Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
9. Solubiologian tutkimusmenetelmiä
Alle olen koonnut muutaman solubiologiassa yleisesti käytetyn tutkimusmenetelmän. Suur...
Kaikki edellä luetellut entsyymit ovat proteiineja ja niitä tuotetaan teollisesti mikrobien, lähinnä koli-bakteerin
(Esche...
Alla olevasta menetelmien luettelosta puuttuvat monoklonaalisten vasta-aineiden käyttöön liittyvät sovellutukset.
Ne olen ...
Kuva 57. PCR-menetelmä eli geenien kopioiminen koeputkessa
3´AATCGTAGCTAAGGTTCTTCGATT5´
3´AATCGTAGCTAAGGTTCTTCGATT5´
5´TTA...
9.3. Vektorit eli geenikuljettimet (siis vähän niin kuin traktorit)
Yhdistelmä-DNA-tekniikassa tarvitaan DNA-jakson kohdes...
Bakteeri
1. Genominen (= kaikki solun
sisältämä) DNA eristetään.
2. DNA pilkotaan jollakin
restriktioentsyymillä. Syntyvää...
Geenikoettimille komplementaarista DNA:ta sisältävien bakteeripesäkkeiden etsiminen geenikirjastoista
(Tämä osio tulee uud...
9. 5. Northern blotting eli solukkonäytteen sisältämien
kaikkien lähetti-RNA-molekyylien eristäminen
- aluksi tutkittava s...
9.6. In Situ –hybridisaatio (Kuva 59) eli geenikoettimien toimintaperiaate
9.7. DNA-sormenjälki
Kiinnostuksen kohteena ole...
Tämän menetelmän ymmärtäminen edellyttää, että olet ensin perehtynyt PCR-
menetelmään ja elektroforeesin perusideaan.
Epäi...
mahdollisuuden vertailla eri eliölajien geenirakenteita. Vaikkapa Homeobox-geenien toimintatapa ja niiden
universaalius el...
Edellä kuvatun toimenpiteen vuoksi PCR:n tuottamat kopiot edustavatkin nyt vain toista DNA:ssa alkujaan olevista
yksöisjuo...
Jos ensimmäiseen koeputkeen laitetaan vain sellaisia ddDNA-nukleotideja, joiden emäs on A eli adeniini (kuva
62), keskeyty...
Kuva 63. ssDNA:ta sisältävät koeputket dideoksy-nukleotidimenetelmällä
toteutetun PCR-kierroksen jälkeen. Kussakin putkess...
Sama toistetaan muissakin koeputkissa. Jokaiseen koeputkeen lisätään tavanomaisten PCR-ainesten lisäksi myös
jonkin verran...
Vertaus pituusjuoksukilpailuun
Elektroforeesivaihetta voitaisiin verrata joukkuemuotoisesti tapahtuvaan pituusjuoksukilpai...
Miksi Sanger-menetelmässä tarvitaan nimen omaan ssDNA:ta?
Kuvitteellisessa DNA-näytteessämme toisilleen komplementaaristen...
Geenisirutekniikalla kyetään keräämään aivan uudella tavalla tietoa geenien normaalista ja patologisesta
(=tauteihin liitt...
Sen, miten kaikki käytännössä tapahtuu, yritän selittää seuraavassa. Ennen varsinaiseen haulikkomenetelmään
paneutumista o...
DNA:ta monistetaan PCR-menetelmällä. DNA:ta monistetaan PCR-
menetelmällä.
Bakteeri
1. Genominen (= kaikki solun
sisältämä) DNA eristetään.
2. DNA pilkotaan jollakin
restriktioentsyymillä ja nämä
l...
Bakteeriviljelmä voidaan tehdä bakteereista, joihin on siirretty jokin vieras eli siirtogeeninen DNA-jakso. Jos
yksittäise...
Koeputki nro 1
Koeputkessa 1 oleva restriktiosilppu voisi koostua vaikkapa seuraavan kokoisista DNA-jaksoista
ATCGGCATTAAG...
Koeputki nro 4
Restriktiosilppu koeputkessa nro 4 voisi koostua vaikkapa seuraavanlaisista DNA-jaksoista
ATCGGCATTAAGCACC ...
9.11. Green Fluorescent Protein eli GFP
Monia solubiologisia ilmiöitä voidaan nykyisin seurata reaaliaikaisesti uusien mol...
Itsevalaisevia reseptoreita
Esimerkiksi valkosoluihin kuuluvat dendrosyytit ja T-solut telakoituvat kiinni toisiinsa sillo...
Itsevalaisevia transkriptiofaktoreita
Samanlaisella yhdistelmä-DNA-tekniikalla voidaan tuottaa valoa hohtavia transkriptio...
Jos halutaan selvittää, täsmääkö jonkin DNA-näytteen emäsjärjestys edellä mainittuihin geenikoettimiin, voidaan
näytejuost...
b) GFP-transkriptiofaktoreita
Monet transkriptiofaktorit ovat dimeerejä. Tämä tarkoittaa sitä, että ne kiinnittyvät geenie...
2b. Dicer alkaa katkoa
viruksen dsRNA:ta
lyhyemmiksi pilkkeiksi.
1. Viruksen dsRNA-
genomi saapuu soluun.
Dicer
2a. dsRNA:...
RNAi:hin perustuvat hoitomuodot
Kaksijuosteisia RNA-molekyylejä voidaan valmistaa myös tarkoituksellisesti. Tällaisen RNA-...
Upcoming SlideShare
Loading in …5
×

Solubiologian tutkimusmenetelmia

3,297 views

Published on

Published in: Education
  • Be the first to comment

  • Be the first to like this

Solubiologian tutkimusmenetelmia

  1. 1. 9. Solubiologian tutkimusmenetelmiä Alle olen koonnut muutaman solubiologiassa yleisesti käytetyn tutkimusmenetelmän. Suurin osa menetelmistä on nykyisin automatisoitu, mutta on tärkeätä, että ymmärrät niiden taustalla olevat ajatukselliset periaatteet. Solubiologian tutkimusmenetelmät kehittyvät sellaisella nopeudella, että niiden kattava kuvaaminen on mahdotonta. Olennaista kuitenkin on tietty solubiologisen tutkimuksen perusmeininki, nimittäin se, että ala tarjoaa valtavasti ideointimahdollisuuksia luoville persoonille. Meininkiin kuuluu myös pieni annos eräänlaista noituutta. Tutkimuksissa ei juuri milloinkaan tapahdu mitään ihmeellistä tai edes näkyvää. Koeputkissa ja pipeteissä käsitellään lähinnä pisaroiksi luokiteltavia näytemääriä. Työvaiheiden päättyessä näytteet usein ulkoisesti näyttävät aivan samalta kuin töiden alkaessakin. Noitamaisten rituaalien lopputuloksena kuitenkin esimerkiksi siirtogeenisissä eliöissä ilmenee perin juurin kouriintuntuvia uusia ominaisuuksia. Geenitutkimuksen kehitys on perustunut moninaisiin oivalluksiin, joita yksittäiset tutkijat tai tutkimusryhmät ovat sattumoisin saaneet. Jännittävää on nähdä, millaisia neronleimauksia tulevaisuus tuokaan tullessaan! Mieti siis, miltä on mahtanut tuntua tutkijoista, jotka ovat keksiskelleet mm. tässä esittämiäni menetelmiä. 9.1. Yhdistelmä-DNA-tekniikassa käytettävät työkalut Ennen varsinaisiin menetelmiin tutustumista käymme läpi merkittävimmät geenitekniikassa käytetyt työkalut. Jotta ymmärrät, mitä työkaluasioista selitän, sinun tulee etukäteen selvittää itsellesi käsite 3´→ 5´-suunta. Tämä käsite selviää kirjallisissa kurssimateriaaleissamme olevasta tiedostosta, jonka otsikkona on ” DNA-replikaatio”. Yhdistelmä-DNA-tekniikalla tarkoitetaan DNA-jaksojen siirtämistä solusta toiseen (ensimmäinen onnistuminen vuonna 1972 tuloksena Nobel-palkinto). Bakteeri- ja hiivasoluihin siirretyillä geeneillä tuotetaan jo ihmisen insuliinia, kasvuhormonia ja interferonia sekä niitä tuman sisäisiä entsyymejä (proteiineja), joita geenitekniikka yleisesti tarvitsee työkaluikseen. Viimeksi mainittujen keksiminen on luonnollisesti ollut koko toiminnan edellytys. Tärkeimpiä yhdistelmä-DNA-tekniikassa tarvittavia entsyymejä ovat: 1) RNA- ja DNA-polymeraasi - rakentavat asianomaisia nukleotidiketjuja - geenien monistamisessa eli PCR:ssä käytetään nykyisin kuumissa lähteissä elävien bakteerien polymeraaseja 2) Käänteiskopioijaentsyymi eli käänteistranskriptaasi - rakentaa lähetti-RNA:sta asianomaisen DNA-jakson - tekee siis transkription takaperin - eristetty retroviiruksista (esim. HIV on retrovirus) 3) DNA- ja RNA-ligaasi - liittää yhteen nukleotidijaksoja 4) Restriktioentsyymit - katkovat nukleiinihappoja kukin tietyn emäsjärjestyksen kohdalta, jättäen leikkauskohtiin lyhyen yksijuosteisen jakson ”sticky end” (tahmea pää, muutama esimerkki alla kuvassa 55) - samalla restriktioentsyymillä katkaistujen DNA-jaksojen sticky endeissä on toistensa kanssa pariutumiskykyiset emäsjaksot, joten kohdatessaan ne kiinnittyvät itsestään kiinni toisiinsa - edellisen ominaisuuden vuoksi restriktioentsyymit ovat käteviä silloin, kun DNA-jaksoja halutaan leikata irti ja siirtää solusta toiseen - restriktioentsyymien avulla voidaan määrätä, millainen emäsjärjestys tulee irrotettavan DNA-jakson kumpaankin päähän (tämä helpottaa esimerkiksi PCR-tekniikassa tarvittavien alukkeiden eli praimereiden valintaa) - restriktioentsyymejä tuottavia geenejä on eristetty bakteereista ja tunnetaan yli 100 erilaista - seuraavassa on joitakin sticky end –esimerkkejä (DNA:n katketessa DNA muuttuu yksijuosteiseksi lihavoinnilla merkittyjen emäsjärjestysten kohdalla, lihavoimattomat emäkset tarvitaan lihavoitujen jaksojen naapureiksi, jotta restriktioentsyymi tunnistaisi katkaisupaikan)
