Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
MICROSCOPÍA CONVENCIONAL VERSUS
FISH EN LA IDENTIFICACIÓN,
ABUNDANCIA Y ECOFISIOLOGÍA DE LOS
MORFOTIPOS FILAMENTOSOS 0803,...
2
3
AGRADECIMIENTOS
En primer lugar dar las gracias a mis tutores José Luis Alonso y Gonzalo Cuesta Amat por sus
consejos y ...
4
5
ÍNDICE
1. INTRODUCCIÓN.....................................................................................................
6
3.8. Análisis estadístico .................................................................................................
7
ÍNDICE DE FIGURAS
Figura 1. Árbol filogenético del phylum Chloroflexi basado en las secuencias genéticas de 16S
rRNA de ...
8
Figura 23. Cuantificación según microscopía convencional y técnica molecular FISH del
morfotipo 0803/0914 en la EDAR de ...
9
Figura 47. Resultados Índice de filamentos EDAR QB............................................................... 104
Fi...
10
ÍNDICE DE TABLAS
Tabla 1. Número de muestras por depuradora ..............................................................
11
Tabla 27. Coeficientes de correlación entre los estados del N y P del afluente y los morfotipos
filamentosos..............
12
13
ABREVIATURAS Y ACRÓNIMOS
%SSVLM: Porcentaje de Sólidos en Suspensión Volátiles del Licor Mezcla
CM: Carga Másica
CondLM...
14
SSLM: Sólidos en Suspensión del Licor Mezcla
SSVLM: Sólidos en Suspensión Volátiles del Licor Mezcla
Tª: Temperatura de...
15
RESUMEN
El control efectivo de muchos de los problemas en el proceso de depuración se basa en la
identificación de los ...
16
en la forma de la célula y en los septos celulares. Los resultados obtenidos han permitido
mostrar aspectos de la ecofi...
A.B. Andújar Máster en Ingeniería Ambiental
17
INTRODUCCIÓN
A.B. Andújar Máster en Ingeniería Ambiental
18
A.B. Andújar Máster en Ingeniería Ambiental
19
1. INTRODUCCIÓN
1.1. Las aguas residuales y su tratamiento
El agua es un re...
A.B. Andújar Máster en Ingeniería Ambiental
20
activos. En este tipo de proceso se utilizan reacciones asociadas a microor...
A.B. Andújar Máster en Ingeniería Ambiental
21
1.4. Problemas en los sistemas de fangos activos
Muchos de los problemas qu...
A.B. Andújar Máster en Ingeniería Ambiental
22
En los sistemas de fangos activos los rotíferos junto con los nematodos con...
A.B. Andújar Máster en Ingeniería Ambiental
23
y en la aparición de episodios de bulking de forma ocasional (Jenkins et al...
A.B. Andújar Máster en Ingeniería Ambiental
24
tipo 1851 (Beer et al., 2002; Kragelund et al., 2007), probablemente tambié...
A.B. Andújar Máster en Ingeniería Ambiental
25
El morfotipo 0803 es localizado principalmente en la superficie de los flóc...
A.B. Andújar Máster en Ingeniería Ambiental
26
1.6.1.2. Morfotipo 0914
El morfotipo filamentoso Eikelboom 0914 es identifi...
A.B. Andújar Máster en Ingeniería Ambiental
27
1.6.1.3. Morfotipo 0092
El morfotipo 0092 ha sido desclasificado del phylum...
A.B. Andújar Máster en Ingeniería Ambiental
28
1.7. Identificación de morfotipos filamentosos
1.7.1. Microscopía convencio...
A.B. Andújar Máster en Ingeniería Ambiental
29
morfológicas, por ello actualmente se sabe que la identificación de las bac...
A.B. Andújar Máster en Ingeniería Ambiental
30
disminuye la temperatura de fusión de los híbridos DNA: RNA en 0,72ºC por c...
A.B. Andújar Máster en Ingeniería Ambiental
31
 Puede ocurrir que una sonda específica para una especie de una señal fluo...
A.B. Andújar Máster en Ingeniería Ambiental
32
A.B. Andújar Máster en Ingeniería Ambiental
33
OBJETIVOS
A.B. Andújar Máster en Ingeniería Ambiental
34
A.B. Andújar Máster en Ingeniería Ambiental
35
2. OBJETIVOS
El control efectivo de muchos de los problemas en el proceso d...
A.B. Andújar Máster en Ingeniería Ambiental
36
A.B. Andújar Máster en Ingeniería Ambiental
37
MATERIAL Y MÉTODOS
A.B. Andújar Máster en Ingeniería Ambiental
38
A.B. Andújar Máster en Ingeniería Ambiental
39
3. MATERIAL Y MÉTODOS
3.1. Toma de muestras
Se tomaron muestras del licor m...
A.B. Andújar Máster en Ingeniería Ambiental
40
Cuenta con dos líneas aerobias de tratamiento biológico, línea A+B y línea ...
A.B. Andújar Máster en Ingeniería Ambiental
41
3.1.4. EDAR Castellón de la Plana (CS)
La EDAR de Castellón de la Plana se ...
A.B. Andújar Máster en Ingeniería Ambiental
42
En la tabla 1 se muestra el número de líneas de tratamiento independientes ...
A.B. Andújar Máster en Ingeniería Ambiental
43
Tabla 2. Relación de muestras estudiadas
QB DE CS CX
04/12/2008 R. 10/12/20...
A.B. Andújar Máster en Ingeniería Ambiental
44
3.3. Parámetros físico-químicos y variables operacionales
Los parámetros fí...
A.B. Andújar Máster en Ingeniería Ambiental
45
Tabla 5. Variables operacionales
Parámetro Abreviatura Unidades
Tiempo de r...
A.B. Andújar Máster en Ingeniería Ambiental
46
Figura 10. Fijación de las muestras
3.5. Hibridación in situ con sondas flu...
A.B. Andújar Máster en Ingeniería Ambiental
47
 Tampón fosfato salino (para fijación)
 Concentración PBS 1X
NaCl...........
A.B. Andújar Máster en Ingeniería Ambiental
48
 EDTA 0,5M (cuando la concentración de formamida es mayor o igual a 20%)
E...
A.B. Andújar Máster en Ingeniería Ambiental
49
3.5.3. Aplicación de las muestras a los portaobjetos
Los pasos para la apli...
A.B. Andújar Máster en Ingeniería Ambiental
50
Tabla 6. Sondas empleadas en la identificación de las bacterias filamentosa...
A.B. Andújar Máster en Ingeniería Ambiental
51
 Poner 9l de la solución de hibridación + 1l de sonda en cada pocillo y ...
A.B. Andújar Máster en Ingeniería Ambiental
52
unas gotas de este líquido en la zona central del portaobjetos y se coloca ...
A.B. Andújar Máster en Ingeniería Ambiental
53
La escala de valoración de los organismos filamentosos se muestra en la tab...
A.B. Andújar Máster en Ingeniería Ambiental
54
elevado número de muestras y realizar un nuevo análisis bivariante. La figu...
A.B. Andújar Máster en Ingeniería Ambiental
55
donde:
di: diferencia entre los dos rangos.
N: número de valores de la mues...
A.B. Andújar Máster en Ingeniería Ambiental
56
A.B. Andújar Máster en Ingeniería Ambiental
57
RESULTADOS
A.B. Andújar Máster en Ingeniería Ambiental
58
A.B. Andújar Máster en Ingeniería Ambiental
59
4. RESULTADOS
Los resultados presentados a continuación corresponden a la c...
A.B. Andújar Máster en Ingeniería Ambiental
60
Figura 14. Morfotipo 0092 identificado mediante microscopía convencional (a...
A.B. Andújar Máster en Ingeniería Ambiental
61
Figura 16. Mortotipo 0803. EDAR CX (24/6/09). (a) Contraste de fases (b) FI...
A.B. Andújar Máster en Ingeniería Ambiental
62
Figura 18. Morfotipo 0914. EDAR CS (15/7/2009). (a) Contraste de fases (b) ...
A.B. Andújar Máster en Ingeniería Ambiental
63
La figura 21 muestra una serie de gráficos en los que se presentan los valo...
A.B. Andújar Máster en Ingeniería Ambiental
64
Figura 21. Valores promedio de IF de los morfotipos filamentosos en cada un...
A.B. Andújar Máster en Ingeniería Ambiental
65
4.2.1. Morfotipo 0803/0914
4.2.1.1. EDAR QB
El método molecular FISH muestr...
A.B. Andújar Máster en Ingeniería Ambiental
66
Figura 23. Cuantificación según microscopía convencional y técnica molecula...
A.B. Andújar Máster en Ingeniería Ambiental
67
Figura 25. Cuantificación según microscopía convencional y técnica molecula...
A.B. Andújar Máster en Ingeniería Ambiental
68
Figura 27. Cuantificación según microscopía convencional y técnica molecula...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentoso...
Upcoming SlideShare
Loading in …5
×

2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentosos 0803, 0914 y 0092 en fangos activos

47 views

Published on

Andújar, A. B. (2012) Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentosos 0803, 0914 y 0092 en fangos activos. Trabajo final de máster en Ingeniería Ambiental. Valencia: Universitat Politècnica de València.
www.abgc.es

Published in: Environment
  • Be the first to comment

  • Be the first to like this

2012 - Microscopía convencional versus FISH en la identificación, abundancia y ecofisiología de los morfotipos filamentosos 0803, 0914 y 0092 en fangos activos

  1. 1. MICROSCOPÍA CONVENCIONAL VERSUS FISH EN LA IDENTIFICACIÓN, ABUNDANCIA Y ECOFISIOLOGÍA DE LOS MORFOTIPOS FILAMENTOSOS 0803, 0914 Y 0092 EN FANGOS ACTIVOS TRABAJO FINAL DE MÁSTER EN INGENIERÍA AMBIENTAL Realizado por: Ana Belén Andújar González Dirigido por: Dr. José Luis Alonso Molina Dr. Gonzalo Cuesta Amat VALENCIA, JULIO 2012
  2. 2. 2
  3. 3. 3 AGRADECIMIENTOS En primer lugar dar las gracias a mis tutores José Luis Alonso y Gonzalo Cuesta Amat por sus consejos y dedicación. Gracias José Luis por darme la oportunidad de realizar este trabajo en el Instituto Universitario del Agua y Medio Ambiente (IIAMA) y tratarme siempre tan bien. A Andrés Zornoza por ayudarme siempre que lo he necesitado, por sus consejos y paciencia. A la Entidad Pública de Saneamiento de Aguas Residuales de la Comunidad Valenciana (EPSAR) por facilitar los datos para la realización de este trabajo. A toda la gente del laboratorio por crear un ambiente de trabajo increíble y por haberme acogido tan bien desde el primer momento. A mi familia por su apoyo, por su esfuerzo, por animarme a seguir y porque sin ellos no habría llegado hasta aquí. Y por último, a Antonio por acompañarme en el camino. Gracias por estar a mi lado. Gracias a todos.
