Hoofdstuk 16-mutations-dna repair

596 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
596
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
40
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Hoofdstuk 16-mutations-dna repair

  1. 1. Genetics: Analysis and Principles Robert J. Brooker Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display CHAPTER 16 GENE MUTION AND DNA REPAIR
  2. 2. INTRODUCTION <ul><li>The term mutation refers to a heritable change in the genetic material </li></ul><ul><li>Mutations provide allelic variations </li></ul><ul><ul><li>On the positive side, mutations are the foundation for evolutionary change needed for a species to adapt to changes in the environment </li></ul></ul><ul><ul><li>On the negative side, new mutations are much more likely to be harmful than beneficial to the individual and often are the cause of diseases </li></ul></ul><ul><li>Since mutations can be quite harmful, organisms have developed ways to repair damaged DNA </li></ul>16-2 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
  3. 3. <ul><li>Mutations can be divided into three main types </li></ul><ul><ul><li>1. Chromosome mutations </li></ul></ul><ul><ul><ul><li>Changes in chromosome structure </li></ul></ul></ul><ul><ul><li>2. Genome mutations </li></ul></ul><ul><ul><ul><li>Changes in chromosome number </li></ul></ul></ul><ul><ul><li>3. Single-gene mutations </li></ul></ul><ul><ul><ul><li>Relatively small changes in DNA structure that occur within a particular gene </li></ul></ul></ul><ul><ul><li>Types 1 and 2 were discussed in chapter 8 </li></ul></ul><ul><ul><li>Type 3 will be discussed in this chapter </li></ul></ul>16.1 CONSEQUENCES OF MUTATIONS Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-3
  4. 4. Mutations Change the DNA Sequence Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>A point mutation is a change in a single base pair </li></ul><ul><ul><li>It involves a base substitution </li></ul></ul>16-4 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGC G AGATC 3’ 3’ TTGCG C TCTAG 5’ <ul><ul><li>A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine </li></ul></ul><ul><ul><li>A transversion is a change of a pyrimidine to a purine or vice versa </li></ul></ul><ul><ul><li>Transitions are more common than transversions </li></ul></ul>
  5. 5. Mutations Change the DNA Sequence Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Mutations may also involve the addition or deletion of short sequences of DNA </li></ul>16-5 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCGC 3’ 3’ TTGCGCG 5’ Addition of four base pairs 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AAC AGTC GCTAGATC 3’ 3’ TTG TCAG CGATCTAG 5’ Deletion of four base pairs
  6. 6. Mutations Can Alter the Coding Sequence Within a Gene Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Mutations in the coding sequence of a structural gene can have various effects on the polypeptide </li></ul><ul><ul><li>Silent mutations are those base substitutions that do not alter the amino acid sequence of the polypeptide </li></ul></ul><ul><ul><ul><li>Due to the degeneracy of the genetic code </li></ul></ul></ul><ul><ul><li>Missense mutations are those base substitutions in which an amino acid change does occur </li></ul></ul><ul><ul><ul><li>Example: Sickle-cell anemia (Refer to Figure 16.1) </li></ul></ul></ul><ul><ul><ul><li>If the substituted amino acid has no detectable effect on protein function, the mutation is said to be neutral. This can occur if the new amino acid has similar chemistry </li></ul></ul></ul>16-6
  7. 7. Mutations Can Alter the Coding Sequence Within a Gene Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Mutations in the coding sequence of a structural gene can have various effects on the polypeptide </li></ul>16-7 <ul><ul><li>Nonsense mutations are those base substitutions that change a normal codon to a termination codon </li></ul></ul><ul><ul><li>Frameshift mutations involve the addition or deletion of nucleotides in multiples of one or two </li></ul></ul><ul><ul><ul><li>This shifts the reading frame so that a completely different amino acid sequence occurs downstream from the mutation </li></ul></ul></ul>
  8. 8. 16-8