  2. 2. Kaikki edellä luetellut entsyymit ovat proteiineja ja niitä tuotetaan teollisesti mikrobien, lähinnä koli-bakteerin (Eschericia coli) avulla. Siirettäviä DNA-jaksoja voidaan ”viritellä” nykyisin lähes kaikin mahdollisin tavoin. Niihin voidaan liittää halutunlaisia sticky end –jaksoja, niiden säätelyosia voidaan vaihtaa toisenlaisiksi yli lajirajojen, sticky end –päitä voidaan leikata tylpiksi, siirtogeeneihin voidaan liittää esim. 200 nukleotidin mittaisia halutunlaisia emäsjaksoja, DNA:han tai RNA:han voidaan liittää sellaisia nukleotideja, joissa roikkuu monoklonaaliseen vasta-aineeseen liitettyjä fluoresoivia eli valoa hohtavia lisäosia jne. Useimpien geenitekniikassa käytettyjen tutkimusmenetelmien käyttö alkaa siitä, että tutkittavasta DNA-jaksosta tuotetaan PCR-menetelmällä riittävän paljon kopioita. Toinen monessa eri menetelmässä toistuva työvaihe on nimeltään elektroforeesi. Siinä läskiä muistuttavan elektroforeesihyytelölevyn toiseen päähän (valmistettu etupäässä keittiöstä tutuista aineksista) tehtyyn viiltoon tipautetaan pisara esimerkiksi DNA:ta, RNA:ta tai proteiinimolekyylejä sisältävää näytettä. Kun levyn läpi tämän jälkeen johdetaan sähkövirta, tutkittavan näytteen sisältämät molekyylit alkavat liikkua virran mukana. Mitä lyhyemmästä molekyylistä on kysymys sitä nopeammin (= pitemmälle) se läskin sisällä liikkuu. Jokaisesta molekyylien kokoluokasta muodostuu näin oma raitansa läskin sisälle (raidat näkyvät UV-valossa). Raitojen määrä kertoo, kuinka monta molekyylien kokoluokkaa näytteessä on. Tapahtumaa voitaisiin verrata repun kantamiseen. Kevyttä reppua (pieniä molekyylejä) jaksaa kuljettaa nopeasti ja pitkälle, raskasta reppua (suuria molekyylejä) taas hitaasti ja vain lyhyen matkan. Repun kantajaa elektroforeesissa vastaa sähkövirta (Kuva 56). G AATTC C TTAA G G GATC C C CTAG G A AGCT T T TCGA A G TCGA C C AGCT G GC GC CG CG Tämä katkaisupaikka jää tylpäksi, siis ilman sticky end –päätettä. Kuva 55. Esimerkkejä restriktioentsyymeille ominaisista katkaisupaikoista.
  3. 3. Alla olevasta menetelmien luettelosta puuttuvat monoklonaalisten vasta-aineiden käyttöön liittyvät sovellutukset. Ne olen esitellyt immunologiaa käsittelevän tiedostoni yhteydessä. 9.2. PCR-menetelmä (kuva 57 alla) PCR-menetelmä alkaa siitä, että koeputkeen lisätään kopioitavan DNA-näytteen ohella DNA-polymeraasia, DNA- nukleotideja ja praimereita. Praimereiden emäsjärjestys tulee valita sellaiseksi, että se vastaa DNA-näytteen 3´- päissä olevia emäsjärjestyksiä. Tämä emäsjärjestys taas määräytyy DNA-jakson irtileikkaamisessa käytettävän restriktioentsyymin perusteella (Helppoa tietää siis!). Erilaisia praimereita saa nykyisin ostaa pullossa. Yhden kopiointikierroksen jälkeen tuloksena on kaksi alkuperäisen kaltaista DNA-molekyyliä. Seuraavan kierroksen jälkeen kopioita on neljä, sitten kahdeksan, kuusitoista jne. Koska yksi kierros kestää parisen minuuttia, saadaan vaikkapa kahden tunnin aikana kaksi potenssiin 60 kappaletta kopioita. Menetelmässä käytetään nykyisin DNA-polymeraasia, joka on eristetty Thermus aquaticus –nimisestä bakteerista. Tämä laji elää kuumissa lähteissä ja sen lämpötilaoptimi on 75 C astetta. Elintavastaan johtuen lajin DNA- polymeraasi kestää lämmityksen myös 98 C asteeseen. Tämän ominaisuuden vuoksi DNA-polymeraasia ei tarvitse lisätä PCR-putkeen enää reaktiokulun aikana. +- + - Kuva 56. Elektroforeesin toimintatapa. Kun sähköä johtavan elektroforeesilevyn päihin kytketään elektrodit, alkavat näytteessä (sininen viiva) olevat molekyylit liikkua levyn sisällä sähkövirran mukana. Pienet molekyylit liikkuvat nopeammin kuin suuret. Lopulta molekyylien kokoluokat erottuvat levyssä omina raitoinaan (harmaat juovat).
  4. 4. Kuva 57. PCR-menetelmä eli geenien kopioiminen koeputkessa 3´AATCGTAGCTAAGGTTCTTCGATT5´ 3´AATCGTAGCTAAGGTTCTTCGATT5´ 5´TTAGCATCGATTCCAAGAAGCTAA3´ 5´TTAGCATCGATTCCAAGAAGCTAA3´ 3´AATCGTAGCTAAGGTTCTTCGATT5´ Kuumennus + 98 C, jolloin DNA avautuu kahdeksi yksijuosteiseksi molekyyliksi GATT5´ 5´TTAGCATCGATTCCAAGAAGCTAA3´ 5´TTAG 3´AATCGTAGCTAAGGTTCTTCGATT5´ Lämmitys 75 C:een, jolloin DNA polymeraasi alkaa toimia Monistettava DNA-näyte Jäähdytys 45 C:een, jolloin praimerit (merkitty harmaalla) kiinnittyvät paikoilleen ihan itsestään.. Yhden kierroksen jälkeen tuloksena on kaksi alkuperäisen DNA-jakson kaltaista kopiota. 5´TTAGCATCGATTCCAAGAAGCTAA3´3´AATCGTAGCTAAGGTTCTTCGATT5´ 5´TTAGCATCGATTCCAAGAAGCTAA3´
  5. 5. 9.3. Vektorit eli geenikuljettimet (siis vähän niin kuin traktorit) Yhdistelmä-DNA-tekniikassa tarvitaan DNA-jakson kohdesoluun kuljettavia apulaisia, niin sanottuja vektoreita. Bakteerien perimää muutettaessa tärkein vektorityyppi ovat plasmidit eli rengasmaiset DNA-jaksot. Siirrosgeeni on siirrettävissä näihin. Bakteerit ahmivat plasmideja sisälleen kasvatusmaljalta. Eläin- ja kasvisoluihin siirrosgeenit viedään usein viruksen avulla ja sen genomiin kytkettynä. Tekniikkaa sovelletaan usein myös bakteereihin. Suora mikroinjektio eli ruiskutus tumaan on myös joskus mahdollista. Kasveihin geenit saadaan siirrettyä käyttämällä vektorina Agrobacterium-suvun maaperäbakteereita (=agrobakteereita). Nämä siirtävät omia plasmidejaan kasvisoluihin siten, että ne kiinnittyvät saumattomasti kasvikromosomien osiksi. Solun jakautuessa kromosomien mukana kulkevat siirtogeenit siirtyvät kaikkiin tytärsoluihin. Tämä on valtava etu, sillä ellei siirtogeenejä saada liittymään kromosomeihin, siirretyt DNA-jaksot usein hukkuvat soluista niiden jakautuessa. Ilmeisesti katoaminen johtuu siitä, että mitoosin metafaasissa muodostuva tumasukkula sukkularihmoineen kiinnittyy vain kromosomaalisessa DNA:ssa oleviin sentromeerikohtiin. Solussa irrallaan olevat muut DNA-jaksot jätetään tumasukkulavaiheessa oman onnensa nojaan. Tutkijapiireissä on tämän murhenäytelmän estämiseksi kehitetty jopa keinotekoisia pienoiskromosomeja sentromeereineen. Toiveena on, että keinokromosomin saanut solu kohtelisi sitä tavanomaisten kromosomiensa tapaan. Bakteereihin siirrettävä geeni liitetään ennen siirtoa usein johonkin toiseen ns. merkkigeeniin, kuten antibioottiresistenssitekijöihin (= lääkeainevastustuskykytekijöihin). Lopullisen istutuksen jälkeen merkkigeenin avulla voidaan tunnistaa onnistuneet istutukset altistamalla kasvatusmaljan bakteerit kyseiselle antibiootille. Vain ne bakteerit, joissa on resistenssitekijä (siis myös siirretty geeni) säilyvät hengissä lääkekäsittelystä. Siirtogeeneihin on liitettävä sellainen geenin säätelyosa, joka toimii siirron kohteena olevassa solutyypissä. Bakteereihin siirrettäessä käytetään bakteereille ominaisia säätelyosia, aitotumallisiin soluihin tarvitaan näille ominaiset säätelyosat. Säätelyosat voidaan valita sellaisiksi, että ne esimerkiksi tietyn lääkeaineen vaikutuksesta käynnistävät tai sulkevat siirtogeenin. Tietyillä säätelyosilla siirtogeenit saadaan käynnistymään tai sulkeutumaan lämpötilaa vaihtamalla. jne. Luovuudelle on tilaa! On myös hyvä muistaa, että geenit, joissa on intronijaksoja mukana (tsekkaa käsite introni tiedostosta ”karmea totuus proteiinisynteesistä”), eivät toimi bakteerisoluissa. 9.4. Genomisen geenikirjaston perustaminen (Kuva 58)
  6. 6. Bakteeri 1. Genominen (= kaikki solun sisältämä) DNA eristetään. 2. DNA pilkotaan jollakin restriktioentsyymillä. Syntyvää silppua monistetaan PCR- menetelmällä. 3. Liitetään DNA-jaksot plasmideihin, jotka on avattu samalla restriktioentsyymillä. Tällöin plasmidien ”sticky endit” sopivat DNA-pilkkeiden päihin. 4. Plasmidit istutetaan bakteereihin. Bakteerit ottavat plasmideja sisäänsä ihan itsestään. 5. Bakteereita viljellään maljoilla niin laihana seoksena, että kukin bakteeripesäke syntyy yhden bakteerin jälkeläisistä. Tällöin kukin pesäke on samaa bakteerikloonia. Bakteerin oma DNA Bakteeripesäke Siirretty DNA 6. Kun kasvatusmaljoja on paljon, on todennäköistä, että jokainen DNA-jakso on päässyt ainakin yhden bakteerin sisään. Jos jokin tietty DNA-jakso alkaa myöhemmin tuntua kiinnostavalta, kyseistä DNA-jaksoa sisältävät pesäkkeet voidaan myöhemmin tunnistaa maljoilta geenikoettimien avulla. Kasvatusmalja Kuva 58. Genomisen geenikirjaston perustaminen