  4. 4. 4
  5. 5. 5 ÍNDICE 1. INTRODUCCIÓN.............................................................................................................. 19 1.1. LAS AGUAS RESIDUALES Y SU TRATAMIENTO............................................................ 19 1.2. TRATAMIENTOS BIOLÓGICOS DE AGUAS RESIDUALES. FANGOS ACTIVOS................. 19 1.3. EL FLÓCULO ................................................................................................................ 20 1.4. PROBLEMAS EN LOS SITEMAS DE FANGOS ACTIVOS ................................................. 21 1.5. COMPOSICIÓN DE LA MICROBIOTA ........................................................................... 21 1.6. LA IMPORTANCIA DE LAS BACTERIAS FILAMENTOSAS.............................................. 22 1.6.1. Phylum Chloroflexi............................................................................................... 22 1.6.1.1. Morfotipo 0803 ........................................................................................... 24 1.6.1.2. Morfotipo 0914 .......................................................................................... 26 1.6.1.3. Morfotipo 0092 ........................................................................................... 27 1.7. IDENTIFICACIÓN DE MORFOTIPOS FILAMENTOSOS ................................................... 28 1.7.1. Microscopía convencional................................................................................... 28 1.7.2. Técnica FISH para la identificación de bacterias filamentosas............................ 29 1.8. PARÁMETROS OPERACIOALES DEL PROCESO DE DEPURACIÓN ................................. 31 2. OBJETIVOS.......................................................................................................................... 35 3. MATERIAL Y MÉTODO ......................................................................................................... 39 3.1. Toma de muestras....................................................................................................... 39 3.1.1. Quart Benàger (EDAR QB)................................................................................... 39 3.1.2. Cuenca del Carraixet (EDAR CX).......................................................................... 39 3.1.3. Dénia-Ondara (EDAR DE)..................................................................................... 40 3.1.4. Castellón de la Plana (EDAR CS) .......................................................................... 41 3.2. Muestreo.................................................................................................................... 41 3.3. Parámetros físico-químicos y variables operacionales .............................................. 44 3.4. Fijación y permeabilización de las muestras............................................................... 45 3.5. Hibridación in situ con sondas fluorescentes (FISH) ................................................... 46 3.5.1. Preparación de reactivos para FISH .................................................................... 46 3.5.2. Tratamiento de los portaobjetos cubiertos con Teflón ...................................... 48 3.5.3. Aplicación de las muestras a los portaobjetos.................................................... 49 3.5.4. Sondas utilizadas................................................................................................. 49 3.5.5. Hibridación “in situ”............................................................................................ 50 3.6. Observación al microscopio ........................................................................................ 51 3.7. Identificación y cuantificación de microorganismos filamentosos............................. 52
  6. 6. 6 3.8. Análisis estadístico ...................................................................................................... 53 4. RESULTADOS ....................................................................................................................... 59 4.1. Cuantificación e identificación de los morfotipos filamentosos................................ 59 4.1.1. Microscopía Convencional .................................................................................. 59 4.1.2. Técnica molecular FISH ....................................................................................... 60 4.2. Comparación microscopía convencional-FISH................................................................. 64 4.2.1. Morfotipo 0803/0914.......................................................................................... 65 4.2.1.1. EDAR QB ..................................................................................................... 65 4.2.1.2. EDAR CX....................................................................................................... 65 4.2.1.3. EDAR CS....................................................................................................... 66 4.2.1.4. EDAR DE....................................................................................................... 67 4.2.2 MORFOTIPO 0092 ............................................................................................... 68 4.2.2.1 EDAR QB ...................................................................................................... 68 4.2.2.2. EDAR CX....................................................................................................... 68 4.2.2.3. EDAR CS....................................................................................................... 69 4.2.2.4. EDAR DE.............................................................................................................. 70 4.3. Características morfológicas y estructurales de los organismos filamentosos........... 71 4.4. Análisis de correlación entre los morfotipos filamentosos y los parámetros operacionales y físico-químicos .............................................................................................. 74 5. DISCUSIÓN........................................................................................................................... 81 5.1. Técnica convencional versus FISH............................................................................... 81 5.2. Abundancia de los morfotipos filamentosos .............................................................. 82 5.3. Morfología de los morfotipos filamentosos................................................................ 83 5.4. Ecofisiología de los morfotipos filamentosos ............................................................. 84 5. CONCLUSIONES ................................................................................................................... 89 6. BIBLIOGRAFÍA...................................................................................................................... 93 7. ANEXOS ............................................................................................................................... 99 I. Fichas de bacterias filamentosas .................................................................................... 99 II. Vistas aéreas de las EDAR estudiadas .......................................................................... 102 III. Abundancias de bacterias filamentosas según técnica convencional y técnica molecular FISH ...................................................................................................................... 104 IV. Rangos de los parámetros operacionales y fisico-químicos...................................... 107 V. Correlaciones de cada una de las EDAR.................................................................... 109 VI. Atlas fotográfico de los morfotipos filamentosos..................................................... 116
  7. 7. 7 ÍNDICE DE FIGURAS Figura 1. Árbol filogenético del phylum Chloroflexi basado en las secuencias genéticas de 16S rRNA de los clones aislados (Yoon et al., 2010). ......................................................................... 24 Figura 2. Árbol filogenético del morfotipo filamentoso 0803 basado en el análisis comparativo de las secuencias genéticas del 16S rRNA (Kragelund et al., 2011)............................................ 25 Figura 3. Árbol filogenético del morfotipo 0914 basado en las secuencias genéticas del 16S rRNA (Speirs et al., 2010). ........................................................................................................... 26 Figura 4. Árbol filogenético del morfotipo 0092 basado en las secuencias genéticas del 16S rRNA (Speirs et al., 2009) ............................................................................................................ 27 Figura 5. Esquema del proceso Hibridación in situ (FISH)........................................................... 30 Figura 6. Diagrama de bloques de la EDAR QB ........................................................................... 39 Figura 7. Diagrama de bloques de la EDAR CX........................................................................... 40 Figura 8. Diagrama de bloques de la EDAR DE............................................................................ 40 Figura 9. Diagrama de bloques de la EDAR CS ............................................................................ 41 Figura 10. Fijación de las muestras ............................................................................................. 46 Figura 11. Criterio de valoración de abundancia de filamentos ................................................. 53 Figura 12. Esquema análisis estadístico...................................................................................... 54 Figura 13. Morfotipo 0803/0914 identificado mediante microscopía convencional (a) QB (b) CS ..................................................................................................................................................... 59 Figura 14. Morfotipo 0092 identificado mediante microscopía convencional (a) QB (b) DE. .... 60 Figura 15. Valores promedio de IF de los morfotipos filamentosos en cada una de las líneas de tratamiento según microscopía convencional............................................................................ 60 Figura 16. Mortotipo 0803. EDAR CX (24/6/09). (a) Contraste de fases (b) FISH, sonda T0803ind-0642, 100x................................................................................................................... 61 Figura 17. Morfotipo 0803. EDAR QB (1/7/09). (a) Contraste de fases (b) FISH, sonda T0803- 0654, 100x................................................................................................................................... 61 Figura 18. Morfotipo 0914. EDAR CS (15/7/2009). (a) Contraste de fases (b) FISH, sonda CFX 67a, 100x..................................................................................................................................... 62 Figura 19. Morfotipo 0092 (variante A). EDAR CX (11/11/09). (a) Contraste de fases (b) FISH, Sonda CFX 197, 100x................................................................................................................... 62 Figura 20. Morfotipo 0092 (variante B). EDAR CX (11/11/09). (a) Contraste de fases (b) FISH, Sonda CFX 223, 100X................................................................................................................... 62 Figura 21. Valores promedio de IF de los morfotipos filamentosos en cada una de las líneas de tratamiento según FISH............................................................................................................... 64 Figura 22. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de QB .................................................................................... 65
  8. 8. 8 Figura 23. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de CX (A+B) ........................................................................... 66 Figura 24. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de CX (C+D) ........................................................................... 66 Figura 25. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de CS (R1).............................................................................. 67 Figura 26. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de CS (R2).............................................................................. 67 Figura 27. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de DE..................................................................................... 68 Figura 28. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0092 en la EDAR de QB.............................................................................................. 68 Figura 29. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0092 en la EDAR de CX (A+B).................................................................................... 69 Figura 30. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0092 en la EDAR de CX (C+D)..................................................................................... 69 Figura 31. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0092 en la EDAR de CS (R1) ....................................................................................... 70 Figura 32. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0092 en la EDAR de CS (R2) ....................................................................................... 70 Figura 33. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0092 en la EDAR de DE............................................................................................... 71 Figura 34. Distintos diámetros de los filamentos pertenecientes al phylum Chloroflexi (a) contraste de fases (b) FISH.......................................................................................................... 71 Figura 35. Distintas morfologías de los filamentos del género Caldilinea.................................. 72 Figura 36. Fotos morfotipo 0803 localizado en el interior del flóculo formando una maraña... 72 Figura 37. Morfotipo 0803 formando una estructura en forma de lazada................................. 72 Figura 38. Morfología filamento tipo 0803................................................................................. 73 Figura 39. Morfología del morfotipo 0914.................................................................................. 73 Figura 40. Morfología morfotipo 0092........................................................................................ 74 Figura 41. Relación de la variante A del morfotipo 0092 con la EF en la EDAR de QB ............... 75 Figura 42. Evolución de los filamentos del género Caldilinea frente a la temperatura en la EDAR de CX............................................................................................................................................ 76 Figura 43. Vista aérea de la EDAR CX ........................................................................................ 102 Figura 44. Vista aérea de la EDAR DE........................................................................................ 102 Figura 45. Vista aérea de la EDAR QB........................................................................................ 103 Figura 46. Vista aérea de la EDAR CS. ....................................................................................... 103
  9. 9. 9 Figura 47. Resultados Índice de filamentos EDAR QB............................................................... 104 Figura 48. Resultados Índice de filamentos EDAR DE ............................................................... 104 Figura 49. Resultados Índice de filamentos EDAR CX (A+B)...................................................... 105 Figura 50. Resultados Índice de filamentos EDAR CX (C+D)...................................................... 105 Figura 51. Resultados Índice de filamentos EDAR CS (R1) ........................................................ 106 Figura 52. Resultados Índice de filamentos EDAR CS (C+D)...................................................... 106 Figura 53. Phylum Chloroflexi, sonda CFXMIX (CFX1223+GNSB914) .......................................... 116 Figura 54. Género Caldilinea, EDAR CS. Sonda Caldi-0678 ....................................................... 116 Figura 55. Género Caldilinea, EDAR QB. Sonda Caldi-0678 ...................................................... 116 Figura 56. Morforipo 0803. EDAR CS R2 (6/5/09). Sonda T0803ind-0642, 100x...................... 117 Figura 57. Morfotipo 0803. EDAR DE (11/11/09). Sonda T0803ind-0642, 100x...................... 117 Figura 58. Morfotipo 0803. EDAR QB (1/7/09). Sonda T0803ind-0642, 100x .......................... 117 Figura 59. Morfotipo 0803. EDAR CX (24/6/09). Sonda T0803-0654, 100x.............................. 118 Figura 60. Morfotipo 0803. EDAR CS R2 (6/5/09). Sonda T0803-0654, 100x........................... 118 Figura 61. Morfotipo 0803. EDAR DE (11/11/09). Sonda T0803-0654, 100x........................... 118 Figura 62. Morfotipo 0914. EDAR DE (11/11/09). Sonda CFX 67a, 100x .................................. 119 Figura 63. Morfotipo 0914. EDAR QB (7/4/09). Sonda CFX 67a, 100X ..................................... 119 Figura 64. Morfotipo 0092 (variante A). EDAR CX (11/11/09). Sonda CFX 197, 100x .............. 119 Figura 65. Morfotipo 0092 (variante A). EDAR DE (27/5/09). Sonda CFX 197, 100x ................ 120 Figura 66. Morfotipo 0092 (variante A). EDAR QB (29/12/09). Sonda CFX 197, 100x.............. 120
