítico, vaina, septos, constricciones celulares, dimensiones celulares, dimensiones del filamento, forma celular (cuadrada, rectangular, ovalada, etc.), presencia de biopolímeros de azufre y gránulos de polifosfato, reacciones de tinción (Gram y Neisser) y formación de rosetas y gonidios. Los métodos convencionales son de gran ayuda para la observación de microorganismos en plantas de tratamiento de aguas residuales. Sin embargo, no dan información fiable sobre la identidad exacta de los filamentos observados, por este motivo, los filamentos son designados con los términos “tipo” o “morfotipo” en vez de especie. Hoy en día se sabe que un morfotipo específico puede incluir varias especies y también puede ocurrir lo contrario, que varios morfotipos puedan representar una sola especie. La identificación y cuantificación mediante las técnicas convencionales presenta algunas dificultades: El método convencional es subjetivo y depende del nivel de entrenamiento y de la experiencia del que realiza la cuantificación e identificación. Una misma especie puede mostrar polimorfismos o diferentes especies parecer iguales. Los filamentos que se encuentran en el interior de los flóculos son difíciles de identificar y cuantificar. Estructura abierta de los flóculos. Elevada población de filamentos. Los métodos clásicos complementan a las técnicas moleculares, ya que proporcionan información de interés sobre las características del flóculo y la presencia de protozoos y otros microorganismos asociados. La microscopía convencional es considerada una herramienta indispensable para el control del proceso de depuración, pero a nivel microbiológico realmente solo unas pocas bacterias filamentosas han podido ser identificadas según sus características morfológicas, por ello actualmente se sabe que la identificación de las bacterias del fango activo no puede llevarse a cabo utilizando sólo el método convencional (Nielsen et al., 2009).
  27. 27. Trabajo Final de Máster Ingeniería Ambiental 27 1.5.2.- Técnica FISH para la identificación de bacterias filamentosas Para la identificación y cuantificación de microorganismos filamentosos se emplean métodos moleculares (Blackall, 1994; Wagner et al., 1994; Bradford et al., 1996; Erhart et al., 1997; Kanagawa et al., 2000;), en particular, la técnica de hibridación in situ con sondas 16S DNA marcadas con fluoróforos (FISH) se considera la más apropiada para una correcta identificación de las bacterias filamentosas en las muestras de fangos activos (Nielsen et al., 2009). La mayoría de los morfotipos filamentosos de Eikelboom no han sido nombrados siguiendo las reglas del Código Internacional de Nomenclatura de Procariotas y muchos reciben una identificación alfanumérica. Ello se debe principalmente a que muchos de estos microorganismos muestran una morfología celular diferente a la que presentan en los fangos activos. Esta situación está cambiando gracias al empleo de técnicas moleculares de caracterización y secuenciación del gen 16S rDNA, que empiezan a clarificar la posición taxonómica de los morfotipos de bacterias filamentosas. La hibridación in situ con sondas u oligonucleótidos 16S rDNA/23S rDNA marcadas con fluoróforos (FISH) es una técnica común para la detección e identificación de microorganismos en diferentes ambientes microbianos, entre los que se incluyen comunidades de bacterias como las presentes en los sistemas biológicos de depuración con fangos activos (Amann et al., 1995). Esta técnica se basa en la hibridación directa de la bacteria diana con una sonda complementaria de una región del gen 16S o 23S rRNA. El elevado número de moléculas de rRNA (103-105) es una ventaja en la aplicación de la técnica de hibridación al aumentar su sensibilidad (Amann, 1994). Una secuencia de DNA (sonda) puede unirse con una secuencia de RNA complementaria (16S rRNA o 23S rRNA) y se produce un híbrido DNA: RNA. La sonda está marcada con una molécula fluorescente de tal forma que los híbridos formados se pueden detectar fácilmente con un microscopio de epifluorescencia. La especificidad de las sondas puede ser ajustada a diferentes niveles taxonómicos como son: dominio, phylum, clase, familia, género o especie, para la identificación de las bacterias presentes en el fango activo. Estas sondas deben ser lo suficientemente específicas para unirse únicamente a la bacteria que se quiere detectar. Para asegurar la especificidad, los dos parámetros determinantes son la temperatura y la concentración de formamida en el tampón de hibridación (Alonso et al., 2009). La formamida hace que disminuya la temperatura de unión de las sondas mediante el debilitamiento de los puentes de hidrógeno, es decir, disminuye la temperatura de fusión de los híbridos DNA: RNA en 0,72ºC por cada 1% de formamida utilizada y permite realizar la hibridación a 46ºC (Alonso et al., 2009).