  7. 7. Geenikoettimille komplementaarista DNA:ta sisältävien bakteeripesäkkeiden etsiminen geenikirjastoista (Tämä osio tulee uudelleen tekstin loppupuolella haulikkosekvenssoinnin yhteydessä, joten älä ihmettele.) Jos bakteeriviljelmään on kerralla istutettu suuri määrä erilaisia DNA-jaksoja, voidaan viljelmästä tunnistaa vaikkapa jonkin tietyn geenin saaneet bakteerit geenikoettimien avulla. Ehtona on, että tiedetään jokin lyhyt, kyseiselle geenille luonteenomainen emäsjärjestys. Tällöin voidaan PCR:llä valmistaa tälle emäsjärjestykselle komplementaarisia geenikoettimia. Geenikoettimet valmistetaan yleensä radioaktiivisista nukleotideista, jolloin ne on helppoa myöhemmin havaita radioaktiivisuudelle herkällä filmillä. Mainitun geenin sisältävien pesäkkeiden etsimistä varten kasvustosta otetaan kopio esimerkiksi nailonkelmulle yksinkertaisesti painamalla se kasvatusalustaa vasten. Kustakin pesäkkeestä jää tällöin kelmulle pieni bakteereita sisältävä tahra. Kelmulle kiinnittyneistä bakteereista liuotetaan pois kaikki muut solujen rakenteet paitsi DNA-molekyylit. DNA- molekyylit avataan yksijuosteisiksi emäskäsittelyllä ja kestävöidään kiinni muovikelmuun. Seuraavaksi kelmua huljutetaan valmistamiamme geenikoettimia sisältävässä liemessä. Tällöin kelmulla tapahtuu in situ –hybridisaatio sellaisten DNA-molekyylien kohdalla, joissa esiintyy geenikoettimellemme komplementaarisia emäsjärjestyksiä. Nailonkelmua ja kasvatusmaljalla olevia bakteeripesäkkeitä toisiinsa vertailemalla komplementaarisia emäsjärjestyksiä sisältävät pesäkkeet voidaan jäljittää. Niissä olevat bakteerit otetaan nyt lähempään jatkokäsittelyyn.
  8. 8. 9. 5. Northern blotting eli solukkonäytteen sisältämien kaikkien lähetti-RNA-molekyylien eristäminen - aluksi tutkittava solukkonäyte murskataan puuroksi ja siitä liuotetaan pois muut orgaaniset molekyylityypit (siis hiilihydraatit, rasva-aineet ja proteiinit) paitsi nukleiinihapot (=DNA ja RNA) - mRNA-molekyyleissä on Poly-A-häntä (asia tulee esille tiedostossa ”Karmea totuus proteiinisynteesistä”) → käytetään eristämiseen suodatinta, jossa on paljon Poly-T-häntiä - uutetaan mRNA-molekyylit irti suodattimesta ja pannaan näyte elektroforeesihyytelölle sähkökenttään → hyytelölle ilmestyy raidoitus molekyylien kokoluokkien mukaan (pienet molekyylit siirtyvät kauas lähtöpaikastaan, suuret jäävät sen lähelle) - otetaan raidoista kopsut imupaperille - myöhemmin raidoista voidaan valkata kulloinkin kiinnostavilta tuntuvien geenikoettimien (esim. homeobox) avulla jatkotarkasteluun mielenkiintoisimmat - käänteiskopioijaentsyymin avulla voidaan loihtia ao. geenit esim. istutettaviksi pöpöihin (näin tuotettua DNA:ta kutsutaan cDNA:ksi) - jos käänteiskopiointiin otetaan kaikki raidat, saadaan syntymään geenikirjasto - näin tuotetussa geenikirjastoissa on mukana vain geenien rakenneosia koodaavat DNA-jaksot (lähetti-RNA-molekyyleissähän ei ole introneita eikä geenien säätelyosia) - cDNA-kirjastot ovat siis hieman erilaisia kuin bakteerikantoihin kloonatut ns. genomiset kirjastot (kirjassa s. 42), jotka puolestaan sisältävät kaiken tutkittavalle eliölajille ominaisen DNA:n (intronit, eksonit, säätelyjaksot ja geenien ulkopuolelle jäävän nonsense-DNA:n)
  9. 9. 9.6. In Situ –hybridisaatio (Kuva 59) eli geenikoettimien toimintaperiaate 9.7. DNA-sormenjälki Kiinnostuksen kohteena oleva DNA-jakso, vaikkapa homeo- sekvenssi PCR:ään, jossa radiohiiltä sisältäviä nukleotideja PCR pysäytetään kuumaan (siis yksijuosteiseen) vaiheeseen ja DNA- molekyylien pysyminen yksijuosteisina varmistetaan esim. emäskäsittelyllä Kudosleike (esim alkion pitkittäisleikkaus) upotetaan näin tuotettuja geenikoettimia sisältävään liuokseen (kuva oikealla). Huljutetaan pesuliuoksessa irto-DNA: t pois. Radio-DNA-juosteet (= geenikoettimet) kiinnittyvät niihin kohtiin leikettä, joissa on niiden emäsjärjestykselle vastakkaisia mRNA-juosteita Radioherkällä filmillä geenikoettimien sijaintipaikat näkyvät täplinä tai raitoina alkiossa. Näissä kohdissa kyseinen geeni toimii! A T G G C C A A T T A C C G G T T A A T G G C C A A T A T G G C C A A T A T G G C C A A T A T G G C C A A T U A C C G G U U A Tutkittava leike (esim. ohutleike alkiosta) RNA- molekyyleineen Yksijuos- teista radio- DNA:ta Kuva 59. In Situ –hybridisaatio eli geenikoettimien toimintaperiaate Kuvasarjan ymmärtääksesi tee ensin itsellesi selväksi PCR-menetelmä.
  10. 10. Tämän menetelmän ymmärtäminen edellyttää, että olet ensin perehtynyt PCR- menetelmään ja elektroforeesin perusideaan. Epäillyltä kudosnäyteRikospaikalta kudosnäyte (verta, hius, hilsettä tms.) Eristetään esim. yksi kromosomi Eristetään se sama kromosomi PCR:ään PCR:ään DNA paloitellaan restriktioentsyymillä DNA paloitellaan samalla restriktioentsyymillä Näyte elektroforeesihyytelölle Näyte elektroforeesihyytelölle Jos raidat kummassakin hyytelössä ilmestyvät samoille kohdille, epäilty on syyllinen. 9. 8. DNA:n sekvenssointi eli emäsjärjestyksen lukeminen Kenties tärkein solubiologisen tutkimuksen saavutuksista on kyky lukea DNA:ssa olevia emäsjärjestyksiä. Emäsjärjestyksien perusteella voidaan päätellä DNA:n koodaamien proteiinien aminohappojärjestys (kolme rinnakkaista emästähän koodaa aina yhtä aminohappoa). Näin voidaan paremmin ymmärtää esimerkiksi tiettyjen geenivirheiden aiheuttamia molekyyli- ja solutason vaikutuksia. DNA:n emäsjärjestyksen selvittäminen antaa myös
  11. 11. mahdollisuuden vertailla eri eliölajien geenirakenteita. Vaikkapa Homeobox-geenien toimintatapa ja niiden universaalius eläinkunnassa ymmärrettiin vain tällaisen puuhastelun tuloksena. Kuvaan tässä niin sanotun Sanger-menetelmän (Nobel-palkinto vuonna 1980), jota kutsutaan myös dideoksynukleotidimenetelmäksi. Menetelmän kehitti tutkija nimeltään Frederick Sanger. Samainen kaveri oli jo vuonna 1958 saanut ensimmäisen Nobel-palkintonsa selvitettyään insuliini-hormonin aminohappojärjestyksen (1955). Sanger-menetelmä Sanger-menetelmä alkaa leikkaamalla haluttu DNA-jakso irti jostakin laajemmasta DNA-näytteestä, esimerkiksi kromosomista. Leikkaamisessa käytetään restriktioentsyymejä. Koska nämä entsyymit leikkaavat DNA:ta vain tiettyjen emäsjärjestysten kohdalta, voidaan restriktioentsyymien avulla määrätä, millainen emäsjärjestys tulee irrotettavan DNA-jakson kumpaankin päähän (kuva 60). Tutkittavassa DNA-molekyylissä olevien sticky end -päiden emäsjärjestykset tunnetaan leikkaamisessa käytetyn restriktioensyymin perusteella. Sen sijaan DNA-jakson muu emäsjärjestys (alla olevissa esimerkeissä sinisellä) on tässä vaiheessa tuntematon. Tämä on siis se osa DNA-molekyyliä, joka halutaan sekvenssoida. Esimerkiksi, jos toinen yksöisjuosteista on 3´ATGAGGATGGTAA 5´, on tälle kompelementaarinen yksöisjuoste emäsjärjestykseltään 5´CCTACCATTAGTA 3´. Kaksoisjuosteena ne näyttäisivät seuraavalta: ssDNA:n tuottaminen Emäsjärjestyksen selvittäminen aloitetaan ns. epäsymmetrisellä PCR:llä. Siinä kopioitavan DNA-kaksoisjuosteen päät muokataankin emäsjärjestykseltään erilaisiksi. Tällöin praimerit voidaan valita sellaisiksi, että ne kiinnittyvät DNA-juosteessa vain jompaankumpaan 3´-päähän (kuva 61). 3´ATGAGGATGGTAA 5´ 5´CCTACCATTAGTA 3´. G AATTC C TTAA G G GATC C C CTAG G A AGCT T T TCGA A G TCGA C C AGCT G GC GC CG CG Tämä katkaisupaikka jää tylpäksi, siis ilman sticky end –päätettä. Kuva 60. Esimerkkejä restriktioentsyymeille ominaisista katkaisupaikoista.