  10. 10. 10 ÍNDICE DE TABLAS Tabla 1. Número de muestras por depuradora .......................................................................... 42 Tabla 2. Relación de muestras estudiadas.................................................................................. 43 Tabla 3. Parámetros físico-químicos determinados en el licor mezcla....................................... 44 Tabla 4. Parámetros físico- químicos determinados en el afluente al reactor y en efluente del decantador secundario ............................................................................................................... 44 Tabla 5. Variables operacionales................................................................................................. 45 Tabla 6. Sondas empleadas en la identificación de las bacterias filamentosas.......................... 50 Tabla 7. Solución de hibridación según porcentaje de formamida............................................. 50 Tabla 8. Solución de lavado según porcentaje de formamida.................................................... 51 Tabla 9. Identificación de morfotipos filamentosos mediante métodos clásicos...................... 52 Tabla 10. Escala de valoración de organismos filamentosos ...................................................... 53 Tabla 11. Intervalos de coeficientes de correlación.................................................................... 55 Tabla 12. Coeficientes de correlación entre la edad de fango (EF) y morfotipos filamentosos. 75 Tabla 13. Coeficientes de correlación entre CM, TRH, OD y Tª y los morfotipos filamentosos.. 76 Tabla 14. Coeficientes de correlación entre los diferentes estados del N en el efluente y los morfotipos filamentosos............................................................................................................. 77 Tabla 15. Coeficientes de correlación entre la DQO, DBO y los estados del N y P del afluente y los morfotipos filamentosos ....................................................................................................... 78 Tabla 16. Coeficientes de correlación entre los parámetros físico-químicos del licor mezcla y los morfotipos filamentosos ....................................................................................................... 78 Tabla 17. Ficha morfotipo 0803 .................................................................................................. 99 Tabla 18. Ficha morfotipo 0914 ................................................................................................ 100 Tabla 19. Ficha morfotipo 0092 ................................................................................................ 101 Tabla 20. Rangos matriz general............................................................................................... 107 Tabla 21. Rangos por depuradora…………………………………………………………………………………………108 Tabla 22. Coeficientes de correlación entre la edad de fango (EF) y los morfotipos filamentosos ................................................................................................................................................... 109 Tabla 23. Coeficientes de correlación entre la CM y los morfotipos filamentosos .................. 110 Tabla 24. Coeficientes de correlación entre TRH, OD y Tª y los morfotipos filamentosos....... 111 Tabla 25. Coeficientes de correlación entre los diferentes estados del N del efluente y los morfotipos filamentosos........................................................................................................... 112 Tabla 26. Coeficientes de correlación entre la DBO y DQO del afluente y los morfotipos filamentosos.............................................................................................................................. 113
  11. 11. 11 Tabla 27. Coeficientes de correlación entre los estados del N y P del afluente y los morfotipos filamentosos.............................................................................................................................. 114 Tabla 28. Coeficientes de correlación entre los parámetros físico-químicos del licor mezcla y los morfotipos filamentosos........................................................................................................... 115
  12. 12. 12
  13. 13. 13 ABREVIATURAS Y ACRÓNIMOS %SSVLM: Porcentaje de Sólidos en Suspensión Volátiles del Licor Mezcla CM: Carga Másica CondLM: Conductividad del licor mezcla CS: Estación Depuradora de Aguas Residuales de Castellón CX: Estación Depuradora de Aguas Residuales de Carraixet DE: Estación Depuradora de Aguas Residuales de Denia DBO5: Demando Bioquímica de Oxígeno total a los 5 días DBOT: Demando Bioquímica de Oxígeno soluble DQO: Demanda Química de Oxígeno total DQOT: Demanda Química de Oxígeno total DQOS: Demanda Química de Oxígeno soluble DQOLM: Demanda Química de Oxígeno del Licor Mezcla EDAR: Estación Depuradora de Aguas Residuales EF: Edad de Fango EPSAR: Entidad Pública de Saneamiento de Aguas Residuales de la Comunidad Valenciana FISH: Hibridación in situ con sondas fluorescentes IF: Índice de Filamentos IVF: Índice Volumétrico de Fango LM: Licor Mezcla N-NH4 + : Nitrógeno amoniacal N-NO2 - : Nitrógeno nitroso N-NO3 - : Nitrógeno nítrico NT: Nitrógeno Total NTLM: Nitrógeno Total del Licor Mezcla Oa: Oxígeno en el reactor biológico >2 ppm Ob: Oxígeno en el reactor biológico <0.8 ppm Om: Oxígeno en el reactor biológico 0.8-2 ppm P-PO4 3- : Fósforo relativo al ortofosfato PT: Fósforo Total PTLM: Fósforo Total del Licor Mezcla QB: Estación Depuradora de Aguas Residuales de Quart Benàger R: Reactor biológico rN- NH4 + : Rendimiento de eliminación del nitrógeno amoniacal
  14. 14. 14 SSLM: Sólidos en Suspensión del Licor Mezcla SSVLM: Sólidos en Suspensión Volátiles del Licor Mezcla Tª: Temperatura del reactor biológico TRH: Tiempo de Retención Hidráulico en el reactor biológico
  15. 15. 15 RESUMEN El control efectivo de muchos de los problemas en el proceso de depuración se basa en la identificación de los microorganismos que lo causan y en la eliminación de las condiciones que favorecen su crecimiento. Los métodos convencionales de detección e identificación de morfotipos filamentosos, a pesar de ser una gran ayuda para la observación de bacterias filamentosas en fangos activos de Estaciones Depuradoras de Aguas Residuales (EDAR), no son una herramienta fiable debido a su bajo nivel de especificidad. Sin el uso complementario de técnicas moleculares, como por ejemplo la hibridación in situ con sondas de 16S rDNA marcadas con fluorocromos (FISH), sería imposible conocer la verdadera ecofisiología y la posición taxonómina de los distintos microorganismos filamentosos. En el presente trabajo se identificó y cuantificó la población de las bacterias filamentosas 0803, 0914, 0092 y los filamentos pertenecientes al género Caldilinea y phylum Chloroflexi presentes en el licor mezcla de cuatro EDAR de la Comunidad Valenciana a lo largo de un año mediante la técnica molecular FISH y se comparó los resultados obtenidos en la estimación de las abundancias de dichos morfotipos con los resultados obtenidos previamente con la microscopía convencional. La identificación de los organismos filamentosos mediante la técnica molecular se realizó con las siguientes sondas: CFXMIX (CFX1223+GNSB94) específica del phylum Chloroflexi, Caldi-0678 para el género Caldilinea, T0803-0654 y T0803ind-0642 para detectar el morfotipo 0803, CFX67a y CFX67b para el morfotipo 0914 y las sondas CFX197 y CFX223 específicas del morfotipo 0092. Se relacionó la abundancia de los morfotipos filamentosos presentes en las muestras con los distintos parámetros operacionales y físico- químicos del proceso de depuración mediante el análisis de correlación bivariante calculándose el coeficiente de Spearman. Se apreciaron diferencias significativas al comparar los resultados en la cuantificación e identificación de los morfotipos filamentosos estudiados mediante las dos técnicas empleadas (convencional y FISH). Se identificó el morfotipo filamentoso 0803 como la bacteria filamentosa dominante, dentro del phylum Chloroflexi junto con el morfotipo 0092 (variante A). Los morofotipos 0914 y 0092 (variante B) aparecieron con abundancias inferiores, incluso en algunas estaciones depuradoras no fueron detectados. Se comprobó que los filamentos del phylum Chloroflexi y género Caldilinea son abundantes en las EDAR estudiadas constituyendo un porcentaje elevado del total de la biomasa de los fangos activos. En cuanto a las características morfológicas y estructurales de las bacterias filamentosas se observó que los miembros del phylum Chloroflexi se localizaron en el interior del flóculo y presentaron distintas formas. Se observaron diferencias en el diámetro celular, en la longitud del tricoma,
  16. 16. 16 en la forma de la célula y en los septos celulares. Los resultados obtenidos han permitido mostrar aspectos de la ecofisiología de los morfotipos filamentosos que no eran evidentes al utilizar la microscopía convencional. Al realizar el análisis estadístico se observaron correlaciones importantes entre los parámetros operacionales y físico-químicos y los morfotipos estudiados.
  17. 17. A.B. Andújar Máster en Ingeniería Ambiental 17 INTRODUCCIÓN
  18. 18. A.B. Andújar Máster en Ingeniería Ambiental 18
  19. 19. A.B. Andújar Máster en Ingeniería Ambiental 19 1. INTRODUCCIÓN 1.1. Las aguas residuales y su tratamiento El agua es un recurso natural, escaso e indispensable para el desarrollo de la vida humana que debe estar disponible no sólo en la cantidad necesaria si no en la calidad adecuada. Durante años, ingentes cantidades de sustancias contaminantes han sido vertidas al agua sin tener en cuenta las consecuencias tanto a corto como a largo plazo. El uso que se hace del agua es muy variado y depende del país, del clima, de las costumbres, de la economía, etc., pero un aspecto común de todos estos usos es la necesidad de satisfacer su demanda y proteger el medio ambiente. El tratamiento de aguas residuales consiste en una serie de procesos físicos, químicos y biológicos que tienen como objetivo conseguir unos determinados niveles de calidad del agua tratada. Se entiende como agua residual aquella constituida por cualquier combinación de aguas descargadas de actividades domésticas, y de establecimientos industriales o comerciales, aguas de escorrentía superficial y de cualquier agua de infiltración de alcantarillados (UNE-EN1085). El grado de tratamiento requerido para un agua residual dependerá fundamentalmente de los límites de vertido para el efluente en un determinado lecho receptor. Las Estaciones de Depuración de Aguas Residuales (EDAR) junto con alcantarillas y colectores son las infraestructuras que permiten recolectar, trasportar y tratar adecuadamente las aguas residuales y así evitar tanto problemas ambientales como sociales y económicos. Para conseguir el nivel adecuado de eliminación de los contaminantes (sólidos en suspensión, materia orgánica, microorganismos patógenos, compuestos inorgánicos, metales pesados y nutrientes), en las EDAR tienen lugar los siguientes procesos (Catalán et al., 1997):  Pretratamiento: desbaste y desarenado-desengrasado.  Tratamiento primario: procesos físico-químicos.  Tratamiento secundario: proceso biológico.  Tratamiento terciario: desinfección. 1.2. Tratamientos biológicos de aguas residuales. Fangos activos La biodegradación es el mecanismo dominante para la eliminación de compuestos orgánicos en las aguas residuales urbanas y en la mayoría de las industriales. Hoy en día la mayoría de las plantas depuradoras utilizan el sistema de fangos activos para este propósito. Existen diversos tratamientos biológicos para la depuración de aguas residuales, pero cabe destacar los procesos de cultivo en suspensión y dentro de estos el tratamiento de fangos
  20. 20. A.B. Andújar Máster en Ingeniería Ambiental 20 activos. En este tipo de proceso se utilizan reacciones asociadas a microorganismos vivos. Los microorganismos crecen utilizando los contaminantes del agua como fuente de carbono y/o como fuente de energía, convirtiéndolos en nueva biomasa, dióxido de carbono y otros compuestos inertes (Ferrer, 2007). Además de la eliminación biológica de la materia orgánica, en las EDAR se han desarrollado esquemas de proceso orientados a la nitrificación, desnitrificación y eliminación de fósforo. El proceso de fangos activos puede definirse como aquel tratamiento biológico de las aguas residuales en el que una mezcla de agua residual y de fangos activos es agitada y aireada, y posteriormente el fango activo se separa de las aguas residuales depuradas y se devuelve al proceso (UNE-EN 1085). 1.3. El flóculo El flóculo es la unidad estructural y funcional del fango activo compuesto por microorganismos (bacterias formadoras de flóculo y bacterias filamentosas), partículas orgánicas e inorgánicas del agua residual afluente y polímeros extracelulares. En resumen, el flóculo puede considerarse como el resultado combinado de una parte biológica y una parte física. Junto al flóculo aparecen poblaciones de microorganismos como protozoos, rotíferos y nematodos que dan lugar a un equilibrio dinámico que está condicionado por la edad del fango, la composición del afluente, las variables operacionales, la presencia de tóxicos, etc. La estructura y la actividad del flóculo son dos puntos significativos en el adecuado proceso de depuración de las aguas residuales. En el flóculo se distinguen dos niveles estructurales: la microestructura y la macroestructura (Sezgin et al., 1978). Los procesos de agregación y biofloculación son los responsables de la aparición de la microestructura, es decir, dan lugar a la formación de flóculos pequeños, esféricos, compactos y débiles. La macroestructura del flóculo la proporcionan las bacterias filamentosas. Los microorganismos filamentosos forman una especie de esqueleto donde se fijan los flóculos, originando flóculos más fuertes, grandes y resistentes a la agitación. Si la proporción de bacterias filamentosas del flóculo no es la correcta pueden aparecer problemas como bulking o flóculo “punta de alfiler”. Cuando hay una excesiva cantidad de filamentosas, éstas impiden el acercamiento de los flóculos, manteniendo los flóculos separados y haciendo que la compactación y sedimentación se dificulte. Si, por el contrario, la proporción de bacterias filamentosas es baja los flóculos serán pequeños y débiles pudiendo aparecer en el efluente.
  21. 21. A.B. Andújar Máster en Ingeniería Ambiental 21 1.4. Problemas en los sistemas de fangos activos Muchos de los problemas que tienen lugar en el proceso de fangos activos están asociados a fallos en la formación de la microstructura o de la macroestructura del flóculo (Ferrer, 2007). Estos problemas ejercen un efecto negativo sobre la calidad del efluente, impidiéndose así alcanzar los objetivos de calidad. Los principales problemas son:  Crecimiento disperso: no se produce la biofloculación.  Bulking viscoso: exceso de polímeros extracelulares.  Flóculo punta de alfiler: poca presencia de bacterias filamentosas.  Bulking filamentoso: exceso de bacterias filamentosas.  Foaming o formación de espumas: asociado a determinadas tipos de bacterias filamentosas.  Otros: flotación de fangos 1.5. Composición de la microbiota El papel de los microorganismos es fundamental en el proceso de depuración de aguas residuales. La biomasa del fango activo está constituida por bacterias, protozoos, hongos, rotíferos, algas y nematodos. Los microorganismos más abundantes en el fango activo son las bacterias, constituyendo el 95% de la biomasa. Intervienen principalmente en la eliminación de materia orgánica por distintas vías y en la eliminación de nutrientes. Además, sin las bacterias formadoras de flóculo y las bacterias filamentosas sería imposible la sedimentación y la obtención de un efluente clarificado y de calidad. Los siguientes microorganismos en importancia, tanto en su abundancia como en su papel en el equilibrio de la biomasa, son los protozoos, constituyendo el 5% de la biomasa. Las funciones principales del grupo protista son: eliminación de patógenos y coliformes, clarificado del efluente y biofloculación. Los hongos bajo determinadas condiciones pueden proliferar pero rara vez compiten con las bacterias en la utilización de la materia orgánica disuelta, por lo tanto no son considerados de importancia en el proceso de depuración. El papel principal de las algas en los sistemas de depuración es el de proporcionar oxígeno a las bacterias para que éstas puedan participar activamente en la eliminación de materia orgánica del agua residual (Ferrer, 2007). La excesiva proliferación de algas puede dar lugar a graves problemas como atascos en las conducciones.