  9. 9. Gene Mutations and Their Effects on Genotype and Phenotype Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>In a natural population, the wild-type is the relatively prevalent genotype. Infrequently, some genes with multiple alleles may have two or more wild-types. </li></ul><ul><li>A forward mutation changes the wild-type genotype into some new variation </li></ul><ul><li>A reverse mutation changes a mutant allele back to the wild-type </li></ul><ul><ul><li>It is also termed a reversion </li></ul></ul>16-9
  10. 10. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Mutations can also be described based on their effects on the wild-type phenotype </li></ul><ul><ul><li>When a mutation alters an organism’s phenotypic characteristics, it is said to be a variant </li></ul></ul><ul><li>Variants are often characterized by their differential ability to survive </li></ul><ul><ul><li>Deleterious mutations decrease the chances of survival </li></ul></ul><ul><ul><ul><li>The most extreme are lethal mutations </li></ul></ul></ul><ul><ul><li>Beneficial mutations enhance the survival or reproductive success of an organism </li></ul></ul><ul><li>Some mutations are called conditional mutants </li></ul><ul><ul><li>They affect the phenotype only under a defined set of conditions </li></ul></ul><ul><ul><li>An example is a temperature-sensitive mutation </li></ul></ul>16-10
  11. 11. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>A second mutation will sometimes affect the phenotypic expression of another </li></ul><ul><li>These second-site mutations are called suppressor mutations or simply suppressors </li></ul><ul><li>Suppressor mutations are classified into two types </li></ul><ul><ul><li>Intragenic suppressors </li></ul></ul><ul><ul><ul><li>The second mutant site is within the same gene as the first mutation </li></ul></ul></ul><ul><ul><li>Intergenic suppressors </li></ul></ul><ul><ul><ul><li>The second mutant site is in a different gene from the first mutation </li></ul></ul></ul><ul><ul><li>Refer to Table 16.2 </li></ul></ul>16-11
  12. 12. 16-11
  13. 13. Gene Mutations in Noncoding Sequences Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>These mutations can still affect gene expression </li></ul><ul><ul><li>A mutation, may alter the sequence within a promoter </li></ul></ul><ul><ul><ul><li>Up promoter mutations make the promoter more like the consensus sequence </li></ul></ul></ul><ul><ul><ul><ul><li>They may increase the rate of transcription </li></ul></ul></ul></ul><ul><ul><ul><li>Down promoter mutations make the promoter less like the consensus sequence </li></ul></ul></ul><ul><ul><ul><ul><li>They may decrease the rate of transcription </li></ul></ul></ul></ul><ul><ul><li>A mutation can also alter splice junctions in eukaryotes </li></ul></ul><ul><ul><li>Refer to Table 16.3 for other examples </li></ul></ul>16-12
  14. 14. 16-13
  15. 15. Mutations Due to Trinucleotide Repeats Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE) </li></ul><ul><ul><li>The term refers to the phenomenon that a sequence of 3 nucleotides can increase from one generation to the next </li></ul></ul><ul><li>These diseases include </li></ul><ul><ul><li>Huntington disease (HD) </li></ul></ul><ul><ul><li>Fragile X syndrome (FRAXA) </li></ul></ul>16-14
  16. 16. 16-15
  17. 17. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Certain regions of the chromosome contain trinucleotide sequences repeated in tandem </li></ul><ul><ul><li>In normal individuals, these sequences are transmitted from parent to offspring without mutation </li></ul></ul><ul><ul><li>However, in persons with TRNE disorders, the length of a trinucleotide repeat increases above a certain critical size </li></ul></ul><ul><ul><ul><li>It also becomes prone to frequent expansion </li></ul></ul></ul><ul><ul><ul><li>This phenomenon is shown here with the trinucleotide repeat CAG </li></ul></ul></ul>16-16 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG n = 11 n = 18
  18. 18. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>In some cases, the expansion is within the coding sequence of the gene </li></ul><ul><ul><li>Typically the trinucleotide expansion is CAG (glutamine) </li></ul></ul><ul><ul><li>Therefore, the encoded protein will contain long tracks of glutamine </li></ul></ul><ul><ul><ul><li>This causes the proteins to aggregate with each other </li></ul></ul></ul><ul><ul><ul><li>This aggregation is correlated with the progression of the disease </li></ul></ul></ul><ul><li>In other cases, the expansions are located in noncoding regions of genes </li></ul><ul><ul><li>Some of these expansions are hypothesized to cause abnormal changes in RNA structure </li></ul></ul><ul><ul><li>Some produce methylated CpG islands which may silence the gene </li></ul></ul>16-17