  12. 12. Edellä kuvatun toimenpiteen vuoksi PCR:n tuottamat kopiot edustavatkin nyt vain toista DNA:ssa alkujaan olevista yksöisjuostetyypeistä. Epäsymmetrisen PCR:n tuloksena syntyvää DNA-näytettä kutsutaan tästä lähtien ssDNA:ksi (ss tulee sanoista ”single stranded” eli yksijuosteinen). ssDNA:ta ei siis ole mikä tahansa yksijuosteisia DNA-molekyylejä sisältävä näyte, vaan sellainen, joka nimenomaan sisältää vain jompaa kumpaa komplementaarista juostetyyppiä. Selostamani vaihe on erittäin tärkeä syystä, jonka perustelen lopussa menetelmän yleiskuvauksen jälkeen. Eristetyt ssDNA-kopiot jaetaan nyt neljään eri koeputkeen. Jokaisessa koeputkessa PCR:ää jatketaan tämän jälkeen yksi kierros, kuitenkin sillä erolla, että nyt tavallisten DNA-nukleotidien lisäksi kuhunkin putkeen sujautetaan jonkin verran myös ns. dideoksynukleotideja. Tällaisia nukleotideja DNA-polymeraasi voi kyllä liittää aikaisempien nukleotidien jatkoksi, mutta se ei pysty liittämään uusia nukleotideja enää dideoksynukleotidien perään. Kopiointi siis pysähtyy aina, kun polymeraasi pahaa aavistamatta liittää ketjun jatkoksi dideoksynukleotidin (ddDNA- nukleotidin). Tavallisten ja dideoksynukleotidien eroa havainnollistaa mojovasti seuraava vertaus: jos tavalliset nukleotidit ovat normaaleita Lego-palikoita, niin dideoksynukleotidien yläpinnalta puuttuisivat Legoille ominaiset nystermät. 5´CCTACCATTAGTA 3´ 3´ATGAGGATGGTAA 5´ 5´CCTACCATTAGTAGCCGC 3´ 3´ATGAGGATGGTAATCATCGGCG 5´ Alkuperäinen restriktioentsyymillä irroitettu kaksoisjuoste, jonka molemmissa 3´-päissä on sama peilikuvamainen emäsjärjestys. Kaksoisjuosteen toisen pään aloittava emäsjärjestys on muutettu toisenlaiseksi (harmaat emäkset). Nyt praimerit voivat kiinnittyä vain koskemattomaksi jätettyyn 3´-päähän. Kuva 61. DNA:n muokkaaminen epäsymmetristä PCR:ää varten.
  13. 13. Jos ensimmäiseen koeputkeen laitetaan vain sellaisia ddDNA-nukleotideja, joiden emäs on A eli adeniini (kuva 62), keskeytyy kopiointi tässä putkessa aina kohtaan, missä viimeisenä emäksenä on adeniini. Putkeen syntyy suuri määrä geenikopioita, jotka ovat täydellisen pitkiä vain silloin, kun polymeraasin tielle ei ole osunut yhtään ddDNA-nukleotidia. Loppuun asti kopioituneiden molekyylien seassa on nyt suuri joukko eri kohdilta kesken jääneitä tynkiä. Näitä on monen kokoisia, mutta jokaisessa molekyylissä viimeisenä emäksenä on adeniini. Sanger-menetelmän lopputilanne havainnollistuu kuvissa 63 ja 64. T T C T G G A T G T T A G A G T A A G G A A C T T A A A A C DNA-polymeraasia DNA:n ddA-nukleotideja (tämän polymeraasi voi liittää nukleotidiketjun jatkoksi, mutta tähän kopiointi pysähtyy) Tavallisia DNA- nukleotideja PCR:n tuloksena saatuja ssDNA-juosteita (3´-pään emäsjärjestys mustalla). Kuva 62. ddA-nukleotideja sisältävä koeputki Sanger-menetelmän lähtötilanteessa. PCR-putkeen lisätään kuvassa näkyvät lähtöaineet emäsjärjestyksen selvittämistä varten. Siniset aakkoset kuvaavat tutkittavassa DNA- näytteessä olevaa emäsjärjestystä, jota tässä vaiheessa ei vielä tunneta. Dideoksy-A-nukleotidit on kuvaan merkitty punaisella. Kutakin neljää dideoksynukleotidityyppiä varten tarvitaan oma koeputkensa. T C A T T C A T Praimereita
  14. 14. Kuva 63. ssDNA:ta sisältävät koeputket dideoksy-nukleotidimenetelmällä toteutetun PCR-kierroksen jälkeen. Kussakin putkessa on valtava populaatio eri kohdista kesken jääneitä (siis vain lyhyeltä matkalta kaksijuosteisia) kopioita alkuperäisestä DNA-juosteesta. Mustat viivat ovat mallijuosteita, värilliset viivat ovat uusia kopioita. Kaikki uudet kopiot päättyvät dideoksy-nukleotidiin. Seuraavassa vaiheessa jokaisesta koeputkesta tehdään ajo elektroforeesilevyllä (kuva 65 ). ddA-putki ddT-putki ddC-putki ddG-putki
  15. 15. Sama toistetaan muissakin koeputkissa. Jokaiseen koeputkeen lisätään tavanomaisten PCR-ainesten lisäksi myös jonkin verran dideoksy-nukleotideja. Neljästä putkestamme yhdessä on dideoksy-nukleotidien emäksenä tymiini. Yhdessä putkessa on dideoksy- nukleotideja, joissa emäksenä on guaniini. Ja neljännessä putkessa dideoksy-nukleotidien emäksenä on sytosiini. PCR:n jälkeen jokaisessa putkessa on valtaisia määrä eri kokoisia DNA-kopioiden tynkiä hyvin lyhyistä jaksoista aina kokonaisiin kopioihin asti. Mutta jokaisessa putkessa tyngät päättyvät aina emäkseen, jonka tyyppisiä dideoksynukleotideja putkeen oli lisätty (kuvat 63 ja 64). DNA:n emäsjärjestys saadaan nyt selville elektroforeesin avulla. Siinä läskiä muistuttavan elektroforeesihyytelölevyn (valmistettu etupäässä keittiöstä tutuista aineksista) toiseen päähän tehtyyn viiltoon tipautetaan näytteet edellä mainituista koeputkista. Jokaiselle putkelle tehdään oma elektroforeesiajo. (kuva 65). Kun levyn läpi tämän jälkeen johdetaan sähkövirta, DNA-kopiot alkavat liikkua virran mukana. Mitä lyhyemmästä molekyylistä on kysymys sitä nopeammin (= pitemmälle) se ”läskin” sisällä liikkuu. Jos esimerkiksi praimerit on valmistettu radiohiiltä sisältävistä nukleotideista, jokaisesta molekyylien kokoluokasta muodostuu oma radioaktiivinen raitansa ”läskin” sisälle (raidat näkyvät radioaktiivisuudelle herkällä filmillä). Kun neljän näytteemme jättämiä raitoja tutkitaan rinnakkain, voidaan DNA-juosteen emäsjärjestys lukea suoraan levyiltä (kuva 65). Emästen pariutumissäännön perusteella selviää saman tien tietenkin myös komplementaarisen juosteen emäsjärjestys. Kuva 64. Näyte dideoksy-A-tyyppisiä nukleotideja sisältävän koeputken sisällöstä PCR-kierroksen jälkeen. Dideoksy-A-nukleotidit on kuvaan varjostettu punaisella ja praimerit turkoosilla. Tosiasiassa koeputkessa on valtaisa populaatio kaikkia kuvassa näkyviä A-emäksen kohdalle pysähtyneitä DNA-kopioita. Tämä ilmenee parhaiten kuvasta 63. T T C T G G A T G T T A G A G T A A A A A T C A T T C T T C T G G A T G T T A G A G T A T T C T G G A T G T T A G A G T A T T C T G G A T G T T A G A G T A T C A T T C A T T C A T A T C C A A T C C C T A C A A T C JNE…
  16. 16. Vertaus pituusjuoksukilpailuun Elektroforeesivaihetta voitaisiin verrata joukkuemuotoisesti tapahtuvaan pituusjuoksukilpailuun. Kilpailussa on neljä rinnakkaista rataa (= neljä eri ”läskiä”). Radat voidaan nimetä emästen mukaan ddA-, ddT-, ddG- ja ddC-radaksi (kuva 65) . Kunkin radan alkuun asettuu joukko eri tavoin raskas- / kevytrakenteisia juoksijoita (= eri kokoisia DNA:n kopioita asianomaisia dideoksy-nukleotideja sisältäneestä koeputkesta). Kun lähtölaukaus kajahtaa (sähkövirta kytketään), jokaisen joukkueen jokainen jäsen (=tutkittavat molekyylit) singahtaa matkaan samanaikaisesti, mutta pysytellen tiukasti omalla radallaan. Mitä pitempään kilpailun annetaan jatkua sitä suuremmaksi kevytrakenteisten juoksijoiden etumatka kasvaa raskasrakenteisiin juoksijoihin nähden. Kilpailuajan päättyessä (= kun sähkövirta katkaistaan) kukin juoksija pysähtyy radalleen. Rata-alueella (= neljä rinnakkaista läskiä) nyt olevien juoksijoiden järjestys kertoo suoraan DNA-molekyylissä olevan emäsjärjestyksen. +- + - - + + + - - ddA-levy ddT-levy ddC-levy ddG-levy Kuva 65. Elektroforeesin käyttö DNA:n sekvenssoinnissa Sanger- menetelmällä. Jokaisen dideoksynukleotideja sisältäneen koeputken (= värit) sisältö ajetaan erikseen omalla elektroforeesilevyllään. Sekvenssoitavan DNA-näytteen emäsjärjestys on luettavissa raidoista helposti, kun levyt asetetaan rinnakkain. Kuvassa emäsjärjestys vasemmalta oikealle olisi CGTATGCATCGATCGATCG (saat järjestyksen selville kuljettamalla pystyssä olevaa viivotinta kuva- alueen poikki nuolien kulkusuunnassa).