  22. 22. A.B. Andújar Máster en Ingeniería Ambiental 22 En los sistemas de fangos activos los rotíferos junto con los nematodos constituyen la cima de la cadena trófica. La principal función de estos microorganismos es la de depredar organismos inferiores. Los rotíferos eliminan bacterias dispersas y contribuyen a la formación del flóculo por la secreción de mucus. Son indicadores de un buen funcionamiento del proceso de depuración. La presencia de elevadas cantidades de rotíferos y nematodos indica una edad del fango alta y por lo tanto cambios en la capacidad de depuración del fango activo. 1.6. La importancia de las bacterias filamentosas Las bacterias filamentosas aparecen en todos los tipos de Estaciones Depuradoras de Aguas Residuales con procesos de fangos activos, siendo responsables de la mayoría de los problemas de bulking y foaming (Jenkins et al., 2004). Más de 30 morfotipos filamentosos han sido identificados en plantas de tratamiento de aguas residuales urbanas (Eikelboom, 2000) y muchos más han sido detectados en plantas que reciben agua de origen industrial (Eikelboom & Geurkink, 2002; Eikelboom, 2006). Las bacterias filamentosas deben ser consideradas como un miembro más de la comunidad biológica de los fangos activos que están involucradas en la degradación de la materia orgánica. En el anexo I se pueden consultar las fichas de los distintos morfotipos filamentosos estudiados en el presente trabajo. 1.6.1. Phylum Chloroflexi Los organismos del phylum Chloroflexi, previamente conocidos como “bacterias verdes no sulfureas” (Woese et al., 1987; Garrity & Holt et al., 2001) fueron asociados en un primer momento a hábitats extremos como ambientes hipersalinos (Nübel et al., 2001) donde aparecían como organismos anóxicos fototrofos (Hanada et al., 2002; Nübel et al., 2002). Posteriormente también se detectaron en los sedimentos superficiales del fondo marino (Huber et al., 2006) y en el suelo húmedo de la tundra alpina (Costello and Schmidt, 2006). Además se ha comprobado que estas bacterias filamentosas son muy abundantes tanto en plantas de tratamiento de aguas residuales urbanas como de aguas residuales de origen industrial por lo que se pueden prever cantidades elevadas de estos filamentos en el proceso de depuración de fangos activos (Beer et al., 2002; Björnsson et al., 2002; Kragelund et al., 2007; Speirs et al., 2009). El phylum Chloroflexi constituye el 12,6 % del total de la población microbiana del fango activo y por ello juega un papel importante en la formación del flóculo (Kragelund et al., 2011)
  23. 23. A.B. Andújar Máster en Ingeniería Ambiental 23 y en la aparición de episodios de bulking de forma ocasional (Jenkins et al., 2004; Kragelund et al., 2006). Dentro del phylum Chloroflexi se describieron cuatro clases bien diferenciadas: Anaerolineae, Dehalococcoidetes, Chloroflexi y Thermomicrobia (Hugenholz & Stackebrandt, 2004) siendo la más abundante en los fangos activos la clase Anaerolineae (Hugenholtz et al., 1998; Sekiguchi et al., 1999; Björnsson et al., 2002; Juretschko et al., 2002). Los filamentos bacterianos fototróficos termofílicos fueron incluidos en la clase Chloroflexi: Chloroflexus (Pierson and Castenholz, 1974), Oscillochloris (Gorlenko and Pivovarova, 1977) y Roseiflexus (Hanada et al., 2002). Dentro de la clase Dehalococcoidetes se aislaron bacterias anaerobias con actividad deshalogenasa en acuíferos contaminados por sustancias cloradas (Grostern & Edwards, 2006). Los filamentos termofílicos pertenecían a la clase Thermomicrobia (Oyaizu et al., 1987; Hensel et al., 1989). Recientemente se ha demostrado que la subdivisión Anaerolineae comprende dos clases, Anaerolineae y Caldilineae, que fueron aisladas del fango granular anaeróbico termofílico (Sekiguchi et al., 2003; Yamada et al., 2006). Estudios realizados en Estaciones Depuradoras de Aguas Residuales de origen municipal basados en la técnica FISH para la cuantificación de bacterias filamentosas han demostrado que el 9-17% del total de los filamentos del phylum Chloroflexi pertenecen al género Caldilinea (Yoon et al., 2010). Estudios ecofisiológicos (Kindaichi et al., 2004; Okabe et al., 2005; Kragelund et al., 2007; Miura et al., 2007; Miura& Okabe et al., 2008) revelan que el phylum Choloflexi constituye un grupo de bacterias filamentosas especializadas nutricionalmente consumidoras de carbohidratos, como glucosa y N-acetilglucosamina, y aminoácidos. Algunos de los filamentos pueden consumir ácidos grasos de cadena corta como piruvato y butirato pero nunca acetato (Kragelund et al 2006; Nielsen et al., 2009). Los filamentos del phylum Chloroflexi pueden ser considerados como bacterias especializadas capaces de degradar macromoléculas complejas como polisacáridos y proteínas (Nielsen et al., 2009). La incorporación de sustratos solubles por parte de las bacterias filamentosas del phylum Chloroflexi solo es observable bajo condiciones aerobias por lo que el metabolismo fermentativo observado en cultivos puros probablemente no juega un papel importante en los fangos activos (Nielsen et al., 2009). La superficie de los filamentos pertenecientes a este phylum parece ser más hidrofílica que la superficie de otras bacterias filamentosas del fango activo (Kragelund et al., 2006, Nielsen et al., 2009). Los filamentos suelen contener pequeños gránulos de polihidroxialcanoatos y se ha detectado actividad exoenzimética (Kragelund et al., 2007a). El phylum Choloflexi engloba muchos tipos de morfotipos Eikelboom como el tipo 0092, desclasificada del phylum Bacteriodetes y del género Flavobacterium, (Speirs et al., 2009), el
  24. 24. A.B. Andújar Máster en Ingeniería Ambiental 24 tipo 1851 (Beer et al., 2002; Kragelund et al., 2007), probablemente también el tipo 0041 con crecimiento epifítico (Kragelund et al., 2007) y el morfotipo 0581 desclasificado del phylum Actinobacteria (Zornoza et al., 2006). A continuación, en la figura 1, se muestra el posible árbol filogenético del phylum Chloroflexi. Figura 1. Árbol filogenético del phylum Chloroflexi basado en las secuencias genéticas de 16S rRNA de los clones aislados (Yoon et al., 2010). 1.6.1.1. Morfotipo 0803 El morfotipo Eikelboom 0803 ha sido asociado al género Caldilinea (Kragelund et al., 20011) dentro del phylum Chloroflexi y no en la subdivisión Rubrivivax de las betaproteobacterias como se había considerado previamente (Bradford et al., 1996). El tipo 0803 constituye alrededor del 20% del total de la población del phylum Choloflexi y junto con el morfotipo 0092 constituyen la fracción dominante de dicho phylum (Kragelund et al., 2011).
  25. 25. A.B. Andújar Máster en Ingeniería Ambiental 25 El morfotipo 0803 es localizado principalmente en la superficie de los flóculos, donde pueden ser observados asociados a granos de arena (Eikelboom, 2000; Jenkins et al., 2004). En estudios posteriores se observó que no siempre están asociados a granos de arena y localizados en la superficie del flóculo (Kragelund et al., 2011). Los filamentos del morfopito 0803 se caracterizan por ser cortos (< 50 µm) y rectos con un diámetro de 0.8 – 1.1 µm y pueden aparecer asociados a partículas inorgánicas y formando rosetas. Son normalmente filamentos Gram negativos pero ocasionalmente la tinción Gram puede variar. Con la tinción Neisser los filamentos aparecen como negativos aunque ocasionalmente aparecen con gránulos positivos (Kragelund et al., 2011). Este morfotipo filamentoso consume glucosa con oxígeno, nitrito y nitrato como aceptores de electrones por lo que podría ser desnitrificante. Además podría jugar un papel importante en la conversión de macromoléculas por la elevada expresión enzimática observada (Kragelund et al., 2011). El árbol filogenético del morfotipo filamentoso 0803 basado en las secuencias genéticas del 16S rRNA se muestra en la figura 2. Figura 2. Árbol filogenético del morfotipo filamentoso 0803 basado en el análisis comparativo de las secuencias genéticas del 16S rRNA (Kragelund et al., 2011).
  26. 26. A.B. Andújar Máster en Ingeniería Ambiental 26 1.6.1.2. Morfotipo 0914 El morfotipo filamentoso Eikelboom 0914 es identificado como un miembro del phylum Choloroflexi del subgrupo 1 (Speirs et al., 2010). El morfotipo es descrito como un filamento con un diámetro de 1-1,2 µm y una longitud inferior a 50 µm que se localiza tanto dentro como fuera del flóculo. Son bacterias Gram negativas y responden de forma negativa a la tinción Neisser. No presenta vaina ni crecimiento epifítico (Jenkins et al., 2004). Los morfotipos filamentosos 0803 y 0914 se consideraban a nivel convencional dos formas de un mismo organismo (Eikelboom et al., 2000), cuando un morfotipo 0803 aparecía, el tipo 0914 desaparecía y vice versa, por lo que se creía que eran dos formas complementarias del mismo filamento bacteriano. Posteriormente el morfotipo 0803 y el morfotipo 0914 fueron considerados dos organismos diferentes siendo la clave identificativa la presencia de gránulos irregulares de azufre in situ en el morfotipo 0914 (Jenkins et al., 2004). El árbol filogenético basado en las secuencias genéticas del 16S rRNA del morfotipo 0914 y otros miembros del phylum Chloroflexi se muestra en la figura 3. Figura 3. Árbol filogenético del morfotipo 0914 basado en las secuencias genéticas del 16S rRNA (Speirs et al., 2010).
  27. 27. A.B. Andújar Máster en Ingeniería Ambiental 27 1.6.1.3. Morfotipo 0092 El morfotipo 0092 ha sido desclasificado del phylum Bacteriodetes (Wagner et al., 1994; Bradford et al., 1997) para introducirlo dentro del phylum Choloflexi (Speirs et al., 2009). Este morfotipo aparece en plantas de fangos activos de todo el mundo, ha sido asociado a edades de fango elevadas (> 15 días) y a sistemas de eliminación de fosfatos (EBPR) donde la biomasa es reciclada repetidamente entre la zona anaerobia y la zona aerobia (Jenkins et al., 2004). El morfotipo 0092 ha sido descrito en un amplio rango de condiciones, se ha comprobado la presencia de esta bacteria filamentosa en condiciones aerobias, anaerobias y anóxicas (Wanner et al., 1989). Son descritos como filamentos cortos que se extienden desde el flóculo con un diámetro entre 0,8 y 1 µm. Presentan respuesta negativa a la tinción Gram y positiva a la tinción Neisser (Jenkins et al., 2004). Se han identificado dos variantes del morfotipo filamentoso 0092 diferenciándose en el diámetro del filamento (Speirs et al., 2009). El árbol filogenético basado en las secuencias genéticas del 16S rRNA del morfotipo 0092 y otros representantes del phylum Chloroflexi se muestra en la figura 4. Figura 4. Árbol filogenético del morfotipo 0092 basado en las secuencias genéticas del 16S rRNA (Speirs et al., 2009)
  28. 28. A.B. Andújar Máster en Ingeniería Ambiental 28 1.7. Identificación de morfotipos filamentosos 1.7.1. Microscopía convencional Los métodos clásicos se basan en la observación microscópica de las muestras para determinar las características morfológicas. Eikelboom (1975), estableció una nomenclatura basada en la observación microscópica de las características morfológicas, que actualizaron posteriormente otros autores (Jenkins et al. 2004). Los caracteres morfológicos en los que se basa la clasificación de Eikelboom (1975), y de Jenkins et al. (2004) son: presencia o ausencia de ramificaciones, movilidad, forma del filamento (curvo, irregular, enrollado, etc.), color, ubicación respecto al flóculo, existencia de crecimiento epífitico, vaina, septos, constricciones celulares, dimensiones celulares, dimensiones del filamento, forma celular (cuadrada, rectangular, ovalada, etc.), presencia de biopolímeros de azufre y gránulos de polifosfato, reacciones de tinción (Gram y Neisser) y formación de rosetas y gonidios. Los métodos convencionales son de gran ayuda para la observación de microorganismos en plantas de tratamiento de aguas residuales, sin embargo no dan información fiable sobre la identidad exacta de los filamentos observados, por ello, los filamentos son designados con los términos “tipo” o “morfotipo” en vez de especie. Hoy en día se sabe que un morfotipo específico puede incluir varias especies y también puede ocurrir lo contrario, que varios morfotipos puedan representar una sola especie. La identificación y cuantificación mediante las técnicas convencionales puede resultar dificultosa por una serie de razones:  Una misma especie puede mostrar polimorfismos o diferentes especies parecer iguales.  Los filamentos que se encuentran en el interior de los flóculos son difíciles de identificar y cuantificar.  El método convencional es subjetivo y depende del nivel de entrenamiento y de la experiencia del que realiza la cuantificación e identificación.  Estructura abierta de los flóculos.  Elevada población de filamentos. Los métodos clásicos complementan a las técnicas moleculares ya que proporcionan información de interés sobre las características del flóculo y la presencia de protozoos y otros microorganismos asociados. La microscopía convencional es considerada una herramienta indispensable para el control del proceso de depuración pero a nivel microbiológico realmente solo unas pocas bacterias filamentosas han podido ser identificadas según sus características
