Tecnologias Emergentes - Bioinformatica

953 views

Published on

las ciencias de la biologia aopyadas en la informatica

Published in: Technology, Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
953
On SlideShare
0
From Embeds
0
Number of Embeds
9
Actions
Shares
0
Downloads
27
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Tecnologias Emergentes - Bioinformatica

  1. 1. Ejemplos de uso de la Bioinformática <ul><li>Clasificación de un h ongo , comparando una secuencia suya con las de una base de datos para determinar si las hay similares </li></ul><ul><li>Visualización de estructuras moleculares en tres dimensiones </li></ul><ul><li>Introducción al análisis de secuencias </li></ul>04/06/09 Introducción a la Bioinformática
  2. 2. Ejemplo 1: Identificación de un hongo <ul><li>Unos investigadores han detectado una infección fúngica en un cultivo agrario. </li></ul><ul><li>En caso de duda en la identificación directa (crecimiento lento del hongo, características morfológicas similares entre varias especies, etc.) se puede plantear la alternativa siguiente: </li></ul><ul><ul><li>Secuenciar un fragmento del ADN del hongo </li></ul></ul><ul><ul><li>Buscar en bases de datos moleculares intentando encontrar la misma secuencia o una lo más similar posible (“DB homology search”) </li></ul></ul>04/06/09 Introducción a la Bioinformática
  3. 3. Ej. 1.1 Secuencia característica <ul><li>Obtenemos la secuencia siguiente </li></ul><ul><li>gtttacgctctacaaccctttgtgaacatacctacaactgttgcttcggcgggtagggtctccgcgaccctcccggcctcccgcctccgggcgggtcggcgcccgccggaggataaccaaactctgatttaacgacgtttcttctgagtggtacaagcaaataatcaaaacttttaacaaccggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaat </li></ul>04/06/09 Introducción a la Bioinformática
  4. 4. <ul><ul><li>Vía internet accedemos al EBI: European Bioinformatics Institute </li></ul></ul><ul><ul><li>Aquí escogemos la opción “ Tools” y </li></ul></ul><ul><ul><ul><li>Seleccionamos Fasta3  </li></ul></ul></ul><ul><ul><ul><li>Seleccionamos en DATABASES : </li></ul></ul></ul><ul><ul><ul><ul><li>N ucleic ACIDS , FUNGI </li></ul></ul></ul></ul><ul><ul><ul><li>Enganchamos la secuencia y hacemos la consulta </li></ul></ul></ul><ul><ul><li>Obtendremos un listado de especies ordenado de mayor a menor similitud </li></ul></ul>Ej. 1.2 Búsqueda de la secuencia en una base de datos 04/06/09 Introducción a la Bioinformática
  5. 5. i) Vamos a la Web del EBI 04/06/09 Introducción a la Bioinformática
  6. 6. ii) Escogemos la opción Tools  04/06/09 Introducción a la Bioinformática
  7. 7. iii) En Tools seleccionamos FASTA3 04/06/09 Introducción a la Bioinformática
  8. 8. iv) la opción DATABASES  NUCLEIC ACIDS, FUNGI 04/06/09 Introducción a la Bioinformática
  9. 9. v) Enganchamos la secuencia en el cuadro inferior y ejecutar (Run FASTA 3) 04/06/09 Introducción a la Bioinformática
  10. 10. v) Resultados de la búsqueda <ul><li>FASTA searches a protein or DNA sequence data bank </li></ul><ul><li>version 3.3t09 May 18, 2001 </li></ul><ul><li>Please cite: </li></ul><ul><li>W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448 </li></ul><ul><li>@:1-: 241 nt </li></ul><ul><li>vs EMBL Fungi library </li></ul><ul><li>searching /ebi/services/idata/v225/fastadb/em_fun library </li></ul><ul><li>104701680 residues in 66478 sequences </li></ul><ul><li>statistics extrapolated from 60000 to 61164 sequences </li></ul><ul><li>Expectation_n fit: rho(ln(x))= -1.2290+/-0.000361; mu= 72.1313+/- 0.026 </li></ul><ul><li>mean_var=907.6270+/-295.007, 0's: 68 Z-trim: 4246 B-trim: 15652 in 3/79 </li></ul><ul><li>Lambda= 0.0426 </li></ul><ul><li>FASTA (3.39 May 2001) function [optimized, +5/-4 matrix (5:-4)] ktup: 6 </li></ul><ul><li>join: 48, opt: 33, gap-pen: -16/ -4, width: 16 </li></ul><ul><li>Scan time: 3.180 </li></ul><ul><li>The best scores are: opt bits E(61164) </li></ul><ul><li>EM_FUN:CGL301988 AJ301988.1 Colletotrichum glo (1484) [f] 1184 88 5.7e-17 </li></ul><ul><li>EM_FUN:AF090855 AF090855.1 Colletotrichum gloe ( 500) [f] 1205 88 7.3e-17 </li></ul><ul><li>EM_FUN:CGL301986 AJ301986.1 Colletotrichum glo (1484) [f] 1166 87 1.2e-16 </li></ul><ul><li>EM_FUN:CGL301908 AJ301908.1 Colletotrichum glo (2868) [f] 1148 87 1.3e-16 </li></ul><ul><li>EM_FUN:CGL301909 AJ301909.1 Colletotrichum glo (2868) [f] 1148 87 1.3e-16 </li></ul><ul><li>EM_FUN:CGL301907 AJ301907.1 Colletotrichum glo (2867) [f] 1148 87 1.3e-16 </li></ul><ul><li>EM_FUN:CGL301919 AJ301919.1 Colletotrichum glo (1171) [f] 1166 87 1.6e-16 </li></ul><ul><li>EM_FUN:CGL301977 AJ301977.1 Colletotrichum glo (1876) [f] 1148 86 2e-16 </li></ul><ul><li>EM_FUN:CFR301912 AJ301912.1 Colletotrichum fra (2870) [f] 1137 86 2.1e-16 </li></ul>04/06/09 Introducción a la Bioinformática
  11. 11. Ejemplo 2: Visualización de estructuras moleculares <ul><li>RASMOL es un programa para visualizar estructuras moleculares en tres dimensiones </li></ul><ul><li>Haciendo click aquí podéis acceder a una guía rápida del programa desde donde podréis descargarlo, instalarlo y ejecutarlo con facilidad </li></ul>04/06/09 Introducción a la Bioinformática
  12. 12. Ejemplo 3: Introducción práctica al análisis de secuencias <ul><li>Haciendo click aquí se accede al Bioinformatics Web Practical del servicio de Bioinformática de la Universidad de Manchester ( UMBER ) </li></ul><ul><li>El objetivo de este tutorial es </li></ul><ul><ul><li>Dar un vistazo a algunos recursos bioinformáticos existentes en Internet </li></ul></ul><ul><ul><li>Adquirir una primera idea sobre que es el análisis de secuencias </li></ul></ul><ul><li>A continuación podéis ver algunas de las pantallas que aparecerán </li></ul>04/06/09 Introducción a la Bioinformática
  13. 13. Enganchamos una secuencia al traductor 04/06/09 Introducción a la Bioinformática
  14. 14. 04/06/09 Introducción a la Bioinformática Traducción de la secuencia y búsqueda en OWL
  15. 15. 04/06/09 Introducción a la Bioinformática La secuencia ha sido identificada

×