  17. 17. Miksi Sanger-menetelmässä tarvitaan nimen omaan ssDNA:ta? Kuvitteellisessa DNA-näytteessämme toisilleen komplementaaristen juosteiden emäsjärjestykset ovat esimerkiksi seuraavat: 3´ATGAGGATGGTAA5´ ja 5´CCTACCATTAGTA 3´. Jos emäsjärjestystä olisi yritetty selvittää molempia juosteita sisältävästä näytteestä, olisi jokaisen dideoksy-G- juovan kohdalle ”läskiin” muodostunut juova myös dideoksy-C-näytteestä. Samoin jokaisen dideoksy-A-juovan kohdalle olisi muodostunut juova myös dideoksy-T-näytteestä. Näin siksi, että komplementaariset emäkset A / T ja C / G sijaitsevat yhtä kaukana molekyylien päistä. Olisimme siis saaneet selville kylläkin peräkkäiset emäsparit, mutta emme sitä, mitkä asianomaisista emäksistä olisivat kuuluneet samaan juosteeseen. Tässä on siis syy siihen, että Sanger-menetelmän dideoksyvaiheessa käytetään vain ja nimen omaan ssDNA:ta. Lukulaitteita Emäsjärjestyksen selvittämisessä käytetään nykyisin myös automaattisia lukulaitteita. Niidenkin toimintaperiaate on edellä kuvatun kaltainen (ei todennäköisesti kuitenkaan kauan, sillä DNA:n suoraankin lukemiseen kykeneviä välineitä ollaan jo kovalla tohinalla kehittelemässä). 9.9. Geenisirut, oppikirjassa s. 44 (= DNA-mikrosirutekniikka, DNA-siru tai DNA-lastu, englanniksi esim. microarray tai DNA-array) Jotta ymmärrät tähän kirjoittamani näkökulmat, sinun täytyy ensin selvittää itsellesi seuraavat aikaisemmin opiskellut asiat: - PCR-menetelmä - Northern blotting eli solukkonäytteen sisältämien kaikkien lähetti-RNA-molekyylien eristäminen poly-A-hännän avulla - käänteistranskriptaasin toimintaperiaate ja käyttö geenitekniikassa - in situ-hybridisaatio ja geenikoettimien toimintaperiaate Geenisirut koostuvat mikroskooppilasille kestävöidyistä tuhansista geenikoettimista, joihin hybridisoidaan tutkimusnäytteen RNA:sta valmistettua komplementaarista DNA:ta (cDNA). Geenisiruja valmistetaan siten, että cDNA-kirjastoista poimitaan esimerkiksi tiettyjen syöpägeenien kloonit. Klooneista valmistetaan geenikoettimet ja ne kestävöidään pipetointirobotilla (»mikrosirukirjoitin») mikroskoopin aluslasille. Kutakin geenikoetinta sijoitetaan aluslasille tietylle kohdalle, selvärajaiseksi täpläksi (kuva oppikirjassa sivulla 44). Yhdelle aluslasille kirjoitetaan tavallisesti 10 000–20 000 erilaista DNA-jaksoa. Tulevaisuudessa siirryttäneen koko genomin (= yksittäisen lajin kaikki geenit) kattaviin noin 50 000 kloonin laseihin. Potilaalta, esimerkiksi syöpäkasvaimesta otetusta näytteestä, eristetään lähetti-RNA-molekyylit, jotka käännetään käänteistranskriptaasin avulla cDNA:ksi. Nämä cDNA-molekyylit leimataan fluoresoivalla eli valoa hohtavalla väriaineella. Kasvaimesta peräisin olevat molekyylit voidaan leimata vaikkapa keltaisiksi. Potilaan leimattua cDNA-näytettä hybridisoidaan (= in situ –hybridisaatio) geenisirulla olevien koettimien kanssa huljuttamalla sirua näytemolekyylejä sisältävässä liuoksessa. Jos näytemolekyyleissä esiintyy geenikoettimiin nähden komplementaarisia emäsjärjestyksiä, nämä kiinnittyvät asianomaista koetinta sisältävän täplän kohdalle. Keltaisten valotäplien sijainti sirulla kertoo, mitkä syöpägeeniversiot näytteen sisältämissä soluissa ovat toiminnassa. Siis sen, mitkä nimenomaiset geenivirheet kyseisen kasvaimen ovat aiheuttaneet. Tarkka tieto kasvaimen genetiikasta auttaa löytämään parhaan mahdollisen lääkityksen. Standardoiduille siruille on olemassa valmiita tietokonepohjaisia lukuohjelmia, jotka antavat tulosyhteenvetoja valmiina taulukkoina. Tulkinta on siis suurelta osin automatisoitua.
  18. 18. Geenisirutekniikalla kyetään keräämään aivan uudella tavalla tietoa geenien normaalista ja patologisesta (=tauteihin liittyvästä) toiminnasta pian jopa koko genomin mittakaavassa. Geenisirutekniikan sovellusmahdollisuudet koskettavat lähes kaikkea biologista ja lääketieteellistä tutkimusta, lääkekehitystyötä ja diagnostiikkaa. 9.10. Haulikkosekvenssointi eli Chromosome walking (Geeni s. 68) Tässä selostetun menetelmän ymmärtämiseksi sinun tulee etukäteen osata seuraavat asiat: - PCR-menetelmä - restriktioentsyymien toimintaperiaate - in situ-hybridisaatio ja geenikoettimien toimintaperiaate - Sanger-menetelmä - elektroforeesi - mielellään myös genomisten geenikirjastojen tekeminen (kirjassa s.42), mutta näiden tekeminen valkenee ehkä myös alla olevasta - käsite plasmidi - käsite ssDNA Johdanto Haulikkosekvensoinnin perusidea on, että pitkien DNA-jaksojen, esimerkiksi kokonaisten kromosomien emäsjärjestyksen selvittämisessä joudutaan tyytymään lyhyiden askelten taktiikkaan. Sanger-menetelmä (tässä tiedostossa kohta 9.8.) tai sitä hyödyntävät automaattiset lukulaitteet eivät nimittäin sovellu kovinkaan pitkien DNA- jaksojen sekvenssoimiseen. Pitkät DNA-jaksot pilkotaan niin lyhyiksi, että Sanger-menetelmää voidaan käyttää. Syntyvien DNA-pilkkeiden järjestys menee pilkkomisen seurauksena sekaisin. Jos kuitenkin pilkkominen tehdään useammalla eri restriktioentsyymillä, kullakin erikseen, pilkkeiden järjestys voidaan myöhemmin päätellä vertailemalla toisiinsa eri restriktioentsyymeillä pilkottujen DNA-jaksojen emäsjärjestysten päällekkäisyyksiä (Kuva 66).
  19. 19. Sen, miten kaikki käytännössä tapahtuu, yritän selittää seuraavassa. Ennen varsinaiseen haulikkomenetelmään paneutumista on kuitenkin syytä tehdä selväksi bakteerikasvatuksena toteutettavien geenikirjastojen olemus. Näitä nimittäin tarvitaan mainitussa puuhastelussa. Myös kirjassa sivulla 42 on esitetty tällaisten geenikirjastojen tuotantotapa, joten tsekkaa se kyseisellä sivulla olevasta kuvasta. Bakteeriviljelmät geenikirjastoina Bakteereita kasvatetaan pyöreillä, suunnilleen kämmenen kokoisilla kasvatuslaustoilla: petrimaljoilla. Bakteerikasvustot näkyvät maljalla pieninä täplinä, ns. bakteeripesäkkeinä eli plakkeina. Bakteerit istutetaan maljalle niin laimeana liuoksena, että kukin bakteeripesäke syntyy yksittäisestä bakteerista. Kaikki yhdessä pesäkkeessä olevat bakteerit ovat siis geneettisesti täsmälleen samanlaisia eli identtisiä. (Kuva 67) Alkuperäinen, pilkkoutumaton DNA-molekyyli, jonka emäsjärjestys halutaan selvittää. Molekyyli on liian pitkä kerralla sekvenssoitavaksi. Restriktioentsyymi 1:llä pilkottu DNA Restriktioentsyymi 2:lla pilkottu DNA Restriktioentsyymi 3:lla pilkottu DNA Kuva 66. Haulikkosekvenssoinnin perusperiaate. Alkuperäinen DNA-näyte on liian pitkä kerralla sekvenssoitavaksi. Siksi sitä aluksi monistetaan PCR- menetelmällä. Monistettua DNA:ta jaetaan useaan eri koeputkeen (= värit). Kun kuhunkin putkista laitetaan erilaiselle emäsjärjestykselle herkkää restriktioentsyymiä, DNA pilkkoutuu kussakin koeputkessa eri kohdista. Tuloksena on sekvenssointiin sopivia, lyhyitä DNA-jaksoja, joissa kuitenkin on niin paljon päällekkäisiä emäsjärjestyksiä, että alkuperäisen DNA- näytteen koko emäsjärjestys voidaan lopulta päätellä.