  29. 29. A.B. Andújar Máster en Ingeniería Ambiental 29 morfológicas, por ello actualmente se sabe que la identificación de las bacterias del fango activo no puede llevarse a cabo utilizando sólo el método convencional (Nielsen et al., 2009). 1.7.2. Técnica FISH para la identificación de bacterias filamentosas Los métodos moleculares han sido utilizados para la identificación y cuantificación de microorganismos filamentosos (Blackall, 1994; Bradford et al., 1996; Erhart et al., 1997; Kanagawa et al., 2000; Wagner et al., 1994), en particular la técnica FISH ha sido particularmente productiva a la hora de llevar a cabo dicho objetivo (Nielsen et al., 2009). La mayoría de los morfotipos filamentosos de Eikelboom no han sido nombrados siguiendo las reglas del Código Internacional de Nomenclatura y muchos reciben una identificación alfanumérica. Ello se debe principalmente a que muchos de estos microorganismos muestran una morfología celular diferente a la que presentan en los fangos activos. Esta situación está cambiando gracias al empleo de técnicas moleculares de caracterización y secuenciación del gen 16S rDNA, que empiezan a clarificar la posición taxonómica de los morfotipos de bacterias filamentosas. La hibridación in situ con sondas u oligonucleótidos 16S rDNA/23S rDNA marcadas con fluoróforos (FISH) ha sido una técnica común para la detección e identificación de microorganismos en diferentes ambientes microbianos, en los que se incluyen comunidades de bacterias como las presentes en los sistemas biológicos de depuración con fangos activos (Amann et al., 1995). Esta técnica se basa en la hibridación directa de la bacteria diana con una sonda complementaria de una región del gen 16S o 23S rRNA. El elevado número de moléculas de rRNA (103 -105 ) es una ventaja en la aplicación de la técnica de hibridación al aumentar su sensibilidad (Amann, 1994). Una secuencia de DNA (sonda) puede unirse con una secuencia de RNA complementaria (16 rRNA o 23S rRNA) y se produce un híbrido DNA: RNA. La sonda está marcada con una molécula fluorescente de tal forma que los híbridos formados se pueden detectar fácilmente con un microscopio de epifluorescencia. La especificad de las sondas puede ser ajustada a diferentes niveles taxonómicos como son dominio, phylum, clase, familia, género o especie para la identificación de las bacterias presentes en el fango activo. Las sondas deben ser lo suficientemente específicas para unirse únicamente a la bacteria que se quiere identificar. Para asegurar la especificidad, los dos parámetros determinantes son la temperatura y la concentración de formamida en el tampón de hibridación (Alonso et al., 2009). La formamida hace que disminuya la temperatura de unión de las sondas mediante el debilitamiento de los puentes de hidrógeno, es decir,
  30. 30. A.B. Andújar Máster en Ingeniería Ambiental 30 disminuye la temperatura de fusión de los híbridos DNA: RNA en 0,72ºC por cada 1% de formamida utilizada y permite realizar la hibridación a 46ºC (Alonso et al., 2009). La sonda que se utiliza en la técnica FISH está formada por una pequeña secuencia de nucleótidos de cadena sencilla, en cuyo extremo, normalmente 5´, se marca con un fluoróforo, como puede ser rodamina o fluoresceína. En la figura 5 se muestra un esquema simplificado del proceso de hibridación in situ con sondas marcadas con fluoróforos. Figura 5. Esquema del proceso Hibridación in situ (FISH) La técnica de hibridación con sondas marcadas con fluoróforos in situ (FISH), presenta una serie de ventajas frente a otras técnicas de detección e identificación. Son las siguientes:  Permite detectar varias especies o géneros en una misma muestra, utilizando una sonda para cada especie, género o grupo, marcada con fluoróforos distintos.  No parecen existir sustancias inhibidoras que interfieren en la reacción de hibridación.  Puede determinar directamente la abundancia de los microorganismos detectados.  No necesita cultivo previo de la bacteria ni la extracción de los ácidos nucleicos (Nielsen et al., 2009).  Las preparaciones pueden conservarse durante mucho tiempo (años).  Se mantiene la morfología de la célula (Nielsen et al., 2009). Además de todas las ventajas de la técnica molecular FISH anteriormente citadas, se aprecian ciertas limitaciones:  La identificación a través de FISH es solo posible si la sonda requerida está disponible.  Se han desarrollado sondas para varias especies filamentosas importantes, pero aún no para todas las especies que puedan aparecer en el fango activo.  Podría afectar las características morfológicas de las especies filamentosas.  Las bacterias filamentosas con bajo contenido ribosomal no dan una señal fluorescente clara con la sonda.
  31. 31. A.B. Andújar Máster en Ingeniería Ambiental 31  Puede ocurrir que una sonda específica para una especie de una señal fluorescente con otras especies, si sus composiciones de rRNA son muy parecidas. Tales resultados positivos falsos pueden ser prevenidos mediante la aplicación de sondas competidoras.  No entrega información sobre características importantes de fango, tales como la población de protozoos o las características del flóculo. 1.8. Parámetros operacionales del proceso de depuración La carga másica (CM) y la edad del fango (EF) son los parámetros más utilizados para el control de las depuradoras de aguas residuales (Andrés et al., 2011). La carga másica es un parámetro que trata de representar la relación existente entre la carga orgánica alimentada al reactor y los microorganismos presentes en él. Dada la dificultad de cuantificar los microorganismos presentes, suele definirse como la relación entre la DBO5 y los sólidos suspendidos volátiles del licor mezcla diarios en el reactor, o incluso puede definirse relacionando dicha DBO con los sólidos suspendidos totales del licor mezcla, por ello es muy importante al hablar de carga másica establecer a qué concentración de sólidos está referida (Ferrer, 2007). La edad de fango relaciona la masa de fango en el reactor con la masa de fangos eliminada diariamente, por lo que depende principalmente del régimen de purgas (Zornoza et al., 2011). Para la determinación de ambos parámetros es necesario tener en cuenta la inercia del sistema de fangos activos, es decir, la inercia de las poblaciones microbianas y la estructura flocular (Zornoza et al., 2011). Ambos parámetros han estado relacionados de forma proporcional e inversa, pero recientemente se ha demostrado que esta relación no siempre tiene lugar en plantas de tratamiento a escala real (Zornoza et al., 2011).
  32. 32. A.B. Andújar Máster en Ingeniería Ambiental 32
  33. 33. A.B. Andújar Máster en Ingeniería Ambiental 33 OBJETIVOS
  34. 34. A.B. Andújar Máster en Ingeniería Ambiental 34
  35. 35. A.B. Andújar Máster en Ingeniería Ambiental 35 2. OBJETIVOS El control efectivo de muchos de los problemas en el proceso de depuración se basa en la identificación de los microorganismos que lo causan y en la eliminación de las condiciones que favorecen su crecimiento. El crecimiento excesivo de bacterias filamentosas puede interferir en el funcionamiento correcto del sistema de fangos activos produciendo problemas como la deficiente sedimentación del fango o la formación de espumas. El principal objetivo de este trabajo es la identificación y cuantificación de determinados morfotipos filamentosos presentes en los fangos de varias depuradoras de la Comunidad Valenciana y relacionarlos con diferentes parámetros del proceso de fangos activos. Por todo ello, en el presente trabajo se plantean los siguientes objetivos:  Aplicar la técnica FISH a muestras procedentes de cuatro plantas depuradoras de aguas residuales urbanas con sistemas de fangos activos de la Comunidad Valenciana (Carraixet, Castellón, Denia y Quart Benàger) para detectar la presencia de los morfotipos filamentosos 0803, 0092 y 0914.  Determinar la abundancia de las bacterias filamentosas tipo 0803, 0092 y 0914 mediante la utilización de la escala subjetiva de Jenkins et al. (2004).  Comparar la abundancia de los morfotipos Eikelboom 0803, 0092 y 0914 obtenida con dos técnicas de detección diferentes: microscopía convencional e hibridación in situ con sondas marcadas con fluoróforo.  Estudiar las características morfológicas y estructurales de las bacterias filamentosas detectadas.  Estudiar las relaciones existentes entre los parámetros operacionales y físico- químicos de las EDAR y la abundancia de los tipos de bacterias filamentosas estudiadas.
  36. 36. A.B. Andújar Máster en Ingeniería Ambiental 36
  37. 37. A.B. Andújar Máster en Ingeniería Ambiental 37 MATERIAL Y MÉTODOS
  38. 38. A.B. Andújar Máster en Ingeniería Ambiental 38
  39. 39. A.B. Andújar Máster en Ingeniería Ambiental 39 3. MATERIAL Y MÉTODOS 3.1. Toma de muestras Se tomaron muestras del licor mezcla de cuatro EDAR de la Comunidad Valenciana con una frecuencia quincenal durante un año. A continuación se muestran los esquemas de funcionamiento y algunos datos de interés de las depuradoras elegidas para el presente estudio. 3.1.1. EDAR Quart Benàger (QB) La depuradora de Quart-Benàger se ubica en la comarca valenciana de L´Horta Oest. Da servicio a los municipios de Alacuás, Aldaia, Manises, Mislata, Quart de Poblet, Valencia y Xirivella. El tratamiento biológico tiene lugar en cuatro reactores paralelos Anóxico-Aerobio de geometría rectangular (figura 6). Según datos de 2008, trata un caudal de 34.240m3 , abastece a una población de 262.561 habitantes equivalentes y tiene unos rendimientos de eliminación del 94% para sólidos suspendidos, 96% para DBO5 y 92% para DQO. Figura 6. Diagrama de bloques de la EDAR QB 3.1.2. EDAR Cuenca del Carraixet (CX) La planta de depuración Cuenca del Carraixet se ubica en la comarca valenciana de L´Horta Nord, en el municipio de Alboraya, y es capaz de tratar agua procedente de 19 municipios consiguiendo unos rendimientos del 98% para SS y DBO5 y del 97 % para DQO, según la información publicada por la EPSAR en el año 2008.
  40. 40. A.B. Andújar Máster en Ingeniería Ambiental 40 Cuenta con dos líneas aerobias de tratamiento biológico, línea A+B y línea C+D, ambas con una zona anaerobia (figura 7). El caudal tratado es de 38.551m3 abasteciendo a una población de 230.631 habitantes equivalentes (he). Figura 7. Diagrama de bloques de la EDAR CX 3.1.3. EDAR Dénia-Ondara (DE) La EDAR Denia-Ondara se ubica en la comarca de La Marina Alta, en la provincia de Alicante. Da servicio a los municipios de Denia, Ondara y Pedreguer. Trata un caudal de 18.138m3 y abastece a una población de 539.770 habitantes equivalentes según datos del año 2008 publicados por la EPSAR. El tratamiento consta de una sola línea con proceso de oxidación total y tiene un rendimiento de eliminación del 96% para sólidos suspendidos, 96% de DBO5 y 94% de DQO (figura 8). Figura 8. Diagrama de bloques de la EDAR DE
  41. 41. A.B. Andújar Máster en Ingeniería Ambiental 41 3.1.4. EDAR Castellón de la Plana (CS) La EDAR de Castellón de la Plana se encuentra localizada en la comarca de la Plana Alta en la provincia de Castellón, no prestando servicio a ningún municipio más. Para el año 2010 el caudal tratado era de 42.748m3 /d, prestando servicio a 202.812 habitantes equivalentes (he). Los rendimientos de eliminación son los siguientes: 96% para SS, 95% para DBO5 y 93% para DQO (figura 9). Figura 9. Diagrama de bloques de la EDAR CS El anexo II recoge varías fotografías de las vistas aéreas de las cuatro EDAR estudiadas. 3.2. Muestreo El muestreo se realizó siempre en el mismo punto, generalmente a la salida del reactor biológico. Se tomaron 1500ml de licor mezcla con un recipiente de plástico, de estas muestras se tomaron unas alícuotas para su fijación que se realizó antes de las 24 horas. Si la planta presentaba problemas de espumas se tomaron muestras tanto del licor mezcla como de las espumas de forma independiente. Los muestreos se realizaron cada quince días durante el año 2009. El muestreo comenzó en diciembre de 2008 y finalizó en diciembre de 2009. Las muestras fueron simples realizadas de forma puntual. Para el transporte y conservación de las muestras fue necesario mantener las condiciones aerobias de la muestra, lo cual se logró con la cámara de aire que queda sobre el licor mezcla en el bote. Todas las EDAR estudiadas tratan aguas de origen doméstico, aunque las plantas de tratamiento de Quart Benàger y Carraixet reciben además aguas industriales.