  28. 28. Trabajo Final de Máster Ingeniería Ambiental 28 La sonda que se utiliza en la técnica FISH está formada por una pequeña secuencia de nucleótidos de cadena sencilla, cuyo extremo, normalmente 5’, se marca con un fluoróforo, como puede ser rodamina o fluoresceína. En la figura 3 se muestra un esquema simplificado del proceso de hibridación in situ con sondas 16SrDNA con fluoróforos. La técnica FISH, presenta una serie de ventajas (tabla 6) frente a otras técnicas de detección e identificación, como la microscopia por contraste de fases. A continuación se comentan dichas ventajas: Tabla 6. Ventajas de la técnica FISH. No se han detectado sustancias inhibidoras que interfieran en la reacción de hibridación. No necesita cultivo previo de la bacteria ni la extracción de los ácidos nucleicos (Nielsen et al., 2009). Las preparaciones pueden conservarse durante mucho tiempo (años). Se mantiene la morfología de la célula y del flóculo (Nielsen et al., 2009). La hibridación inespecífica con otros microorganismos presentes en la muestra no es habitual, por lo que no se dan resultados falsos positivos. La especificidad de las sondas permite detectar varias especies o genes en una misma muestra, utilizando una sonda para cada especie, género o grupo, marcada con fluoróforos distintos, para la identificación de las bacterias en sus diferentes comunidades naturales. Puede utilizarse junto con la tinción DAPI para determinar si las células estudiadas están vivas o no, muy útil para la monitorización del estado de la microbiota durante la adicción de tóxicos para el control del “bulking” y del “foaming”. Además de todas las ventajas de la técnica molecular FISH anteriormente citadas, se aprecian ciertas limitaciones: Tabla 7.Limitaciones de la técnica FISH. La identificación a través de FISH es solo posible si la sonda requerida está disponible. Se han desarrollado sondas para varias especies filamentosas importantes, pero aún no para todas las especies que puedan aparecer en el fango activo. Su mayor limitación reside en la sensibilidad de la penetración de la propia sonda y de la matriz donde estemos hibridando, que depende del contenido de ribosomas existente en las bacterias filamentosas, si este contenido es bajo no darán una señal fluorescente clara con la sonda; en muchos casos es necesario un tratamiento previo. Puede ocurrir que una sonda específica para una especie de una señal fluorescente con otras especies, si sus secuencias de rRNA son muy parecidas. Tales resultados positivos falsos pueden ser prevenidos mediante la aplicación de sondas competidoras. La accesibilidad de la sonda rRNA es distinta según la molécula de rRNA de que se trate y la zona del mismo de la que sea complementaria, esto hay que tenerlo en cuenta para el diseño de la sonda.
  29. 29. Trabajo Final de Máster Ingeniería Ambiental 29 2.- OBJETIVOS Para conseguir un control efectivo de muchos de los problemas en el proceso de depuración es necesaria la identificación de los microorganismos que los causan, de modo que se puedan limitar las condiciones que favorecen su crecimiento. Un excesivo crecimiento de las bacterias filamentosas puede interferir en el correcto funcionamiento del sistema de fangos activos, dando lugar a problemas como la deficiente sedimentación del fango o la formación de espumas. El desarrollo de este trabajo tiene como objetivo principal la identificación y cuantificación de la población de bacterias filamentosas no ramificadas (Microthrix y tipo 0581) formadoras de espumas presentes en el fango activo de la EDAR de la Cuenca del Carraixet. Además, se estudiarán las posibles relaciones entre las variables operacionales y físico-químicas que pueden afectar a su actividad y crecimiento. Se plantean los siguientes objetivos específicos: Aplicar la técnica FISH a las muestras para determinar la presencia de diferentes morfotipos filamentosos del género Microthrix. En el caso del tipo 0581, al no existir una sonda específica para su hibridación, se aplica una sonda para poder identificar las bacterias del phylum Chloroflexi, al que pertenece este morfotipo. Determinar la abundancia de las bacterias filamentosas detectadas por FISH mediante la aplicación de la escala subjetiva de Eikelboom. Comparar la abundancia obtenida mediante la técnica FISH con la resultante de la aplicación de la microscopía convencional (contraste de fases), utilizando en ambos casos la escala subjetiva de Eikelboom. Estudiar las relaciones existentes entre los parámetros operacionales y físico- químicos de la EDAR y la abundancia de los diferentes morfotipos filamentosos estudiados.
  30. 30. Trabajo Final de Máster Ingeniería Ambiental 30 3.- MATERIAL Y MÉTODOS 3.1.- Descripción de la EDAR Se tomaron muestras del licor mezcla de la EDAR de la Cuenca del Carraixet con una frecuencia quincenal durante un año. A continuación se muestra el esquema de funcionamiento y algunos datos de interés. La planta de depuración de la Cuenca del Carraixet se ubica en la comarca de La Ribera Alta, en el municipio de Alzira, en la Comunidad Valenciana, es capaz de tratar agua procedente de 4 municipios consiguiendo unos rendimientos del 98 % para sólidos en suspensión (SS), del 95 % para DBO5 y del 91 % para DQO, según la información publicada por la EPSAR en el año 2012. Cuenta con dos líneas aerobias de tratamiento biológico, línea A+B y línea C+D, ambas con una zona anóxica (Ilustración 4). El caudal tratado es de 33.584 m3/d, con una carga de 96.230 habitantes equivalentes (he). Ilustración 3. Línea de tratamiento de agua y fango de la EDAR del CARRAIXET. EPSAR