  19. 19. Changes in Chromosome Structure Can Affect Gene Expression Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>A chromosomal rearrangement may affect a gene because the break occurred in the gene itself </li></ul><ul><li>A gene may be left intact, but its expression may be altered because of its new location </li></ul><ul><ul><li>This is termed a position effect </li></ul></ul><ul><li>There are two common reasons for position effects: </li></ul><ul><ul><li>1. Movement to a position next to regulatory sequences </li></ul></ul><ul><ul><li>2. Movement to a position in a heterochromatic region </li></ul></ul>16-19
  20. 20. Figure 16.2 16-20 Regulatory sequences are often bidirectional
  21. 21. Mutations Can Occur in Germ-Line or Somatic Cells Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Geneticists classify the animal cells into two types </li></ul><ul><ul><li>Germ-line cells </li></ul></ul><ul><ul><ul><li>Cells that give rise to gametes such as eggs and sperm </li></ul></ul></ul><ul><ul><li>Somatic cells </li></ul></ul><ul><ul><ul><li>All other cells </li></ul></ul></ul><ul><ul><li>Germ-line mutations are those that occur directly in a sperm or egg cell, or in one of their precursor cells </li></ul></ul><ul><ul><ul><li>Refer to Figure 16.4 a </li></ul></ul></ul><ul><ul><li>Somatic mutations are those that occur directly in a body cell, or in one of its precursor cells </li></ul></ul><ul><ul><ul><li>Refer to Figure 16.4 b AND 16.5 </li></ul></ul></ul>16-21
  22. 22. Figure 16.4 16-22 Therefore, the mutation can be passed on to future generations The size of the patch will depend on the timing of the mutation The earlier the mutation, the larger the patch An individual who has somatic regions that are genotypically different from each other is called a genetic mosaic Therefore, the mutation cannot be passed on to future generations
  23. 23. <ul><li>Mutations can occur spontaneously or be induced </li></ul><ul><li>Spontaneous mutations </li></ul><ul><ul><li>Result from abnormalities in cellular/biological processes </li></ul></ul><ul><ul><ul><li>Errors in DNA replication, for example </li></ul></ul></ul><ul><li>Induced mutations </li></ul><ul><ul><li>Caused by environmental agents </li></ul></ul><ul><ul><li>Agents that are known to alter DNA structure are termed mutagens </li></ul></ul><ul><ul><ul><li>These can be chemical or physical agents </li></ul></ul></ul><ul><li>Refer to Table 16.5 </li></ul>16.2 OCCURRENCE AND CAUSES OF MUTATION Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-23
  24. 24. 16-24
  25. 25. Spontaneous Mutations Are Random Events Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Are mutations spontaneous occurrences or causally related to environmental conditions? </li></ul><ul><ul><li>This is a question that biologists have asked themselves for a long time </li></ul></ul>16-25
  26. 26. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>These two opposing theories of the 19th century were tested in bacteria in the 1940s and 1950s </li></ul><ul><li>Salvadore Luria and Max Delbruck studied the resistance of E. coli to infection by bacteriophage T1 </li></ul><ul><ul><li>ton r ( T on e r esistance) </li></ul></ul><ul><ul><li>They wondered if ton r is due to spontaneous mutations or to a physiological adaptation that occurs at a low rate </li></ul></ul><ul><ul><ul><li>The physiological adaptation theory predicts that the number of ton r bacteria is essentially constant in different bacterial populations </li></ul></ul></ul><ul><ul><ul><li>The spontaneous mutation theory predicts that the number of ton r bacteria will fluctuate in different bacterial populations </li></ul></ul></ul><ul><ul><ul><ul><li>Their test therefore became known as the fluctuation test </li></ul></ul></ul></ul>16-26