  42. 42. A.B. Andújar Máster en Ingeniería Ambiental 42 En la tabla 1 se muestra el número de líneas de tratamiento independientes de cada EDAR y el número de muestreos realizados en cada punto. Tabla 1. Número de muestras por depuradora EDAR NÚMERO DE MUESTRAS Abreviatura Nº líneas REACTOR ESPUMAS QB 1 24 - DE 1 24 - CX* 2 (A+B y C+D) 46 9 CS 2 (R1 y R2) 46 - * Planta con problemas de espumas A continuación se muestra una relación de fechas de muestreos por depuradora estudiada (tabla 2):
  43. 43. A.B. Andújar Máster en Ingeniería Ambiental 43 Tabla 2. Relación de muestras estudiadas QB DE CS CX 04/12/2008 R. 10/12/2008 R. 03/12/2008 R. 1 03/06/2009 R. 2 10/12/2008 R.( A+B) 22/07/2009 R.( A+B) 17/12/2008 R. 22/12/2008 R. 03/12/2008 R. 2 17/06/2009 R. 1 10/12/2008 R. (C+D) 22/07/2009 R. (C+D) 14/01/2009 R. 08/01/2009 R. 17/12/2008 R. 1 17/06/2009 R. 2 23/12/2008 R.( A+B) 16/09/2009 R.( A+B) 28/01/2009 R. 21/01/2009 R. 17/12/2008 R. 2 01/07/2009 R. 1 23/12/2008 R. (C+D) 16/09/2009 R. (C+D) 11/02/2009 R. 04/02/2009 R. 15/01/2009 R. 1 01/07/2009 R. 2 07/01/2009 R.( A+B) 30/09/2009 R.( A+B) 25/02/2009 R. 18/02/2009 R. 15/01/2009 R. 2 15/07/2009 R. 1 07/01/2009 R. (C+D) 30/09/2009 R. (C+D) 11/03/2009 R. 04/03/2009 R. 28/01/2009 R. 1 15/07/2009 R. 2 21/01/2009 R.( A+B) 14/10/2009 R.( A+B) 28/03/2009 R. 16/03/2009 R. 28/01/2009 R. 2 09/09/2009 R. 1 21/01/2009 R. (C+D) 14/10/2009 R. (C+D) 07/04/2009 R. 01/04/2009 R. 11/02/2009 R. 1 09/09/2009 R. 2 04/02/2009 R.( A+B) 27/10/2009 R.( A+B) 22/04/2009 R. 29/04/2009 R. 11/02/2009 R. 2 23/09/2009 R. 1 04/02/2009 R. (C+D) 27/10/2009 R. (C+D) 06/05/2009 R. 13/05/2009 R. 25/02/2009 R. 1 23/09/2009 R. 2 18/02/2009 R.( A+B) 11/11/2009 R.( A+B) 20/05/2009 R. 27/05/2009 R. 25/02/2009 R. 2 07/10/2009 R. 1 18/02/2009 R. (C+D) 11/11/2009 R. (C+D) 03/06/2009 R. 10/06/2009 R. 11/03/2009 R. 1 07/10/2009 R. 2 04/03/2009 R.( A+B) 25/11/2009 R.( A+B) 17/06/2009 R. 24/06/2009 R. 11/03/2009 R. 2 21/10/2009 R. 1 04/03/2009 R. (C+D) 25/11/2009 R. (C+D) 01/07/2009 R. 08/07/2009 R. 25/03/2009 R. 1 21/10/2009 R. 2 01/04/2009 R.( A+B) 09/12/2009 R.( A+B) 15/07/2009 R. 22/07/2009 R. 25/03/2009 R. 2 04/11/2009 R. 1 01/04/2009 R. (C+D) 09/12/2009 R. (C+D) 09/09/2009 R. 16/09/2009 R. 22/04/2009 R. 1 04/11/2009 R. 2 29/04/2009 R.( A+B) 21/12/2009 R.( A+B) 23/09/2009 R. 30/09/2009 R. 22/04/2009 R. 2 18/11/2009 R. 1 29/04/2009 R. (C+D) 21/12/2009 Esp. A+B 07/10/2009 R. 14/10/2009 R. 06/05/2009 R. 1 18/11/2009 R. 2 13/05/2009 R.( A+B) 21/12/2009 Esp. C+D 21/10/2009 R. 11/11/2009 R. 06/05/2009 R. 2 16/12/2009 R. 1 13/05/2009 R. (C+D) 14/10/2009 R.( A+B) 04/11/2009 R. 11/11/2009 R. 20/05/2009 R. 1 16/12/2009 R. 2 27/05/2009 R.( A+B) 14/10/2009 Esp. C+D 18/11/2009 R. 25/11/2009 R. 20/05/2009 R. 2 29/12/2009 R. 1 27/05/2009 R. (C+D) 27/10/2009 R (A+B) 16/12/2009 R. 15/12/2009 R. 03/06/2009 R. 1 29/12/2009 R. 2 10/06/2009 R.( A+B) 27/10/2009 Esp. C+D 29/12/2009 R. 21/12/2009 R. 10/06/2009 R. (C+D) 11/11/2009 Esp. A+B 24/06/2009 R. (A+B 11/11/2009 Esp. C+D 24/06/2009 R. (C+D) 25/11/2009 R.( A+B) 08/07/2009 R.( A+B) 09/12/2009 R.( A+B) 08/07/2009 R. (C+D)
  44. 44. A.B. Andújar Máster en Ingeniería Ambiental 44 3.3. Parámetros físico-químicos y variables operacionales Los parámetros físico-químicos se determinaron siguiendo los procedimientos normalizados (APHA, 1998). Las tablas 3 y 4 muestran los parámetros medidos en las muestras de las distintas EDAR. El índice Volumétrico de Fango (IVF) se calculó según el procedimiento descrito por Jenkins et al, 2004. Tabla 3. Parámetros físico-químicos determinados en el licor mezcla Parámetro Abreviatura Unidades Conductividad CondLM μmS/cm Sólidos suspendidos en el licor mezcla SSLM mg/l Sólidos suspendidos volátiles del licor mezcla SSVLM mg/l Porcentaje de Sólidos suspendidos volátiles del licor mezcla % SSVLM % Índice volumétrico del fango IVF ml/g Nitrógeno total del licor mezcla NTLM mg/gSSVLM Fósforo total del licor mezcla PTLM mg/gSSVLM Demanda Química de Oxígeno del licor mezcla DQOLM g/g SSVLM Tabla 4. Parámetros físico-químicos determinados en el afluente al reactor y en efluente del decantador secundario Parámetros Abreviatura Unidades Afluente Efluente Demanda Química de Oxígeno Total DQOt mg/l x - Demanda Química de Oxígeno soluble DQOs mg/l x - Demanda Biológica de Oxígeno Total DBOt mg/l x - Demanda Biológica de Oxígeno Filtrada DBOf mg/l x - Nitrógeno Total NT mg/l x - Nitógeno Amoniacal N-NH4 + mg/l x X Nitrógeno nitroso N-NO2 - mg/l - X Nitrógeno nítrico N-NO3 - mg/l - X Fósforo Total PT mg/l x - Fósforo del ortofosfato P-PO4 3- mg/l x - La tabla 5 muestra las variables operacionales determinadas durante la campaña de muestreo. Los valores de oxígeno disuelto (OD) en el reactor fueron distribuidos en tres intervalos: <0,8, 0,8-2 y <2 ppm. Debido a la inercia del proceso biológico, los valores de carga másica (CM) y tiempo de retención hidráulico en el reactor (TRHr) se determinaron calculando el promedio de los tres días anteriores al muestreo del licor mezcla. La EF determinada para cada depuradora fue aquella en la que el proceso se encontraba más estable. Para dos de las depuradoras se utilizó la EF5 (suma de las variables correspondientes de los cinco días anteriores a la toma de muestra) y para las otras dos restantes la EF7 (suma de las variables de los siete días anteriores).
  45. 45. A.B. Andújar Máster en Ingeniería Ambiental 45 Tabla 5. Variables operacionales Parámetro Abreviatura Unidades Tiempo de retención hidráulico en reactor TRHr Horas (h) Carga másica CM kgDBO5/kgSSVLM.d Edad de fango EF Días Oxígeno disuelto en reactor ODb, ODm, Oda % 3.4. Fijación y permeabilización de las muestras Para llevar a cabo la técnica FISH fue necesario fijar las bacterias. Este primer paso es necesario para que la estructura celular se mantenga rígida y estática y se conserve su morfología favoreciendo la penetración de las sondas. Las células deben ser permeabilizadas, para ello se utilizan detergentes como el SDS (sodio dodecil sulfato). Para la fijación de las muestras se utilizó un reactivo diferente según la pared celular de la bacteria (Gram positiva y Gram negativa). En el caso de las bacterias Gram negativas la permeabilización se realizó con paraformaldehido. Una vez fijadas las muestras, se conservan a -20ºC. Los pasos y reactivos para la fijación y permeabilización se describen en detalle a continuación para bacterias Gram negativas:  Lavar 1ml de flóculo con 500µl de PBS 1X (7000 r.p.m durante 3 minutos).  Añadir 3 vols de PFA (750 µl) a 1 vol (250 µl) de muestra y mantener a 4ºC durante 1-3 h. (mínimo 1h- máximo 18h).  Concentrar las células por centrifugación (7000 r.p.m durante 3 minutos) y eliminar fijador.  Lavar las células con PBS 1X (500 µl).  Resuspender las células con con PBS 1X (500 µl) y etanol absoluto (500 µl) y mantener a -20ºC La figura 10 describe los pasos a realizar en función del tipo de bacteria a fijar, en este caso se destaca la fijación para bacterias Gram negativas.
  46. 46. A.B. Andújar Máster en Ingeniería Ambiental 46 Figura 10. Fijación de las muestras 3.5. Hibridación in situ con sondas fluorescentes (FISH) 3.5.1. Preparación de reactivos para FISH A continuación se describe el protocolo de preparación de los reactivos necesarios en los procesos de fijación, lavado e hibridación.  Paraformaldehido (para fijación)  Calentar 65 ml de agua bidestilada hasta 60ºC.  Añadir 4 g de paraformaldehido (PFA).  Añadir 1 gota de una solución de NaOH 2M y agitar rápidamente hasta que la solución se haya clarificado.  Quitar de la fuente de calor y añadir 33 ml de PBS 3X.  Ajustar el pH a 7,2 con HCl.  Eliminar cualquier resto de cristales por filtración a través de 0,2 m.  Enfriar rápidamente a 4ºC y conservar a esta temperatura.
  47. 47. A.B. Andújar Máster en Ingeniería Ambiental 47  Tampón fosfato salino (para fijación)  Concentración PBS 1X NaCl.............…..…..7,60 g NaH2PO4∙H2O....... 1,38 g NaH2PO4∙H2O....... 1,78 g Agua destilada.......1000 mL pH 7,2  Concentración PBS 3X NaCl.................... 22,8 g NaH2PO4∙H2O.... 4,1 g Na2HPO4∙H2O..... 5,3 g Agua destilada .... 1000 ml PH 7,2 Preparación: Primero disolver los fosfatos y luego el cloruro sódico. Esterilizar por filtración 0,45 m ó 0,2 m y conservar a 4ºC.  Solución de gelatina (para preparación de portaobjetos) Gelatina.................................... 0,1% Sulfato potasico cromato ........ 0,01% (Sigma ref. C-5926, 12H20)  Calentar previamente el agua destilada hasta 60ºC.  Fundir la gelatina (100 mg 0,1% + 10 mg sal de cromato 0,01%) en 100 ml de agua destilada.  Enfriar a 50ºC para sumergir los portas.  Solución de limpieza de portaobjetos (para preparación de portaobjetos) Etanol con 10% KOH  Etanol (para deshidratación)  50%  80%  100%  Cloruro sódico 5M ( para tampón de hibridación y tampón de lavado) Cloruro sódico.......... 292.2 g Agua destilada.......... 1000 ml Disolver el NaCl en 800 ml de agua destilada y ajustar el volumen hasta 1 litro. Distribuir en alícuotas. Esterilizar en autoclave 121ºC durante 15 minutos y por filtración.
  48. 48. A.B. Andújar Máster en Ingeniería Ambiental 48  EDTA 0,5M (cuando la concentración de formamida es mayor o igual a 20%) EDTA 2H2O.....................186,1 g Agua destilada................ hasta 1000 mL Preparación: pesar el EDTA y añadir a 800 mL de agua destilada. Ajustar el pH a 8,0 con NaOH (el reactivo no se disuelve hasta ajustar el pH a 8,0). Completar hasta 1000 mL con agua destilada. Esterilizar en autoclave 121ºC durante 15 minutos y por filtración.  Tris-HCl pH 8.0 (tampón de hibridación y tampón de lavado) Tris Base ........................ 121,1 g H-Cl.................................. 42 ml de HCl concentrado Agua destilada................ hasta 1000 ml Preparación: pesar el Tris y añadir a 800 ml de agua destilada. Añadir 42 ml de HCl concentrado y completar hasta 1000 ml con agua destilada. Esterilizar en autoclave 121ºC durante 15 minutos y filtración.  SDS 10% (para tampón de hibridación y tampón de lavado) SDS ........................ 10 g Agua destilada....... Hasta 100 ml Esterilizar por filtración.  Agua Milli-Q  Reactivo de montaje para evitar la pérdida de fluorescencia. Vectashield 3.5.2. Tratamiento de los portaobjetos cubiertos con Teflón Todos los portaobjetos utilizados en la técnica FISH se han de lavar y desengrasar. Previamente a su empleo se les debe dar un baño en una solución de gelatina y de sulfato de potasio y cromo para favorecer la adhesión de la muestra. A continuación se detallan los pasos a seguir para el tratamiento de los portaobjetos:  Lavar con solución de limpieza.  Enjuagar con agua destilada.  Secar al aire (dejar escurrir todo 1 día, protegiendo del polvo ambiental cubriendo los portas con papel aluminio).  Cubrir con gelatina por inmersión en la solución de gelatina 0,1% con cromato sulfato potásico 0,01% (preparada en el momento, temperatura 60ºC).  Secar al aire.