  31. 31. Trabajo Final de Máster Ingeniería Ambiental 31 En la tabla 8 se puede observar la ficha técnica de la instalación: Tabla 8. Ficha técnica de la instalación. Fuente: EPSAR. Línea de agua Línea de fango Pretratamiento Espesador (gravedad y mecánico) Reja de gruesos Estabilización anaerobia Tamizado Deshidratación (centrífuga) Desarenador Generación eléctrica (cogeneración) Desengrasador Tratamiento primario Decantación primaria Tratamiento secundario Fangos activos Eliminación de nitrógeno y fósforo 3.2.- Muestreo Las muestras utilizadas para el desarrollo de este proyecto fueron proporcionadas por el Instituto Universitario de Ingeniería del Agua y Medio Ambiente (IIAMA) de la Universidad Politécnica de Valencia (UPV). El muestreo se realizó siempre en el mismo punto, generalmente a la salida del reactor biológico. Se tomaron 1,5 L de licor mezcla con un recipiente de plástico, de estas muestras se tomaron unas alícuotas para su fijación que se realizó antes de las 24 horas. Los muestreos se realizaron cada quince días durante el año 2009. El muestreo comenzó en Diciembre de 2008 y finalizó en Diciembre de 2009. Las muestras fueron simples realizadas de forma puntual. Se tomaron un total de 46 muestras, 23 en cada línea. Para el transporte y conservación de las muestras fue necesario mantener las condiciones aerobias de la muestra, lo cual se logró con la cámara de aire que queda sobre el licor mezcla en el recipiente de recogida. En el Anexo I encontramos la relación de fechas de muestreo. 3.3.- Variables físico-químicas y parámetros operacionales En las tablas expuestas en el anexo II se encuentran los parámetros físico- químicos analizados, su nomenclatura y unidades. En el anexo III las tablas con todos los parámetros donde aparecen los rangos, media y desviación estándar en cada depuradora. Estos parámetros se determinaron siguiendo los procedimientos
  32. 32. Trabajo Final de Máster Ingeniería Ambiental 32 normalizados (APHA, 2005) en las muestras de las distintas EDAR. El Índice Volumétrico de Fango (IVF) se calculó según el procedimiento descrito por Jenkins et al. (2004). En el presente trabajo los valores de oxígeno disuelto (OD) en el reactor fueron distribuidos en tres intervalos: < 0,8 oxígeno disuelto bajo (ODb), 0,8 – 2 oxígeno disuelto medio (ODm) y > 2 ppm oxígeno disuelto alto (ODa). 3.4.- Hibridación in situ con sondas marcadas con fluoróforos (FISH) 3.4.1.- Preparación de reactivos para FISH La técnica FISH requiere que se fijen previamente las bacterias. Este primer paso es necesario para que la estructura celular se mantenga rígida y estática y se conserve su morfología favoreciendo la penetración de las sondas. Para la fijación de las muestras se utilizó un reactivo diferente según la pared celular de la bacteria (Gram-positivo, Gram-negativo, Mycolata). Para las bacterias Gram-negativas, como el tipo 0581, se emplea paraformaldehído (PFA). En cambio las bacterias como Microthrix que son Gram-positivas se fijan con etanol. Para permeabilizar mejor la pared celular de Microthrix se ha realizado un tratamiento enzimático con mutanolisina (Schuppler et al., 1998). Ilustración 4.Esquema simplificado del proceso de hibridación in situ con sondas marcadas con fluoróforos. En la ilustración 5 se describen los pasos a realizar en cada caso:
  33. 33. Trabajo Final de Máster Ingeniería Ambiental 33 Ilustración 5. Pasos a realizar para la fijación de muestras según su pared celular. 3.4.2.- Tratamiento de los portaobjetos cubiertos con Teflón Todos los portaobjetos utilizados en la técnica FISH se han de lavar y desengrasar. Previamente a su empleo se les debe dar un baño en una solución de gelatina y de sulfato potásico y cromo para favorecer la adhesión de la muestra. A continuación se detallan los pasos a seguir para el tratamiento de los portaobjetos. Lavar con solución de limpieza Enjuagar con agua destilada Secar al aire(dejar escurrir todo 1 día, protegiendo del polvo ambiental cubriendo los portas con papel aluminio) Cubrir con gelatina por inmersión en la solución 0,1% con cromato sulfato potásico 0,01% (preparada en el momento, temperatura 60ºC) Secar al aire
  34. 34. Trabajo Final de Máster Ingeniería Ambiental 34 3.4.3.- Aplicación de las muestras a los portaobjetos Los pasos para la aplicación de las muestras a los portaobjetos son diferentes para Chloroflexi (gram -) y para Microthrix (gram +) ya que, como se ha comentado anteriormente, Microthrix necesita un tratamiento adicional con enzimas, en este caso se utiliza la mutanolisina: Etapas para la aplicación de las muestras a hibridar con Chloroflexi: Poner un volumen entre 3 y 5 µl de muestra fijada en el portaobjetos FISH. En este caso se ha colocado un volumen de 4 µl en cada pocillo del portaobjetos Secar al aire Deshidratar en etanol 50% durante 3 minutos por inmersión Deshidratar en etanol 80% durante 3 minutos por inmersión Deshidratar en etanol 100% durante 3 minutos por inmersión Secar al aire -Etapas para la aplicación de las muestras a hibridar con Microthrix: Poner un volumen entre 3 y 5 µl de muestra fijada en el portaobjetos FISH. En este caso se ha colocado un volumen de 4 µl en cada pocillo del portaobjetos Secar al aire Deshidratar en etanol 50% durante 3 minutos por inmersión Deshidratar en etanol 80% durante 3 minutos por inmersión Deshidratar en etanol 100% durante 3 minutos por inmersión Secar al aire Aplicar 10 µl de mutanolisina en cada pocillo y dejar actuar durante 20 minutos. Poner un trozo de papel celulosa dentro de un tubo Falcon con 1 mL de agua miliQ, para crear una atmósfera húmeda e introducir cada porta en un tubo Falcon. Incubar a 37ºC durante 20 minutos. Limpiar los porta con agua miliQ Secar al aire Deshidratar en etanol 50% durante 3 minutos por inmersión Deshidratar en etanol 80% durante 3 minutos por inmersión Deshidratar en etanol 100% durante 3 minutos por inmersión Secar al aire 3.5.- Sondas utilizadas Las diferentes sondas utilizadas en las hibridaciones, así como su secuencia de nucleótidos del extremo 5’ al 3’ y el porcentaje de formamida óptimo a utilizar se muestran en la tabla 9.