  20. 20. DNA:ta monistetaan PCR-menetelmällä. DNA:ta monistetaan PCR- menetelmällä.
  21. 21. Bakteeri 1. Genominen (= kaikki solun sisältämä) DNA eristetään. 2. DNA pilkotaan jollakin restriktioentsyymillä ja nämä lyhyemmät jaksot monistetaan PCR-menetelmällä. 3. Liitetään DNA-pilkkeet plasmideihin, jotka on avattu samalla restriktioentsyymillä. Tällöin plasmidien ”sticky endit” sopivat DNA-pilkkeiden päihin. 4. Plasmidit istutetaan bakteereihin. Bakteerit ottavat plasmideja sisäänsä ihan itsestään. 5. Bakteereita viljellään maljoilla niin laihana seoksena, että kukin bakteeripesäke syntyy yhden bakteerin jälkeläisistä. Tällöin kukin pesäke on samaa bakteerikloonia. Bakteerin oma DNA Bakteeripesäke Siirretty DNA 6. Kun kasvatusmaljoja on paljon, on todennäköistä, että jokainen DNA-jakso on päässyt ainakin yhden bakteerin sisään. Jos jokin tietty DNA-jakso alkaa myöhemmin tuntua kiinnostavalta, kyseistä DNA-jaksoa sisältävät pesäkkeet voidaan myöhemmin tunnistaa maljoilta geenikoettimien avulla. Kasvatusmalja Kuva 67. Genomisen geenikirjaston perustaminen
  22. 22. Bakteeriviljelmä voidaan tehdä bakteereista, joihin on siirretty jokin vieras eli siirtogeeninen DNA-jakso. Jos yksittäisestä pesäkkeestä otetaan bakteerinäyte ja eristetään bakteerien sisältämät DNA-molekyylit, voidaan siirtogeeninen jakso tarvittaessa leikata uudelleen irti bakteerin omasta genomista jatkotutkimuksia varten. Tämä käy näppärästi, sillä siirtogeenien istuttamisessa käytetyn plasmidin sticky end -päät ovat siirtäjän tiedossa. Jos plasmidit avataan samalla restriktioentsyymillä, jolla ne ennen siirtogeenin istuttamista avattiin, irtautuvat siirtogeenijaksot ulos plasmideista sellaisinaan. Ne voidaan sitten monistaa PCR:n avulla ja erottaa muista DNA- molekyyleistä elektroforeesilla. Geenikoettimille komplementaarista DNA:ta sisältävien bakteeripesäkkeiden etsiminen geenikirjastoista Jos bakteeriviljelmään on kerralla istutettu suuri määrä erilaisia DNA-jaksoja, voidaan viljelmästä tunnistaa vaikkapa jonkin tietyn geenin saaneet bakteerit geenikoettimien avulla. Ehtona on, että tiedetään jokin lyhyt, kyseiselle geenille luonteenomainen emäsjärjestys. Tällöin voidaan PCR:llä valmistaa tälle emäsjärjestykselle komplementaarisia geenikoettimia. Geenikoettimet valmistetaan yleensä radioaktiivisista nukleotideista, jolloin ne on helppoa myöhemmin havaita radioaktiivisuudelle herkällä filmillä. Mainitun geenin sisältävien pesäkkeiden etsimistä varten kasvustosta otetaan kopio esimerkiksi nailonkelmulle yksinkertaisesti painamalla se kasvatusalustaa vasten. Kustakin pesäkkeestä jää tällöin kelmulle pieni bakteereita sisältävä tahra. Kelmulle kiinnittyneistä bakteereista liuotetaan pois kaikki muut solujen rakenteet paitsi DNA-molekyylit. DNA- molekyylit avataan yksijuosteisiksi emäskäsittelyllä ja kestävöidään kiinni muovikelmuun. Seuraavaksi kelmua huljutetaan valmistamiamme geenikoettimia sisältävässä liemessä. Tällöin kelmulla tapahtuu in situ –hybridisaatio sellaisten DNA-molekyylien kohdalla, joissa esiintyy geenikoettimellemme komplementaarisia emäsjärjestyksiä. Nailonkelmua ja kasvatusmaljalla olevia bakteeripesäkkeitä toisiinsa vertailemalla komplementaarisia emäsjärjestyksiä sisältävät pesäkkeet voidaan jäljittää. Niissä olevat bakteerit otetaan nyt lähempään jatkokäsittelyyn. Siinäpä lämmittelyä kerrakseen ja nyt varsinaisesti haulikkomenetelmän kimppuun! Sekvenssoitavana voi siis olla tavattoman pitkä DNA-jakso kuten kokonainen kromosomi. Alkuperäinen tuntematon ssDNA:n emäsjärjestys voisi mukamas olla vaikkapa seuraavanlainen (kuvitellaan, että tämä oikeasti olisi aivan tajuttoman pitkä): ATCGGCATTAAGCACCTTAGAAATGCAACCCCGTACGGATAATGATCGTAGCTA (Koska emäsjärjestys on pitkä, se saattaa ulottua tässä kahdelle riville. Siksi se saattaa näyttää kaksijuosteiselta, mutta ei kuitenkaan sitä ole.) DNA-jaksoa monistetaan PCR:llä ja saatuja kopioita lorautetaan esim. neljään eri koeputkeen. Kussakin koeputkessa olevat DNA-jaksot pilkotaan nyt erilaisella restriktioentsyymillä. Jokainen restriktioentsyymi katkoo DNA:ta erilaisen emäsjärjestyksen kohdalta, joten jokaiseen koeputkeen syntyy erilainen DNA-silppujen kokoelma. Näiden silppukokoelmien olemusta ja eroja selostan myöhemmin yksityiskohtaisemmin. Jotta tehty työ ei menisi hukkaan, silppukokoelmat istutetaan plasmidivektorien avulla bakteereihin kuvan 67 esittämällä tavalla (tsekkaa myös kirjan sivulla 42 oleva kuva geenikirjaston tekemisestä). Kustakin silppukokoelmasta (= värit kuvassa 66) tehdään siis erillinen oma geenikirjastonsa. Vektorina käytettävän plasmidin avaamisessa tulee käyttää samaa restriktioentsyymiä kuin millä silppu kyseisessä koeputkessa tuotettiin. Näin sekä istutettavissa DNA-jaksoissa että plasmideissa on valmiiksi toisiinsa sopivat sticky end –päät. Seuraavien väliotsikoiden alla (= koeputket nro 1 – 4) näkyviin restriktiosilppuihin en ole merkinnyt kullekin restriktioentsyymille ominaisia sticky end –emäsjärjestyksiä.
  23. 23. Koeputki nro 1 Koeputkessa 1 oleva restriktiosilppu voisi koostua vaikkapa seuraavan kokoisista DNA-jaksoista ATCGGCATTAAGCAC CTTAGAAATGCAACC CCGTACGGATAATG ATAGCGTAGCTA DNA-silpusta voidaan elektroforeesin avulla eristää yhtä silppumolekyylien kokoluokkaa edustava DNA-jakso. Tästä DNA-jaksosta selvitetään esimerkiksi Sanger-menetelmällä siinä oleva emäsjärjestys. Kun emäsjärjestys on saatu selville, valmistetaan sen jommassa kummassa päässä oleviin emäksiin nähden komplementaarinen geenikoetin. Kuvitellaanpa, että edellä sekvenssoimamme DNA-jakso olisi yllä olevassa DNA-molekyylissä vasemmanpuoleisimpana oleva molekyyli. Siihen olen harmaalla merkinnyt meitä erityisesti kiinnostavat viimeiset emäkset AGCAC. Näille komplementaarinen koetin olisi siis TCGTG. Tämän koettimen avulla (nailonkelmulla tapahtuva in situ –hybridisaatio) etsisimme nyt sille koplementaarisen emäsjärjestyksen sisältävät pesäkkeet silppua 2 sisältävästä geenikirjastosta. Koeputki nro 2 Restriktiosilppu koeputkessa nro 2 voisi koostua vaikkapa seuraavanlaisista DNA-jaksoista (huomaa, että DNA on katkeillut eri kohdista kuin koeputkessa 1). ATCGGCAT TAAGCACCTTAGAAATG CAACCCCGTA CGGATAATGATAGCGTAGCTA Edellisessä kohdassa valmistamaamme koetinta vastaava komplementaarinen emäsjärjestys esiintyy tässä silpustossa toisena näkyvissä DNA-jaksoissa (merkitty silppuun harmaalla). Uuden in situ –hybridisaatiokierroksen avulla saisimme selville ne bakteeripesäkkeet, joissa kyseinen DNA-jakso esiintyisi kirjastossa nro 2. Nyt näissäkin pesäkkeissä olevan siirto-DNA-juosteen emäsjärjestys selvitettäisiin Sanger-menetelmällä ja siinä viimeisinä oleville emäksille valmistettaisiin komplementaarinen koetin. Tämä olisi emäsjärjestykseltään TTTAC. Tämänkin koettimen avulla etsisimme nyt sille koplementaarisen emäsjärjestyksen sisältävät pesäkkeet silppua 3 sisältävästä geenikirjastosta. Koetinta vastaava komplementaarinen emäsjärjestys on merkitty silppuun 3 (seuraavan väliotsikon alla) harmaalla. Koeputki nro 3 Restriktiosilppu koeputkessa nro 3 voisi koostua vaikkapa seuraavanlaisista DNA-jaksoista ATCGGCATTAAGCACCTTA GAAATGCAACCCCGTACGG ATAATGATAGCGTAGCTA Harmaalla merkityn jakson sisältävän DNA-juosteen emäsjärjestys selvitettäisiin jälleen Sanger-menetelmällä ja vuorostaan siinä viimeisinä oleville emäksille valmistettaisiin komplementaarinen koetin. Tämä olisi emäsjärjestykseltään ATGCC. Tämänkin koettimen avulla etsisimme nyt sille koplementaarisen emäsjärjestyksen sisältävät pesäkkeet silppua 4 sisältävästä geenikirjastosta. Tätä koetinta vastaava komplementaarinen emäsjärjestys on merkitty silppuun 4 (seuraavan väliotsikon alla) harmaalla.