  49. 49. A.B. Andújar Máster en Ingeniería Ambiental 49 3.5.3. Aplicación de las muestras a los portaobjetos Los pasos para la aplicación de las muestras se describen a continuación:  Poner un volumen entre 3 y 5 µl de muestra fijada al portaobjetos FISH. En este caso se ha puesto un volumen de 4 µl en cada pocillo del portaobjetos.  Secar al aire.  Deshidratar en etanol 50% durante 3 minutos por inmersión.  Deshidratar en etanol 80% durante 3 minutos por inmersión.  Deshidratar en etanol 100% durante 3 minutos por inmersión  Secar al aire. 3.5.4. Sondas utilizadas Las diferentes sondas utilizadas en las hibridaciones, así como su secuencia de nucleótidos del extremo 5´al 3´ y el porcentaje de formamida óptimo a utilizar se muestran en la tabla 6. Las sondas marcadas con el fluoróforo TAMRA (rodamina, cuya longitud de onda de absorción es de 565nm y de emisión de 580nm, rojo) fueron las siguientes: Caldi-0678, T0803-0654, T0803ind-0642, CFX197, CFX223, CFX67a y CFXMIX (CFX1223+GNSB941) Sólo una sonda se marcó con FAM (Fluoresceína) cuya longitud de onda absorción es de 494 nm y de emisión de 518nm (verde): CFX67b.
  50. 50. A.B. Andújar Máster en Ingeniería Ambiental 50 Tabla 6. Sondas empleadas en la identificación de las bacterias filamentosas Sonda Especificidad Secuencia % FA* Referencia Caldilinea Caldi-0678 Género Caldilinea TTCCACCACTACACCGGG 30 Kragelund et al. (2011) Comp1-Caldi-0678 Sonda competidor 1 TTTCACCACTACACCGGG - Kragelund et al. (2011) Comp2-Caldi-0678 Sonda competidor 2 TTCCACCGCTACACCGGG - Kragelund et al. (2011) Tipo0803 T0803-0654 Morfotipo 0803 ACACC CTCTCACYRCCT 30 Kragelund et al. (2011) T0803ind-0642 Morfotipo 0803 CTGCCTCAAGCTACTCAG 30 Kragelund et al. (2011) h1 T0803ind-0607 Helper AGTTAAGCCAGGAGATTT - Kragelund et al. (2011) h2 T0803ind-0625 Helper TTTCCAACGACCCCTCCC - Kragelund et al. (2011) h3 T0803ind-0662 Helper GAATTCTACACCCCTCTC - Kragelund et al. (2011) h4 T0803-0680 Helper ATTCCACCACTACACCGG - Kragelund et al. (2011) TIPO0092 CFX197 Variante A TCCCGGAGCGCCTGAACT 40 Speirs et al. (2009) CFX197comp Sonda competidora TCCCGAAGCGCCTGAACT - Speirs et al. (2009) CFX223 Variante B GGTGCTGGCTCCTCCCAG 35 Speirs et al. (2009) CFX223 H202 Helper AGCGCCTGAGCTTCAGTCATC - Speirs et al. (2009) CFX223 H241 Helper CGTTACCTTACCAACTAGCTGATGG - Speirs et al. (2009) TIPO0914 CFX67a Tipo 0914 TTCCGAAGATCAGGTTCG 35 Speirs et al. (2010) CFX67-H46 Helper TTCGACTTGCATGTGTTARGC - Speirs et al. (2010) CFX67 comp Sonda competidora TTCCGAAGATCGGGTTCG - Speirs et al. (2010) CFX67b Tipo 0914 TTCCGAAGATTAGGTTCG 35 Speirs et al. (2010) CFX67-H95 Sonda helper CCGTRCGCCACTAACCYT - Speirs et al. (2010) PhylumChloroflexi CFX1223 Phylum Chloroflexi CCATTGTAGCGTGTGTGTMG 35 Björnsson et al. (2002) CFX1223-H1206 Helper CCCWGGAYATAAAGGCC - Speirs et al. (2010) CFX1223-H1243 Helper TTTAGCAACYYATTGTACCGR - Speirs et al. (2010) GNSB914 Phylum Chloroflexi AAACCACACGCTCCGCT 35 Gich et al. (2001) GNSB914-H927 Helper GCTTGTGCGGGCCC - Speirs et al. (2010) GNSB941-H958 Helper TTCTTCGYGTTGCATCGAATT - Speirs et al. (2010) * Porcentaje de formamida óptimo para la hibridación. 3.5.5. Hibridación “in situ” Los pasos y reactivos del proceso de hibridación se describen en detalle a continuación:  En primer lugar se prepara la solución de hibridación con formamida en un microtubo de 2 ml. La cantidad de reactivos dependerá del porcentaje óptimo de formamida que a su vez dependerá de la sonda utilizada (tabla 7). Tabla 7. Solución de hibridación según porcentaje de formamida Reactivo % DE FORMAMIDA 10% 20% 25% 30% 35% 40% 45% NaCl 5M 360l 360l 360l 360l 360l 360l 360l HCl-Tris 1M 40l 40l 40l 40l 40l 40l 40l Formamida 200l 400l 500l 600l 700l 800l 900l H2O MiliQ 1398l 1198l 1098l 998l 898l 798l 698l SDS 10% 2l 2l 2l 2l 2l 2l 2l Volumen Final 2000 l 2000 l 2000 l 2000 l 2000 l 2000 l 2000 l
  51. 51. A.B. Andújar Máster en Ingeniería Ambiental 51  Poner 9l de la solución de hibridación + 1l de sonda en cada pocillo y repartir homogéneamente por todo el campo. En el caso de que junto con la sonda se tengan que añadir sondas competidoras y/o helper se deberá hacer una combinación de todos ellos con la sonda hasta alcanzar la cantidad de 1 l. A partir de la puesta en contacto con la sonda hay que evitar el contacto con la luz para evitar la pérdida de fluorescencia del fluoróforo.  Poner un trozo de papel de celulosa dentro de un tubo Falcon de 50ml y echar sobre el papel la solución de hibridación sin sonda que sobra, este paso es necesario para crear una atmósfera húmeda.  Introducir el portaobjetos dentro del tubo Falcon de 50ml en posición horizontal.  Incubar a 46ºC durante al menos1h 30 min.  Para eliminar el exceso de sonda que no ha hibridado y la formamida de los portaobjetos se prepara 50 ml de solución de lavado mezclando los reactivos presentes en la siguiente tabla dependiendo del porcentaje de formamida que ha sido utilizado en la solución de hibridación (tabla 8) Tabla 8. Solución de lavado según porcentaje de formamida Reactivo % DE FORMAMIDA 10% 20% 25% 30% 35% 40% 45% NaCl 5M 4500l 2150l 1490l 1020l 700l 460l 300l EDTA 0,5M - 500l 500l 500l 500l 500l 500l HCl-Tris 1M 1000l 1000l 1000l 1000l 1000l 1000l 1000l H2O MiliQ 44,45ml 46,3ml 47,94ml 47,43l 47,75ml 47,06l 48,15ml SDS 10% 50 l 50l 50l 50l 50l 50l 50l Volumen Final 50 ml 50 ml 50 ml 50 ml 50 ml 50 ml 50 ml  Sacar de la estufa y rápidamente lavar los portaobjetos e introducirlos dentro del tubo con la solución de lavado, los tubos se forran con papel de aluminio para protegerlos de la luz. Incubar en un baño a 48ºC durante 15-20 minutos.  Lavar con agua MilliQ.  Secar al aire en la oscuridad.  Si no se observa al microscopio inmediatamente, guardar el porta a -20ºC. 3.6. Observación al microscopio Una vez realizada la hibridación in situ con las sondas específicas se procede a la observación con el microscopio y a la toma de imágenes. A la hora de observar las muestras con el microscopio de epifluorescencia se precisa utilizar un líquido de montaje (Vectashield) para evitar la pérdida de fluorescencia. Se añaden
  52. 52. A.B. Andújar Máster en Ingeniería Ambiental 52 unas gotas de este líquido en la zona central del portaobjetos y se coloca encima un cubreobjetos, con ayuda de una punta se ejerce una pequeña presión sobre éste para que el líquido de montaje se extienda de forma uniforme por toda la muestra, a continuación se observa el pocillo a 60X o a 100X con aceite de inmersión. El microscopio utilizado para la observación de las muestras ha sido un Olimpus BX 50. Las fotografías en color se realizaron con una cámara digital Olimpus DP 10 acoplada al microscopio con los filtros: U-MWIB (Fluoresceína, FAM) y U-MWIG (Rodamina, TAMRA). 3.7. Identificación y cuantificación de microorganismos filamentosos Uno de los objetivos del presente estudio fue la comparación de los resultados de abundancias de determinados morfotipos filamentosos obtenidos con la microscopía clásica y utilizando la técnica molecular FISH. A continuación se indican las dos técnicas utilizadas en la identificación y cuantificación de las bacterias filamentosas en el presente estudio:  Técnica convencional La observación de los filamentos bacterianos del flóculo mediante métodos clásicos se realizó antes de las 48 horas posteriores a la toma de muestras. Las técnicas convencionales utilizadas para la identificación y cuantificación de los distintos morfotipos filamentosos se muestran en la tabla 9. Tabla 9. Identificación de morfotipos filamentosos mediante métodos clásicos Morfotipos Técnica Tipo 0914/0803 Sobre muestras en vivo. Microscopía de contraste de fases Tipo 0092 Sobre muestras fijadas en tinción Neisser. Microscopía de campo claro. Se estimó la densidad de filamentos aplicando la escala subjetiva (0-5) propuesta por Eikelboom (2000, 2006) y Jenkins et al. (2004).  Técnica FISH Para la cuantificación de los microorganismos se realizó un barrido de todos los pocillos del portaobjetos con el microscopio de epifluorescencia una vez realizado el proceso de hibridación in situ. Se realizó la valoración de la abundancia de las bacterias filamentosas utilizando la escala subjetiva de Eikelboom (2000,2006) y Jenkins et al. (2004).
  53. 53. A.B. Andújar Máster en Ingeniería Ambiental 53 La escala de valoración de los organismos filamentosos se muestra en la tabla 10. En la figura siguiente se muestra la escala utilizada para valorar la abundancia de las bacterias filamentosas (figura 11) Figura 11. Criterio de valoración de abundancia de filamentos 3.8. Análisis estadístico Para el análisis estadístico de las variables (operacionales y físico-químicas) medidas se utilizó el paquete informático SPSS versión 19.0. En primer lugar se realizó un análisis bivariante para establecer la relación existente entre la abundancia de los distintos morfotipos filamentosos con las variables operacionales y físico- químicas del proceso de depuración de cada una de las EDAR por separado. Seguidamente se integraron todos los datos de las cuatro depuradoras para obtener una matriz general con un Tabla 10. Escala de valoración de organismos filamentosos FI Abundancia Descripción 0 “Ninguno” Ningún filamento presente 1 “Pocos” Pocos filamentos y de forma ocasional en el flóculo 2 “Algunos” Filamentos en aproximadamente la mitad de los flóculos 3 “Comunes” Filamentos en todos los flóculos con baja densidad (1- 5/flóculo) 4 “Muy comunes” Filamentos en todos los flóculos con densidad media (5-20/ flóculo) 5 “Abundantes” Filamentos en todos los flóculos con alta densidad (>20/ flóculo)
  54. 54. A.B. Andújar Máster en Ingeniería Ambiental 54 elevado número de muestras y realizar un nuevo análisis bivariante. La figura 12 muestra de forma esquemática el tratamiento estadístico de los datos. Figura 12. Esquema análisis estadístico Este tratamiento estadístico consistió en el cálculo del coeficiente de correlación de Spearman. Para que los datos siguieran una distribución normal se realizó la siguiente transformación: Ln (variable +1), (Esteban et al., 1991). La metodología para calcular el coeficiente de Spearman consiste en ordenar todos los casos para cada una de las variables de interés y asignar un rango consecutivo a cada observación de cada una de las variables por separado. Si la asociación lineal entre ambas variables fuera perfecta, esperaríamos que el rango de la variable X fuera exactamente igual al rango de la variable Y, por lo tanto el coeficiente se calcula en base a las diferencias registradas en los rangos entre ambas variables, esperando que estas diferencias fueran 0. Conforme mayores son las diferencias observadas en las ordenaciones de ambas variables, más se alejaría la relación de ser perfecta. Para evitar que las diferencias positivas anularan las diferencias negativas y comportaran la toma de decisiones equivocadas, el estadístico se calcula en función de la suma de las diferencias elevadas al cuadrado. ∑
  55. 55. A.B. Andújar Máster en Ingeniería Ambiental 55 donde: di: diferencia entre los dos rangos. N: número de valores de la muestra. El coeficiente evalúa si existe una relación lineal, creciente o decreciente, entre ambas variables. El coeficiente de correlación de Spearman únicamente puede adoptar valores comprendidos entre -1 y 1, identificando el valor de -1 una relación decreciente perfecta, mientras que por el contrario, el valor 1 identificaría una relación lineal creciente perfecta. Intuitivamente, el coeficiente de correlación debe examinar la relación lineal de dos variables por lo que imaginemos que si la relación es muy evidente, los puntos se separarán muy poco de la línea de puntos imaginaria y si, por el contrario, la relación es muy débil, entonces la nube de puntos se ensanchará tanto que será imposible extraer conclusiones sobre algún tipo de relación. Aunque no existen valores estandarizados, a título indicativo se presenta la interpretación de sus valores por intervalos en la tabla 11: Tabla 11. Intervalos de coeficientes de correlación Coeficiente Interpretación 0 Relación nula 0-0,2 Relación muy baja 0,2-0,4 Relación baja 0,4-0,6 Relación moderada 0,6-0,7 Relación alta 0,8-1 Relación muy alta 1 Relación perfecta La prueba de significación asociada al coeficiente, únicamente prueba la hipótesis nula de que el coeficiente pueda ser igual a 0, es decir, que no exista ninguna relación lineal entre ambas variables. La prueba de significación del coeficiente, únicamente prueba la hipótesis nula de que el coeficiente pueda ser igual a cero, es decir, que no exista una relación lineal ente ambas variables. El nivel de significación “p” representa la probabilidad de error que se comete al aceptar el resultado observado como válido. En el análisis estadístico realizado en este estudio se han considerado dos niveles de significación: 0,05 y 0,01. Con un nivel de significación de 0,01 se comete un error menor al aceptar las correlaciones entre las variables estudiadas. Si p 0,01 existe una probabilidad del 1% de que la relación entre las variables sea fruto del azar.