  35. 35. Trabajo Final de Máster Ingeniería Ambiental 35 Tabla 9. Sondas utilizadas. Sonda Secuencia (5’-3’) Organismo % FA1 Referencia MPA 645 CCGGACTCTAGTCAGAGC M. parvicella2 20 Erhart et al. (1997b) Mpa-T1-1260 TTCGCATGACCTCACGGTTT M. calida3 25 Levantesi et al. (2006) Mpa-all-1410 GGTGTTGTCGACTTTCGGCG Microthrix 35 Levantesi et al. (2006) MPA-60 GGATGGCCGCGTTCGACT M. parvicella2 20 Erhart et al. (1997b) GNSB941 CCATTGTAGCGTGTGTGTMG Chloroflexi 35 Gich et al. (2001) CFX1223 CCGTCAATTCCTTTATGTTTTA Chloroflexi 35 Björnsson et al.(2002) Fuente: Alonso et al., 2009. 1Concentración óptima de formamida; 2Candidatus Microthrix parvicella; 3Candidatus Microthrix calida. 3.6.- Hibridación “in situ” Los pasos y reactivos del proceso de hibridación se describen en detalle a continuación: En primer lugar se prepara la solución de hibridación con formamida en un microtubo de 2 ml. La cantidad de reactivos dependerá del porcentaje óptimo de formamida que a su vez dependerá de la sonda utilizada (tabla 10). Tabla 10. : Solución de hibridación según porcentaje de formamida. Reactivo % de Formamida 10 20 25 30 35 40 45 NaCl 5M 360 µl 360 µl 360 µl 360 µl 360 µl 360 µl 360 µl HCL-Tris 1M 40 µl 40 µl 40 µl 40 µl 40 µl 40 µl 40 µl Formamida 200 µl 400 µl 500 µl 600 µl 700 µl 800 µl 900 µl H2O MiliQ 1398 µl 1198 µl 1098 µl 988 µl 898 µl 798 µl 698 µl SDS 10% 2 µl 2 µl 2 µl 2 µl 2 µl 2 µl 2 µl Volumen Final 2000 µl 2000 µl 2000 µl 2000 µl 2000 µl 2000 µl 2000 µl Poner 9 µl de la solución de hibridación + 1 µl de sonda en cada pocillo y repartir homogéneamente por todo el campo. En el caso de que junto con la sonda se tenga que añadir sondas competidoras se deberá hacer una combinación de todos ellos con la sonda hasta alcanzar la cantidad total de 1 µl de sonda. A partir de la puesta en contacto con la sonda hay que evitar el contacto con la luz para evitar la pérdida de fluorescencia del fluoróforo Poner un trozo de papel celulosa dentro de un tubo Falcón de 50 ml y verter sobre el papel la solución de hibridación restante sin sonda, este paso es necesario para crear una atmósfera húmeda en el tubo Falcón y favorecer la hibridación.
  36. 36. Trabajo Final de Máster Ingeniería Ambiental 36 Introducir el portaobjetos en posición horizontal dentro del tubo Falcón de 50 ml Incubar a 46ºC durante al menos 1 hora y 30 minutos para Gram-, 3 horas en el caso de Mycolata. Para eliminar el exceso de sonda que no ha hibridado y la formamida de los portaobjetos se prepara 50 ml de solución de lavado mezclando los reactivos presentes en la siguiente tabla dependiendo del porcentaje de formamida que ha sido utilizado en la solución de hibridación (Tabla 11). Tabla 11. Solución de lavado según porcentaje de formamida. Reactivo % de Formamida 10 20 25 30 35 40 45 NaCl 5M 4500 µl 2150 µl 1490 µl 1020 µl 700 µl 460 µl 300 µl EDTA 0,5 M - 500 µl 500 µl 500 µl 500 µl 500 µl 500 µl HCL-TRIS 1M 1000 µl 1000 µl 1000 µl 1000 µl 1000 µl 1000 µl 1000 µl H2O MiliQ 44,45 ml 46,3 ml 47,94 ml 47,43 ml 47,75 ml 47,06 ml 48,15 ml SDS 10% 2 µl 2 µl 2 µl 2 µl 2 µl 2 µl 2 µl Volumen Final 50 ml 50 ml 50 ml 50 ml 50 ml 50 ml 50 ml l Sacar de la estufa y rápidamente lavar los portaobjetos e introducirlos dentro del tubo con la solución de lavado, los tubos se forran con papel de aluminio para protegerlos de la luz. Incubar en un baño a 48ºC durante 15 – 20 minutos. Lavar con agua Mili-Q Secar al aire en la oscuridad Si no se observa al microscopio inmediatamente, guardar el porta a -20ºC 3.7.- Observación al microscopio Una vez realizada la hibridación in situ con las sondas específicas se procede a la observación con el microscopio y a la toma de imágenes. A la hora de observar las muestras con el microscopio de epifluorescencia se precisa utilizar un líquido de montaje (Vectashield) para evitar la pérdida de fluorescencia. Se añaden unas gotas de este líquido en la zona central del portaobjetos y se coloca encima un cubreobjetos, con ayuda de una punta se ejerce una pequeña presión sobre éste para que el líquido de montaje se extienda de forma uniforme por toda la muestra, a continuación se observa el pocillo a 600X. El microscopio utilizado para la observación de las muestra ha sido un Olympus BX 50. Las fotografías en color se realizaron con una cámara digital Olympus DP 10 acoplada al microscopio con los filtros: U-MWIB (Fluoresceína, FAM) y U- MWIG (Rodamina, TAMRA).