  24. 24. Koeputki nro 4 Restriktiosilppu koeputkessa nro 4 voisi koostua vaikkapa seuraavanlaisista DNA-jaksoista ATCGGCATTAAGCACC TTAGAAATGCAACC CCGTACGGATAATGATAGCGTAGCTA jne. jne. jne. Huomaathan, että... Pilkotusta pitkästä DNA-juosteesta restriktioentsyymeillä saatavien lyhyiden DNA-jaksojen sekvenssoiminen esim. Sanger-menetelmällä ei ole vaikeata. Mutta vaikeata on selvittää, missä järjestyksessä nämä lyhyet DNA-jaksot esiintyvät alkuperäisessä pitkässä DNA-juosteessa, kuten vaikkapa kromosomissa. Yllä esitetyssä menetelmässä järjestys selviää kätevästi silppujen emäsjärjestyksessä esiintyvien päällekkäisyyksien avulla. Päällekkäisyydet havaitaan tietokoneohjelmien avulla. Kun palapeli kootaan lopulta yhteen, tuloksena syntyy esim. kokonaisen kromosomin täydellinen emäsjärjestys alusta loppuun saakka. Esimerkiksi ihmisen genomin emäsjärjestystä selvitettäessä (ns. Human Genome Project) meneteltiin juuri edellä kuvatulla tavalla. Oppikirjassa haulikkomenetelmä esitellään sivulla 68. Edellä harmaaksi värittämiäni DNA-jaksoja kutsutaan kirjassamme geenimerkeiksi. Tässä haulikkomenetelmän vaiheet vielä lyhyenä luettelona: 1. DNA:n eristäminen 2. Näyte jaetaan moneen eri koeputkeen 3. Pilkotaan restriktioentsyymillä (jokaiseen putkeen eri restriktioentsyymiä) 4. Jokaisessa putkessa monistus PCR:llä 5. Yksi putki elektroforeesiin 6. Yksi raita erilleen, monistetaan uudelleen PCR:llä. Monistetun raidan emäsjärjestys selvitetään Sanger-menetelmällä ja valmistetaan emäsjärjestystä vastaava geenikoetin. 7. Jokaisesta putkesta perustetaan genominen geenikirjasto 8. Geenikirjastoista otetaan leimat nailonkelmuille 9. Kelmut kestävöidään ja niitä huljutetaan kohdassa 6 tehtyä geenikoetinta sisältävässä liemessä 10. Katsotaan, missä pesäkkeissä geenikoetin osoittautui toimivaksi 11. Nyt näistä pesäkkeistä irroitetaan koettimella löytämämme DNA-jakso. Tämä pannaan PCR:ään ja Sangeriin kohdan 6 mukaisella tavalla 12. Toistetaan vaiheet 6, 7, 8, 9, 10 ja 11 niin monta kierrosta, että koko genomin emäsjärjestys on selvillä. Vertailussa genomiset ja cDNA-geenikirjastot Genomisten eli bakteerikasvatukseen perustuvien geenikirjastojen etuna on, että niissä ovat mukana myös geenien väliset nonsense-DNA-jaksot (nämä kattavat peräti 97 % DNA:sta), geenien rakenneosissa lymyilevät intronit sekä geenien säätelyosat (promoottorit, enhanserit ja silenserit). Vaikkapa homeobox-geenejä tutkittaessa kiinnostuksen kohteena saattavat olla juuri säätelyosat. Silloin, kun geenikirjasto tuotetaan käänteiskopioijaentsyymin avulla pelkistä lähetti-RNA-molekyyleistä, tuloksena on kopioita vain geenien rakenneosista. Säätelyosien lisäksi näistä puuttuvat geenien rakenneosan sisälle jäävät intronijaksot. cDNA-geenikirjastoissa ei siis esiinny introneita eikä edellä mainittuja geenien säätelyyn osallistuvia DNA-jaksoja. Juu!
  25. 25. 9.11. Green Fluorescent Protein eli GFP Monia solubiologisia ilmiöitä voidaan nykyisin seurata reaaliaikaisesti uusien molekyylitasolle yltävien värjäysmenetelmien avulla. Usein värjäysmenetelmissä hyödynnetään sinivihreää valoa hohtavaa proteiinia, jota eräät meduusat ja kampamaneetit tuottavat. Proteiini tuntee nimen Green Fluorescent Protein (=GFP). GFP:tä koodaava geeni onnistuttiin eristämään. Tutkijat myös tarkoituksellisesti mutatoivat geeniä niin, että geenituotteina saatiin lukuisia erilaisia värimuunnoksia. Nykyisin tuotetaan esimerkiksi punaista, keltaista, vihreätä tai sinistä valoa hohtavia GFP-proteiineja. GFP-geenin eri versioita voidaan yhdistää muiden geenien jatkoksi. Kun ”isäntänä” toimivan geenin promoottoriosa päräyttää RNA-polymeraasin liikkeelle, syntyy lähetti-RNA-molekyylejä, joiden alussa on ”isäntägeenin” koodaaman proteiinin rakenneohje, mutta sen mukana myös GFP-proteiinia koodaava RNA-ketju (Kuva 68). Näin jokainen yhdistelmägeenin perusteella rakennettu proteiini saa kylkeensä näkyvää valoa hohtavan ”lampun”. Proteiinien avaruusrakenne, ja samalla proteiinin toimintatapa, häiriintyy helposti ylimääräisten lisukkeiden vaikutuksesta. Jotta GFP-osa ei häiritsisi ”isäntäproteiinin” toimintaa, liitetään ”isäntägeenin” ja GFP-geenijakson väliin lyhyt ylimääräinen nukleotidiketju. Tarkoitukseen valitaan sellainen emäsjärjestys, jonka vanhastaan tiedetään koodaavan suoraa, siimamaisen muodon saavaa aminohappoketjua. Näin GFP kulkee proteiinin lisukkeena, mutta turvallisen etäisyyden päässä, vähän niin kuin ilmapallo narussaan. Tämä välike ”isäntäproteiinia” ja GFP-osaa koodaavan geenijakson välillä on suomeksi linkkeri eli yhdistäjä (Kuva 68). Virallisesti sen nimi englanniksi on ”flexible polypeptide linker region” (flexible = taipuisa, polypeptide = lyhyt aminohappoketju, linker = yhdistäjä, region = alue). Kuva 68. GFP-yhdistelmägeeni. ”Isäntägeenin” promoottoriosan (musta) ja rakenneosan (vihreä) jatkoksi on liitetty linkkeriosa (punainen) ja GFP-osa (sininen). RNA-polymeraasi kopioi promoottorin perässä olevan DNA-jakson yhdeksi pitkäksi mRNA-molekyyliksi. ”Isäntägeenin” promoottoriosa GFP-osa ”Isäntägeenin” rakenneosa Linkkeriosa GFP-yhdistelmägeeni
  26. 26. Itsevalaisevia reseptoreita Esimerkiksi valkosoluihin kuuluvat dendrosyytit ja T-solut telakoituvat kiinni toisiinsa silloin, kun dendrosyytit esittelevät T-soluille vierasantigeenejä. Telakoituminen tapahtuu solukelmulla olevien reseptoriproteiinien avulla. Dendrosyytin pinnalla on MHC- reseptoreita ja B7-apureseptoreita. T-solun pinnalla on CD28-apureseptoreita sekä vierasantigeenien tunnistamiseen erikoistuneita T-solureseptoreita (kuva 69). Esittelyn alkaessa solut asettavat solukelmunsa vastakkain, ne ikään kuin antavat toisilleen muiskauksen. Paikkaan, missä solukelmut koskettavat toisiaan, kertyy tuolloin runsaasti kummankin solutyypin apureseptoreita B7 ja CD28. Apureseptoreillaan solut ”paiskaavat kättä” telakoituen kiinni toisiinsa. Kun telakoituminen on tapahtunut, apureseptorit alkavat siirtyä ”muiskauskohdan” reunamille. Nyt ”muiskauksen” keskiosaan alkaa vuorostaan kerääntyä MHC- ja T-solureseptoreita. Kun ne nyt kohtaavat toisensa, on vuorossa varsinainen antigeenien esittely. Tätäkin siis tapahtuu laajalla alueella dendrosyytin ja T-solun solukelmulla lukuisien MHC- / T-solureseptoriparien kesken (kuva 70). Jos yhdistelmä-DNA-tekniikalla (kuva 68) liitetään esimerkiksi Dendrosyytin B7-reseptoreihin punainen GFP- proteiini ja MHC-reseptoreihin vihreä, voidaan reseptorien sijaintia ja liikehdintää solukelmulla seurata värien leikkinä reaaliaikaisesti valomikroskoopilla (kuva 70). Kuva 69. Dendrosyytti ja T-solu telakoituvat toisiinsa solukelmulla olevien reseptorien avulla. Ensin yhtyvät toisiinsa B7- ja CD28-, vasta tämän jälkeen MHC- ja T-solureseptorit. T-solu Dendro- syytti MHC T-solu- reseptori B7 CD28
  27. 27. Itsevalaisevia transkriptiofaktoreita Samanlaisella yhdistelmä-DNA-tekniikalla voidaan tuottaa valoa hohtavia transkriptiofaktoreita. Jos tutkimuksen kohteena ovat vaikkapa alkionkehitystä ohjaavat transkriptiofaktorit, valon syttyminen solulimassa paljastaa, missä alkionkehityksen vaiheessa solut kyseisiä TF:iä tuottavat. Kun valotäplät siirtyvät solulimasta tumaan, on se merkki transkriptiofaktoreiden aktivoitumisesta ja siitä, että ne kiinnittyvät omien kohdegeeniensä säätelyosiin. Tilaa luovuudelle! a) GFP-geenikoettimia GFP:n rakennetta koodaavassa geenissä on kaksi peräkkäin sijaitsevaa osaa. Toinen osa koodaa aminohappoketjua, joka muodostaa lampunvarjostinta muistuttavan lieriömäisen rakenteen. Toinen osa koodaa pienempää sauvamaista rakennetta, jota kutsutaan kromoforiksi. Valmiissa GFP:ssä kromoforiosa työntyy ”varjostinosan” sisään. GFP tuottaa luminenssia (valoa) vain, kun mainitut osat ovat sisäkkäin (Kuvan 71 yläosa). Eräs tutkijaryhmä sai ajatuksen katkaista GFP-geeni kahtia juuri ”varjostin-” ja kromoforiosan välistä. Näin voitiin valmistaa kahdenlaisia GFP-geenejä: sellaisia, joissa oli pelkän ”varjostimen” rakenneohje sekä sellaisia, joissa oli pelkän kromoforin rakenneohje. Näitä kumpaakin geeniä sitten kloonattiin (=monistettiin) erikseen. Kun geenit istutettiin bakteereihin, kumpaakin osaproteiinia voitiin tuottaa suuria määriä (Kuvan 71 keskiosa). Kun epäsymmetrisellä PCR-menetelmällä monistetaan jotakin DNA-juostetta, voidaan PCR pysäyttää yksijuosteiseen vaiheeseen ja kemiallisesti kiinnittää jokaisen juosteen 5´-päähän GFP:n varjostinproteiini. Kiinnittämisessä yleisimmin käytetty kemiallinen ”välike” on eräs B-ryhmän vitamiini biotiini (englanniksi välikkeen lisääminen onkin nimeltään biotinylation). Näin saadaan ”GFP-hatutettuja” geenikoettimia, joita voidaan kestävöidä geenisiruihin. Lopputilanne: B7- apureseptorit laidoilla (vihreä), MHC-reseptorit keskellä (punainen). Lähtötilanne: B7- apureseptorit keskellä (vihreä), MHC-reseptorit laidoilla (punainen). Kuva 70. B7- ja MHC-reseptorien liikkuminen dendrosyytin solukelmulla (vertaa kuvaan 69). Kuvassa on se alue solukelmusta, jonka kohdalta dendrosyytti telakoituu T-solun kanssa. Välivaihe: B7- ja MHC-reseptorit vaihtavat paikkaa.