  56. 56. A.B. Andújar Máster en Ingeniería Ambiental 56
  57. 57. A.B. Andújar Máster en Ingeniería Ambiental 57 RESULTADOS
  58. 58. A.B. Andújar Máster en Ingeniería Ambiental 58
  59. 59. A.B. Andújar Máster en Ingeniería Ambiental 59 4. RESULTADOS Los resultados presentados a continuación corresponden a la comparación de las abundancias de los morfotipos 0803, 0914 y 0092 según la técnica convencional y el método molecular FISH, al estudio de la morfología de los distintos filamentos bacterianos del phylum Chloroflexi observados en las muestras y a un análisis estadístico bivariante entre los morfotipos filamentosos y los distintos parámetros del proceso de depuración de fangos activos. Se ha realizado un análisis preliminar de los datos obtenidos, quincenalmente durante el año 2009, en las cuatro EDAR estudiadas. En primer lugar se realizó el análisis estadístico bivariante de los datos de cada depuradora de forma independiente para obtener un estudio individualizado de las abundancias de los morfotipos filamentosos y su relación con los parámetros operacionales y físico- químicos del proceso de depuración. Posteriormente los datos de las cuatro depuradoras se integraron para obtener una matriz general de datos y realizar un estudio estadístico bivariante con mayor número de muestras. 4.1. Cuantificación e identificación de los morfotipos filamentosos 4.1.1. Microscopía Convencional Los resultados de las abundancias según el método convencional fueron extraídos del Estudio Integrado del proceso de Fangos activos financiado por la EPSAR. Las bacterias filamentosas se identificaron mediante una serie de características morfológicas como puede apreciarse en las figuras 13 y 14. La microscopía convencional no permitió identificar los morfotipos 0803 y 0914 como organismos diferentes basándose en las características morfológicas, por lo tanto su cuantificación se realizó como un único filamento Figura 13. Morfotipo 0803/0914 identificado mediante microscopía convencional (a) QB (b) CS. BA
  60. 60. A.B. Andújar Máster en Ingeniería Ambiental 60 Figura 14. Morfotipo 0092 identificado mediante microscopía convencional (a) QB (b) DE. Según la microscopía convencional el morfotipo 0803/0914 y el tipo 0092 se identificaron en todas las líneas de tratamiento de las EDAR estudiadas. Se calculó los IF promedios de cada filamento para cada depuradora como se muestra en la figura 15. El morfotipo 0803/0194 apareció con abundancias elevadas en las EDAR de QB, DE y CS. El tipo 0092 fue poco abundante en las EDAR de QB y CX. El método convencional proporcionó unos valores aproximados de la abundancia de los morfotipos filamentosos detectados. Figura 15. Valores promedio de IF de los morfotipos filamentosos en cada una de las líneas de tratamiento según microscopía convencional. 4.1.2. Técnica molecular FISH La sonda T0803ind-0642 se utilizó para la detección e identificación de filamentos pertenecientes al morfotipo 0803 aislados en aguas industriales. La figuras 16 muestra un ejemplo de filamento tipo 0803 hibridado con la sonda en la depuradora de CX. En primer lugar se realizó la observación bajo el microscopio de epifluorescencia y se tomó la imagen, seguidamente se fotografió el mismo campo en contraste de fases. A B
  61. 61. A.B. Andújar Máster en Ingeniería Ambiental 61 Figura 16. Mortotipo 0803. EDAR CX (24/6/09). (a) Contraste de fases (b) FISH, sonda T0803ind-0642, 100x Para la detección del morfotipo 0803 aislado en aguas domésticas se utilizó la sonda T0803- 0654. En las figura 17 se muestra un ejemplo de filamento hibridado con dicha sonda bajo contraste de fases y epifluorescencia. Figura 17. Morfotipo 0803. EDAR QB (1/7/09). (a) Contraste de fases (b) FISH, sonda T0803-0654, 100x La sonda CFX 67a hibridó con el morfotipo filamentoso 0914 en tres de las depuradoras estudiadas. La figura 18 muestra un filamento tipo 0914 en contraste de fases y bajo epifluorescencia perteneciente a la EDAR CS. No se obtuvo ninguna señal positiva con la sonda CFX67b en ninguna de las EDAR estudiadas. A B BA
  62. 62. A.B. Andújar Máster en Ingeniería Ambiental 62 Figura 18. Morfotipo 0914. EDAR CS (15/7/2009). (a) Contraste de fases (b) FISH, sonda CFX 67a, 100x La sonda CFX 197 hibridó con la variante A del morfotipo filamentoso 0092. La variante B del morfotipo filamentoso 0092 se detectó e identificó mediante la sonda CFX223 como puede apreciarse en las figura 19 y 20. Figura 19. Morfotipo 0092 (variante A). EDAR CX (11/11/09). (a) Contraste de fases (b) FISH, Sonda CFX 197, 100x Figura 20. Morfotipo 0092 (variante B). EDAR CX (11/11/09). (a) Contraste de fases (b) FISH, Sonda CFX 223, 100X A B A B A B
  63. 63. A.B. Andújar Máster en Ingeniería Ambiental 63 La figura 21 muestra una serie de gráficos en los que se presentan los valores promedio de los IF de cada morfotipo filamentoso en cada una de las líneas de tratamiento de las EDAR estudiadas. Se identificó el morfotipo filamentoso 0803 como la bacteria filamentosa dominante, dentro del phylum Chloroflexi junto con el morfotipo 0092 (variante A). Los morofotipos 0914 y 0092 (variante B) aparecieron con abundancias inferiores, incluso en algunas estaciones depuradoras no fueron detectados. El morfotipo filamentoso 0803 se observó en todas las EDAR estudiadas con abundancias elevadas, excepto en el caso de la EDAR CX donde la abundancia fue notablemente inferior. El morfotipo 0914 hibridado con la sonda CFX67a no se detectó en ninguna de las dos líneas de tratamiento de la EDAR CX. La sonda CFX 67 a hibridó con las bacterias presentes en las muestras de las otras EDAR estudiadas. El morfotipo 0914 no fue detectado con la sonda CFX67b en ninguna de las muestras estudiadas de las cuatro EDAR. Se observa que los IF promedio del morfotipo 0914 son inferiores a los del morfotipo 0803. La variante A del morfotipo 0092 también apareció como filamento dominante en dos depuradoras (CS y DE). La variante B sólo aparece de forma significativa en el proceso de fangos activos de la EDAR DE, no siendo detectada en las EDAR de QB y CS. Los valores de IF de cada uno de los morfotipos filamentosos para cada muestra de las cuatro EDAR pueden consultarse en el anexo III.
  64. 64. A.B. Andújar Máster en Ingeniería Ambiental 64 Figura 21. Valores promedio de IF de los morfotipos filamentosos en cada una de las líneas de tratamiento según FISH. 4.2. Comparación microscopía convencional-FISH Cómo se ha descrito en el apartado de objetivos del presente trabajo, se comparó el método clásico y la técnica molecular FISH en la estimación de la abundancia de los morfotipos 0803, 0914 y 0092 en las cuatro depuradoras estudiadas. Se apreciaron diferencias significativas al comparar los resultados en la cuantificación e identificación de estos morfotipos filamentosos mediante las dos técnicas. Generalmente la técnica convencional subestimó la presencia del morfotipo 0803/0914 en todas las depuradoras estudiadas. El morfotipo 0092 se sobreestimó mediante el método convencional en dos de las EDAR estudiadas.
  65. 65. A.B. Andújar Máster en Ingeniería Ambiental 65 4.2.1. Morfotipo 0803/0914 4.2.1.1. EDAR QB El método molecular FISH muestra una mayor abundancia de bacterias filamentosas que el método convencional en todos los muestreos. El sistema clásico de cuantificación e identificación considera el morfotipo 0803 y el morfotipo 0914 dos formas transitorias de un mismo organismo, por ello los cuantifica como un mismo filamento. Como se observa en la figura 22 las diferencias entre ambas cuantificaciones son significativas, llegando a distar hasta cuatro puntos en la escala subjetiva de valoración. En nueve de los veinticuatro muestreos el método molecular detectó la presencia del morfotipo filamentoso 0914 con la sonda CFX67a siendo su abundancia inferior a la del morfotipo 0803. Figura 22. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de QB 4.2.1.2. EDAR CX En el caso de la línea A+B de la EDAR CX se observaron diferencias entre los dos métodos, pero en este caso, en dos muestreos el índice de filamentos (IF) obtenido con los dos métodos coincide. En quince de los muestreos la técnica molecular FISH indica un mayor índice de filamentos superando hasta en tres puntos de la escala subjetiva a la valoración del método convencional. Como se muestra en la figura 23 no se detectó el morfotipo filamentoso 0914 mediante la hibridación in situ utilizando la sonda CFX67a.
  66. 66. A.B. Andújar Máster en Ingeniería Ambiental 66 Figura 23. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de CX (A+B) En la segunda línea de la EDAR CX aumentó el número de muestreos en los que las valoraciones de la abundancia de los dos métodos coincidían, pero en general la técnica FISH proporcionó valores del índice de filamentos superiores. En la muestra del 07/01/2009, mediante el método convencional, no se detectó la presencia de los morfotipos 0803/0914 mientras que con la técnica FISH se detectaron filamentos de forma ocasional en el flóculo. Al igual que en la línea A+B, no se detectó el morfotipo filamentoso 0914 (figura 24). Figura 24. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de CX (C+D) 4.2.1.3. EDAR CS En la mayoría de los muestreos de la línea 1 de la EDAR CS la técnica molecular FISH proporcionó un valor del IF superior al del método clásico de cuantificación e identificación como se puede observar en la figura 15. En este caso los valores de abundancias difieren como máximo en dos puntos en la escala subjetiva de valoración de abundancia de bacterias filamentosas. En trece muestreos apareció el morfotipo filamentoso 0914 detectado con la sonda CFX67a (figura 25).
  67. 67. A.B. Andújar Máster en Ingeniería Ambiental 67 Figura 25. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de CS (R1) En el reactor 2 de la EDAR CS las diferencias entre los dos métodos de cuantificación e identificación fueron del mismo orden que en la línea 1. En la mayoría de los muestreos la técnica molecular FISH mostró valores de IF superiores. En esta línea aumentaron los muestreos en los que aparecía el morfotipo filamentoso 0914. Generalmente, cuando eran detectados los dos organismos filamentosos, el morfotipo 0803 aparecía con abundancias superiores (figura 26). Figura 26. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de CS (R2) 4.2.1.4. EDAR DE Como en el resto de estaciones depuradoras, en la EDAR DE la técnica molecular FISH proporcionó valores de IF superiores a los indicados por el método convencional. En trece de los veintidós muestreos apareció el morfotipo filamentoso 0914 con abundancias relativamente altas como se observa en la figura 27.
  68. 68. A.B. Andújar Máster en Ingeniería Ambiental 68 Figura 27. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0803/0914 en la EDAR de DE 4.2.2 MORFOTIPO 0092 4.2.2.1 EDAR QB El la figura 28 se observa cómo en algunos muestreos el método convencional de cuantificación e identificación sobrestimó la abundancia del morfotipo 0092. La sonda CFX 223 no detectó la presencia de la variante B del morfotipo 0092 en ninguno de los muestreos realizados en la planta depuradora QB. Figura 28. Cuantificación según microscopía convencional y técnica molecular FISH del morfotipo 0092 en la EDAR de QB 4.2.2.2. EDAR CX La figura 29 muestra, además de las abundancias del morfotipo filamentoso 0092 mediante los dos métodos (convencional y molecular), su distribución en los últimos meses del año. Fueron detectadas las dos variantes del morfotipo 0092, A y B, siendo esta última la que aparecía con abundancias inferiores.

×