  37. 37. Trabajo Final de Máster Para la cuantificación de los microorganismos se realizó un barrido de todos los pocillos del portaobjetos con el objetivo de 60X, una v hibridación in situ. Se realizó la valoración de la abundancia de las bacterias filamentosas utilizando la escala subjetiva de Eikelboom (2000, 2006). La escala de valoración de los organismos filamentos se muestra Tabla 12. Escala de valoración de organismos filamentosos. Índice filamento Abundancia 0 “Ninguno” 1 “Pocos” 2 “Algunos” 3 “Comunes” 4 “Muy comunes” 5 “Abundantes” En la Ilustración 6 se muestra la escala utilizada para valorar la abundancia de las bacterias filamentosas. Ingeniería Ambiental Para la cuantificación de los microorganismos se realizó un barrido de todos los pocillos del portaobjetos con el objetivo de 60X, una vez realizado el proceso de Se realizó la valoración de la abundancia de las bacterias filamentosas utilizando la escala subjetiva de Eikelboom (2000, 2006). La escala de valoración de los organismos filamentos se muestra . Escala de valoración de organismos filamentosos. Abundancia Descripción “Ninguno” Ningún filamento presente “Pocos” Pocos filamentos y de forma ocasional en el flóculo “Algunos” Filamentos en aproximadamente la mitad de los flóculos “Comunes” Filamentos en todos los flóculos con baja densidad (1 5/flóculos) comunes” Filamentos en todos los flóculos con densidad media(5 20/flóculos) “Abundantes” Filamentos en todos los flóculos con alta densidad (>20/flóculos) se muestra la escala utilizada para valorar la abundancia de Ilustración 6. Índice de filamentosas Ingeniería Ambiental 37 Para la cuantificación de los microorganismos se realizó un barrido de todos los ez realizado el proceso de Se realizó la valoración de la abundancia de las bacterias filamentosas La escala de valoración de los organismos filamentos se muestra en la tabla 12. Pocos filamentos y de forma ocasional en el flóculo aproximadamente la mitad de los Filamentos en todos los flóculos con baja densidad (1- Filamentos en todos los flóculos con densidad media(5- alta densidad se muestra la escala utilizada para valorar la abundancia de
  38. 38. Trabajo Final de Máster Ingeniería Ambiental 38 3.8.- Técnicas de Análisis Estadístico para muestras ambientales 3.8.1.- Análisis bivariante Las técnicas de análisis bivariante expresan el grado de relación entre dos variables. Pueden considerarse, en algunos supuestos, como casos especiales o simplificados de algunas técnicas de análisis multivariante. Por ello es recomendable realizar una exploración previa mediante este tipo de análisis antes de abordar la aplicación de cualquier técnica multivariante. Las técnicas de correlación son usadas con frecuencia para resumir la fuerza de la asociación entre dos variables métricas. Coeficiente de correlación lineal de Pearson. El coeficiente de correlación de Pearson es un coeficiente estadístico que se suele emplear para medir la intensidad de la relación entre dos variables linealmente relacionadas X e Y, y es calculable siempre que ambas variables se distribuyan normalmente. Se calcula con la fórmula expresada en la Ecuación 1. ‫ݎ‬ ൌ ∑ ሺ‫ݔ‬௜ െ ‫ݔ‬ҧሻ௡ ௜ୀଵ ሺ‫ݕ‬௜ െ ‫ݕ‬തሻ ඥ∑ ሺ‫ݔ‬௜ െ ‫ݔ‬ҧሻଶ௡ ௜ୀଵ ∑ ሺ‫ݕ‬௜ െ ‫ݕ‬തሻଶ௡ ௜ୀଵ Ecuación 1. Cálculo del coeficiente lineal de Pearson. El coeficiente de correlación de Pearson está comprendido entre -1 y +1, donde los valores positivos indican una dependencia lineal creciente y los valores negativos indican una dependencia lineal decreciente. El valor absoluto del coeficiente de correlación indica el grado de la relación lineal entre las variables. Valores absolutos grandes indican las relaciones más fuertes. Cuando los valores del coeficiente sean pequeños, significativos de una pequeña dependencia lineal, se debe cambiar el modelo lineal por otro tipo de curva a fin de tener una mejor aproximación. Coeficiente de Correlación de Spearman El coeficiente de Correlación de Spearman es una versión no paramétrica del coeficiente de correlación de Pearson. Este parámetro estadístico es adecuado para datos ordinales, o de intervalo, que no satisfagan el supuesto de normalidad, como es el caso de los resultados de este estudio. La correlación de Spearman se basa en los rangos de los datos en lugar de los valores reales, y compara dichos rangos para cada grupo de variables (Conover, 1998). El uso de este coeficiente estadístico es aconsejable cuando tenemos un número relativamente alto de categorías. El coeficiente de correlación de Spearman requiere que las variables sean aleatorias continuas, o por lo menos una de ellas, de forma que los objetos o individuos puedan colocarse en series ordenadas (Siegel, 1983).