  28. 28. Jos halutaan selvittää, täsmääkö jonkin DNA-näytteen emäsjärjestys edellä mainittuihin geenikoettimiin, voidaan näytejuosteiden 3´-päät puolestaan leimata GFP:n kromoforiosilla. Jos emäsjärjestykset täsmäävät, näytejuosteet pariutuvat geenisirulla olevien koettimien kanssa. Tällöin DNA-juosteiden 3´ja 5´-päät asettuvat sirulla kohdakkain, kromoforit löytävät ”varjostimensa” ja GFP:t alkavat tuottaa valoa, näppärää (kuvan 71 alaosa)! ”Varjostinosa” KromoforiosaGFP GFP-geeni 3´ 5´ 5´ 3´ 3´ 5´5´ 3´ Kuva 71. GFP:n geeni koodaa kromoforiosaa ja ”varjostinosaa”. Geeni voidaan katkaista, jolloin saadaan erillinen geeni kummallekin osalle. Geenejä voidaan kloonata (=monistaa) ja tuottaa niiden avulla asianomaisia proteiineja. Proteiineilla voidaan leimata esimerkiksi DNA:n yksöisjuosteita. Kun juosteet pariutuvat, GFP alkaa tuottaa valoa. ”Varjostin”geeni Kromoforigeeni Leimataan mikrosirulla olevien geenikoettimien ja tutkittavassa näytteessä olevien DNA-juosteiden vastakkaiset päät GFP:n eri osilla. Luminesenssi Tutkittava DNA-näyte Mikrosirulla oleva geenikoetin
  29. 29. b) GFP-transkriptiofaktoreita Monet transkriptiofaktorit ovat dimeerejä. Tämä tarkoittaa sitä, että ne kiinnittyvät geenien säätelyosiin aina parina, vähän niin kuin vasemman- ja oikeankäden hansikas, kun pannaan kädet ristiin. Jos nyt valmistetaan GFP-yhdistelmägeenejä, jotka koodaavat tällaisia transkriptiofaktoreita, voidaan vasemmanpuoleista osaa koodaavan geenin jatkoksi liittää pelkän ”varjostinosan” rakenneohje ja oikeanpuoleista osaa koodaavan geenin jatkoksi pelkän kromoforiosan rakenneohje. Kun nämä geenit toimivat, syntyy kahdenlaisia GFP-transkriptiofaktoreita: osassa on mukana ”varjostin-” ja osassa kromoforiosa. Kyseiset transkriptiofaktorit sytyttävät ja sammuttavat valonsa sitä mukaa, kuin ne aktivoituvat eli kiinnittyvät pareina kohdegeeniensä säätelyosiin tai irtautuvat niistä. GFP:stä Nobel-palkinto GFP-rekombinanttigeenit ovat rajusti helpottaneet solubiologisten ilmiöiden tutkimusta. Merkittävyydessä menetelmää on verrattu jopa mikroskoopin keksimiseen. GFP-väreillä on tutkittu synapsien syntyä hermosoluissa, aivosolujen vaurioitumista rappeuttavissa aivosairauksissa, haiman insuliinia tuottavien beta-solujen toimintaa ja syöpäsolujen leviämistä elimistössä. GFP paljastaa milloin ja missä jokin geeni alkaa toimia sekä sen, minne geenin koodaamat proteiinit siirtyvät valmistumisensa jälkeen. GFP-rekombinanttitekniikan kehittäjät (Osamu Shimomura, Martin Chalfie ja Roger Tsien) saivat työstään kemian Nobel-palkinnon vuonna 2008. 9.12 RNA-interferenssi eli RNAi (interfere = puuttua asioiden kulkuun) Kaksijuosteiset RNA-virukset (dsRNA-virukset) ovat viruksia, joiden genomi muodostuu kahdesta toisiinsa sitoutuneesta RNA-juosteesta. Kun virus tunkeutuu isäntäsoluunsa, viruksen proteiinikotelo hajoaa. Sen jälkeen viruksen omat RNA-polymeraasit alkavat valmistaa kopioita alkuperäisestä virusgenomista. Genomin perusteella valmistuu myös yksijuosteisia mRNA-molekyylejä. Niiden perusteella isäntäsolun ribosomit alkavat valmistaa virukselle ominaisia proteiineja. Yksi kuuluisimmista dsRNA-viruksista on mahatautia aiheuttava rotavirus. Evoluution kuluessa kehittyi soluihin jo varhain kyky havaita virusinfektiot juuri kaksijuosteisten RNA-molekyylien perusteella. Solulimassa olevat Dicer-nimiset proteiinit tarttuvat dsRNA-molekyyleihin ja katkovat ne 22 nukleotidin mittaisiksi jaksoiksi. Sen jälkeen RISC-proteiini (=RNA Induced Silencing) hajottaa pilkkeet yksijuosteiseksi RNA:ksi. RISC rakentuu useammasta pienemmästä proteiinista modulaarisesti samaan tapaan kuin vaikkapa B- valkosolujen tuottamat vasta-aineet. RISC-proteiinin kuljettaa mukanaan viruksen yksijuosteisia RNA-jaksoja. Tällöin sellaiset solussa olevat mRNA- molekyylit, joissa on virus-RNA-jaksolle vastakkainen emäsjärjestys, pariutuvat sen kanssa ja niiden translaatio proteiineiksi pysähtyy. Näin virusproteiinien tuotanto loppuu, eikä virus pysty lisääntymään (kuva 72).
  30. 30. 2b. Dicer alkaa katkoa viruksen dsRNA:ta lyhyemmiksi pilkkeiksi. 1. Viruksen dsRNA- genomi saapuu soluun. Dicer 2a. dsRNA:n perusteella alkaa valmistua viruksen lähetti-RNA-molekyylejä. 3. RISC halkaisee pilkkeet yksijuosteisiksi RNA- molekyyleiksi ja alkaa kuljettaa niitä mukanaan. 4. RISC tarttuu viruksen lähetti-RNA- juosteisiin, koska nimenomaan niissä on RISCiin kiinnittyneelle RNA- juosteelle vastakkainen emäsjakso. 5. Isäntäsolun ribosomit eivät voi lukea viruksesta peräisin olevia lähetti- RNA-molekyylejä, jolloin viruksen toiminta estyy. Virusgenomin tuottamia lähetti- RNA-molekyylejä RISC Kuva 72. RNA-interferenssin toimintaperiaate. Dicer ja RISC ovat proteiineja, jotka vaimentavat virusgenomin toiminnan.
  31. 31. RNAi:hin perustuvat hoitomuodot Kaksijuosteisia RNA-molekyylejä voidaan valmistaa myös tarkoituksellisesti. Tällaisen RNA-molekyylin mallina voidaan käyttää vaikkapa syöpägeeniksi mutatoitunutta DNA-jaksoa. Kun kyseinen kaksijuosteinen RNA-molekyyli viedään potilaan soluihin viruksen mukana, RISC estää nyt virus-RNA:n ohella myös syöpägeenin proteiinituotannon. Siksi, vaikka itse syöpägeeni säilyykin solun genomissa, solu kuitenkin lakkaa toimimasta syöpäsolun tapaan. RNAi:tä voidaan käyttää myös retrovirusten vaimentamiseen. Retroviruksien genomi on yksijuosteinen RNA- molekyyli, jonka virus muuttaa käänteistranskriptaasin avulla kaksijuosteiseksi DNA:ksi. Kaksijuosteinen DNA asettuu sitten isäntäsolun geenien joukkoon. Jos valmistetaan kaksijuosteisia RNA-molekyylejä, joissa on virusgenomille ominaisia 22 nukleotidin mittaisia emäsjärjestyksiä, Dicer ja RISC estävät viruksen lisääntymisen. Esimerkiksi HIV on retrovirus. RNAi tuotti löytäjilleen (Andrew Fire ja Craig C. Mello) lääketieteen Nobel-palkinnon vuonna 2006.

×