  39. 39. Trabajo Final de Máster Ingeniería Ambiental 39 El coeficiente de Spearman se calcula con la fórmula expresada en la Ecuación 2 ‫ݎ‬௦ ൌ 1 െ 6 ∑ ݀௜ ଶ ܰଷ െ ܰ di: la diferencia entre los rangos X e Y (di=rxi-ryi). N: Número de valores de muestra Ecuación 2. Cálculo del coeficiente de correlación de Spearman. Los valores de los rangos se colocan según el orden numérico de los datos de la variable estudiada. Su interpretación es semejante al coeficiente de correlación de Pearson. Índices cercanos a +1 indican una fuerte correlación creciente mientras que valores cercanos a - 1 indican una fuerte correlación decreciente, los valores próximos a 0 indican que no hay correlación entre las variables (Siegel, 1983). La prueba de significación asociada a ambos coeficientes únicamente prueba la hipótesis nula de que el coeficiente pueda ser igual a 0, es decir, que no exista ninguna relación lineal entre ambas variables. El nivel de significación “p” representa la probabilidad de error que se comete al aceptar el resultado observado como válido. Cuanto mayor sea este nivel de significación mayor error se comete al aceptar que las correlaciones observadas entre las variables de la muestra son indicadoras de la relación entre las respectivas variables de la población. En el presente estudio, se emplea el coeficiente de correlación de Spearman para hacer el análisis bivariante de los resultados ya que se trata de datos ordinales. Previamente a la determinación de Spearman se comprobó la distribución de la normalidad de los datos obtenidos de las distintas variables mediante los test de Curtosis y Asimetría. Las variables cuyos datos no siguieron una distribución normal se transformaron a través de un cálculo logarítmico (variable = Ln [variable + 1]) (Esteban et al., 1991). La correlación de Spearman se obtuvo mediante el programa IBM SPSS Statistics versión 19. En este programa se introdujo una matriz con los parámetros operacionales y las especies de bacterias filamentosas objeto de este estudio y se realizó un análisis estadístico correspondiente a la correlación Spearman. El programa genera como salida de este estudio una tabla con los valores de las correlaciones y los p-valores de cada una. Estos últimos indican la bondad estadística del modelo ajustado. Por ejemplo p-valores iguales o inferiores a 0,05 indican una relación estadísticamente significativa al 95%.
  40. 40. Trabajo Final de Máster Ingeniería Ambiental 40 3.8.2.- Análisis Multivariante El análisis multivariante es la parte de la estadística y del análisis de datos que estudia, analiza , representa e interpreta los datos que resultan de observar más de una variable estadística sobre una muestra de individuos. Las variables observadas son homogéneas y correlacionadas, sin que alguna predomine sobre las demás. Dentro de los Análisis Multivariante se encuentra la técnica de Análisis canónico la cual se describe a continuación: El análisis de correspondencias canónicas (ACC) es una técnica de ordenación directa, a diferencia del análisis de componentes principales. El ACC asume un modelo unimodal en la respuesta de los organismos sobre combinaciones de un conjunto de variables, considerando simultáneamente la información biológica y la información ambiental. En el ACC, los ejes que explican la respuesta biológica están forzados a ser una suma ponderada de las variables estudiadas (terBraak and Smilauer, 1998). En los análisis canónicos se extrae toda la varianza de la matriz respuesta que está relacionada con la matriz explicativa. La ordenación de la matriz respuesta se precisa de forma que los vectores de ordenación resultantes son combinaciones lineales de las variables de la matriz explicativa. El proceso se explica a continuación: Sean X= (X1, …, Xp), Y=(Y1, …, Yq) dos vectores aleatorios de dimensiones p y q. Se pretende encontrar dos variables compuestas, U = Xa = a1X1+ … + apXp, V = Yb = b1Y1 + … + bqYq, siendo a = (a1, …, ap), b = (b1, …, bq)´, tales que la correlación entre ambas sea máxima. Se indicarán por S11, S22 las matrices de covarianzas (muéstrales) del primer y segundo conjunto, es decir, de las variables X, Y, respectivamente, y sea S12 la matriz p x q con las covarianzas de las variables X con las variables Y. · ܺ ܻ ܺ ‫ݏ‬ଵଵ ‫ݏ‬ଵଶ ܻ ‫ݏ‬ଶଵ ‫ݏ‬ଶଶ Donde: S12=S21 Ilustración 7.Matriz de covarianzas ACC. Entonces podremos suponer que var (U) = a´S11a =1 , var (V) = b´S22b = 1, reduciendo el problema a maximizar a´S12b restringido a a´S11a =1, b´S22b = 1. Los vectores de coeficientes a, b que cumplen esta condición son los primeros vectores canónicos. La máxima correlación entre U, V es la primera correlación canónica r1.
  41. 41. Trabajo Final de Máster Ingeniería Ambiental 41 La posibilidad de comprobar si existe una relación estadísticamente significativa entre la composición de la comunidad y una matriz de variables ambientales permite pasar de un uso meramente descriptivo de las ordenaciones a emplearlas como herramientas para el contraste de hipótesis formuladas a priori. La hipótesis nula de un ACC es que no existe relación alguna entre la matriz de variables respuesta y la matriz de variables explicativas. La significación de esta hipótesis nula se puede evaluar mediante permutaciones. En este caso, el estadístico es la suma de todos los valores propios canónicos y su significación se evalúa mediante un test de F. La hipótesis alternativa establece que la suma de todos los valores propios canónicos es mayor que la que se obtiene de matrices en las que se han permutado sus filas de datos. La suma de todos los valores propios canónicos dividida por el total de variación de la matriz Y permite obtener la proporción de la variación de Y explicada por X, que es análoga al coeficiente de determinación de las regresiones múltiples. Para realizar el análisis de correspondencias canónicas se utilizó el programa XLSTAT versión 2013.4.05, donde se introdujo la matriz de datos y se especificaron las variables para realizar el análisis. En primer lugar se comprobó si existían relaciones lineales entre las variables o bien unimodales, para ello se evaluaron los resultados de las pruebas de permutación, que indican la aceptación o rechazo de la hipótesis nula. Como se comentaba anteriormente, la hipótesis nula establece que no existe relación lineal entre la matriz de variables respuesta (organismos) y la matriz de variables explicativas (variables del proceso). En los casos que se acepta la hipótesis nula no es posible llevar a cabo el ACC y se debe proceder a la realización del análisis de redundancia. En este caso todos los datos analizados dieron como resultado el rechazo de la hipótesis nula, por tanto se utilizó el ACC. El resultado del ACC consiste principalmente en un diagrama de ordenación (biplot o triplot) formado por un sistema de ejes o dimensiones, los cuales son combinación lineal de las variables explicativas, en ellos es posible representar los sitios, las especies y las variables ambientales. Este diagrama representa un análisis directo del gradiente. La longitud de las variables explicativas, representadas por vectores, indica su variabilidad. Cuanto menor es el ángulo entre ellas más directa es la relación entre las variables, si forman un ángulo de 90º significa que las variables no están relacionadas, y a medida que este se va a aproximando a un ángulo de 180º la relación que indica es decreciente. Cuanto más alto corte la perpendicular de la variable respuesta con la variable explicativa mayor será el grado de relación entre ambas.
  42. 42. Trabajo Final de Máster Ingeniería Ambiental 42 4.- RESULTADOS Los resultados obtenidos durante la realización del proyecto corresponden, tal como se explicó en el apartado de materiales y métodos, a la realización de las hibridaciones mediante la técnica FISH de 46 muestras (23 de cada línea) tomadas quincenalmente en el fango activo de las dos líneas de la depuradora de la cuenca del Carraixet durante un periodo de un año. Las hibridaciones se realizaron con el fin de detectar y cuantificar las bacterias filamentosas del género Microthrix así como del phylum Chloroflexi (al cual pertenece el tipo 0581) presentes en el licor mezcla del reactor biológico. Seguidamente se llevó a cabo un análisis cualitativo y cuantitativo de las bacterias que dieron resultado positivo en las hibridaciones. Por último, se realizó un análisis estadístico bivariante y un análisis de correspondencias canónicas (ACC) para determinar las relaciones entre la dinámica poblacional de estas bacterias y las variables físico-químicas y operacionales de la EDAR. 4.1.- Cuantificación e identificación de bacterias filamentosas del género Microthrix y Tipo 0581 4.1.1.- Microscopía convencional Los resultados de abundancia según el método convencional fueron extraídos del proyecto “Estudio Integrado del Proceso de Fangos Activos” y se muestran en las tablas 1,2,3. Las bacterias filamentosas del morfotipo Microthrix se identificaron gracias a características morfológicas distintivas. De ahora en adelante en todo el documento se hará referencia a las bacterias del género Microthrix identificadas por microscopía convencional como Microthrix (convencional). Cabe mencionar que los valores de la media de abundancia se muestran solamente para tener una idea de la cantidad de bacterias filamentosas en las muestras, pero no pueden sumarse las medias de los diferentes organismos (por ejemplo, la suma de las medias de las abundancias detectadas con las distintas sondas de Microthrix no se corresponde con la media de la abundancia detectada con la sonda general de Microthrix) , ya que lo importante es el rango de valores que toma la abundancia y la variación de la misma en las diferentes muestras. Tabla 13, Valores mínimos y máximos (rango), media y desviación estándar de la abundancia de las bacterias identificadas por microscopía convencional en la línea A+B de la EDAR Carraixet.. Parámetro Rangos Media ± desviación Microthrix (Convencional) 0 – 5 3 ± 2 Tipo 0581 0 - 5 2 ± 2
  43. 43. Trabajo Final de Máster Ingeniería Ambiental 43 Tabla 14. Valores mínimos y máximos (rango), media y desviación estándar de la abundancia de las bacterias identificadas por microscopía convencional en la línea C+D de la EDAR Carraixet. Parámetro Rangos Media ± desviación Microthrix (convencional) 0 - 5 3 ± 2 Tipo 0581 0 - 5 2 ± 2 Tabla 15. Valores mínimos y máximos (rango), media y desviación estándar de abundancia de las bacterias identificadas por microscopía convencional en el conjunto de las dos líneas de agua de la EDAR Carraixet. Parámetro Rangos Media ± desviación Microthrix (convencional) 0 - 5 3 ± 2 Tipo 0581 0 - 5 2 ± 2 A continuación se muestran ilustraciones (Ilustraciones 8 y 9) con la observación mediante microscopía convencional de Microthrix y tipo 0581, en la ilustración 9 se observa su diferente respuesta a la tinción gram: Ilustración 8: Imágenes con contraste de fases. A la izquierda Microthrix, a la derecha Tipo 0581. Aumento 1000x. Se observa la similitud morfológica entre ambas bacterias. Ilustración 9: Imágenes con contraste de fases de la reacción a la tinción Gram. A la izquierda Microthrix, gram positiva; a la derecha Tipo 0581, gram negativa. Aumento 1000x. Mediante la tinción Gram es posible diferenciar estas bacterias por microscopía convencional.
  44. 44. Trabajo Final de Máster Ingeniería Ambiental 44 Como se ha comentado anteriormente, la similitud morfológica entre las bacterias del género Microthrix y el Tipo 0581 (Ilustración 8) hace que su identificación mediante la técnica molecular FISH sea clave para poder diferenciar ambos organismos, ya que hibridarán con sondas distintas y de phylum diferentes, Microthrix pertenece al phylum Actinobacteria y Tipo 0581 al phylum Chloroflexi. Además, el hecho de que muchas veces estas bacterias se encuentren dentro del flóculo también dificulta su identificación por microscopía convencional, resultando visibles utilizando FISH, como se aprecia en la ilustración 10: Ilustración 10.A la izquierda vista convencional y a la derecha FISH con la sonda GNSB941+CFX1223 del mismo campo de la muestra. En el caso de la imagen FISH sí puede apreciarse la presencia de los filamentos dentro del flóculo. Aumento: 1000x. 4.1.2.- Técnica molecular FISH Como se comentó en el apartado de materiales y métodos, se emplearon un total de 5 sondas, 4 para la identificación de bacterias del género Microthrix y una de ellas para el phylum Chloroflexi, dado que actualmente no existe ninguna sonda específica para el morfotipo 0581. Con la sonda general MPAall-1410 se identificaron los filamentos pertenecientes al género Microthrix. En primer lugar se realizó la observación mediante el microscopio de epifluorescencia y se tomó la imagen. Seguidamente se fotografió el mismo campo con contraste de fases, de forma que se pueden comparar ambas imágenes. En la imagen con contraste de fases se observa una mayor cantidad de filamentos que en la imagen FISH, esto puede dar lugar a confusiones a la hora de contabilizar los filamentos, ya que no todos pertenecen al género Microthrix. Con la imagen FISH se ve como solamente destacan por su fluorescencia algunos de los filamentos, justamente los que sí pertenecen a Microthrix, que han hibridado con la sonda MPAall-1410. De modo que utilizando la técnica FISH se puede realizar el recuento de microorganismos de una forma más fiable. En la Ilustración 11 se muestra un ejemplo de filamento hibridado con la sonda general.
  45. 45. Trabajo Final de Máster Ingeniería Ambiental 45 Ilustración 11.A la izquierda vista con contraste de fases y a la derecha vista FISH del mismo campo con la sonda MPAall-1410. Aumento: 1000x Para la detección e identificación de filamentos pertenecientes al morfotipo Candidatus Microthrix parvicella se emplearon las sondas MPA645 y MPA60, que hibridan dos regiones de nucleótidos diferentes. El morfotipo Candidatus Microthrix calida se detectó e identificó utilizando la sonda específica MPA-T1-1260. En la figura se muestra el árbol filogenético del phylum Actinobacteria, al que pertenecen M. parvicella y M. calida. Ilustración 12.Árbol filogenético del phyllum Actinobacteria. Nielsen et al,2008.
  46. 46. Trabajo Final de Máster Ingeniería Ambiental 46 Por último, se empleó la sonda GNSB941+CFX1223 para la identificación de los filamentos del phylum Chloroflexi, del que se muestra el árbol filogenético en la figura: Ilustración 13.árbol filogenético del phyllum Chloroflexi. Nielsen et al, 2008. En la tabla16 se presentan los resultados de abundancia para cada muestra con cada sonda:
  47. 47. Trabajo Final de Máster Ingeniería Ambiental 47 Muestra Línea A+B Línea C+D Nº Fecha MPAall1410 MPA645 MPA60 MPA1260 GNSB941+CFX1223 MPAall1410 MPA645 MPA60 MPA1260 GNSB941+CFX1223 (IF) (IF) (IF) (IF) (IF) (IF) (IF) (IF) (IF) (IF) 1 10-12-08 5 2 0 0 4 5 4 0 0 4 2 23-12-08 4 4 0 0 4 5 5 0 0 3 3 7-1-09 5 5 0 0 3 5 5 0 0 3 4 21-1-09 5 5 0 0 3 5 5 1 0 2 5 4-2-09 5 5 0 0 2 5 5 0 0 3 6 18-2-09 5 5 0 0 3 5 4 0 0 4 7 4-3-09 5 4 3 0 3 5 3 4 0 2 8 1-4-09 5 5 0 1 4 5 5 2 1 4 9 29-4-09 5 5 5 4 3 5 5 5 5 1 10 13-5-09 5 5 5 4 2 5 5 5 4 4 11 27-5-09 5 4 5 0 3 5 5 5 1 5 12 10-6-09 5 3 4 1 3 5 5 5 0 5 13 24-6-09 5 4 5 1 4 5 5 5 0 4 14 8-7-09 5 3 1 1 5 4 4 3 0 5 15 22-7-09 3 3 0 1 5 1 3 3 1 5 16 16-9-09 2 2 0 1 5 1 0 0 1 5 17 30-9-09 3 1 0 1 5 0 1 0 0 5 18 14-10-09 1 1 0 1 5 1 0 0 0 5 19 27-10-09 3 1 0 1 5 0 0 0 0 5 20 11-11-09 2 1 0 1 5 0 0 0 1 5 21 25-11-09 4 0 0 0 5 1 0 0 0 5 22 9-12-09 3 0 0 0 5 0 0 0 0 5 23 21-12-09 5 0 0 0 5 2 0 3 0 5 Tabla 16: Resultados de abundancia con las diferentes sondas FISH para las dos líneas de la EDAR Carraixet. Como puede observarse, todas las sondas presentan señal positiva en más de una muestra, lo que indica que, en algún momento, han estado presentes estas bacterias en la EDAR. Las diferencias en la abundancia de unas y otras se comentan más adelante, tras realizar los análisis estadísticos.

×