  27. 27. <ul><li>An important evidence for the emergence of mutations in a random manner (‘at random’): </li></ul><ul><li> “ Fluctuationtest “ (1943) with bacteria: “Classic” </li></ul><ul><li>experiment: Origin of resistance (mutation) in E. coli against lysis through a ‘bacterio phage’ in cultures </li></ul><ul><ul><ul><li>Hypotheses: </li></ul></ul></ul><ul><li>1. Each E.coli can become resistant through a growing condition </li></ul><ul><li> : fysiological induction >> aprox. the same mutation in each culture </li></ul><ul><li>2. Origin through coincidence: no mutants, early, or late in the growing process of the bacterial cultures </li></ul><ul><li> >> expectations is: large differences (‘fluctuation’) in number of mutants between the cultures </li></ul><ul><li>Experiment: small bac. cultures: to test on phage-resistant bacteria </li></ul>
  28. 28. Test of the two hypotheses: Fluctuation Test Predictions:
  29. 29. Results Fluctuation Test Gekwantifiseerd: >> counting of phage-resistant colonies <ul><li>- If you take 0.2 mL of a great culture and plate it out, on each plate you shall see the same amount of colonies </li></ul><ul><li>but, if you let 0.2 mL of cultures grow separately, and thereafter you plate them out in presence of phages, you shall see great differences in numbers of colonies (from 0 to >100 !) </li></ul><ul><li>Conclusion: Induction of resistance occurs randomly instead of directed or physiological induces. Mutation= random process </li></ul>
  30. 30. 16-27 E.. coli is grown in the absence of T1 phages 20 million cells each 20 million cells each Many ton r bacteria Mutation occurred at an early stage of population growth, before T1 exposure No ton r bacteria Spontaneous mutation did not occur Several independent ton r mutations occurred during different stages These are mixed together in a big flask to give an average value of ton r cells Great fluctuation in the number of ton r colonies Relatively even distribution of ton r colonies The Luria-Delbruck fluctuation test Figure 16.6
  31. 31. Mutation Rates and Frequencies Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>The term mutation rate is the likelihood that a gene will be altered by a new mutation </li></ul><ul><ul><li>It is commonly expressed as the number of new mutations in a given gene per generation </li></ul></ul><ul><ul><li>It is in the range of 10 -5 to 10 -9 per generation </li></ul></ul><ul><li>The mutation rate for a given gene is not constant </li></ul><ul><ul><li>It can be increased by the presence of mutagens </li></ul></ul><ul><li>Mutation rates vary substantially between species and even within different strains of the same species </li></ul>16-30
  32. 32. Mutation Rates and Frequencies Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Within the same individual, some genes mutate at a much higher rate than other genes </li></ul><ul><ul><li>Some genes are larger than others </li></ul></ul><ul><ul><ul><li>This provides a greater chance for mutation </li></ul></ul></ul><ul><ul><li>Some genes have locations within the chromosome that make them more susceptible to mutation </li></ul></ul><ul><ul><ul><li>These are termed hot spots </li></ul></ul></ul><ul><ul><li>Note: Hot spots can be also found within a single gene </li></ul></ul>16-31
  33. 33. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-32 Figure 6.20 Contain many mutations at exactly the same site within the gene
  34. 34. Mutation Rates and Frequencies Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>The mutation frequency for a gene is the number of mutant genes divided by the total number of genes in a population </li></ul><ul><ul><li>If 1 million bacteria were plated and 10 were mutant </li></ul></ul><ul><ul><ul><li>The mutation frequency would be 1 in 100,000 or 10 -5 </li></ul></ul></ul><ul><ul><li>The mutation frequency depends not only on the mutation rate, but also on the </li></ul></ul><ul><ul><ul><li>Timing of the mutation </li></ul></ul></ul><ul><ul><ul><li>Likelihood that the mutation will be passed on to future generations </li></ul></ul></ul>16-33
  35. 35. Causes of Spontaneous Mutations Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Spontaneous mutations can arise by three types of chemical changes </li></ul><ul><ul><li>1. Depurination </li></ul></ul><ul><ul><li>2. Deamination </li></ul></ul><ul><ul><li>3. Tautomeric shift </li></ul></ul>16-34 The most common
  36. 36. Causes of Spontaneous Mutations Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Depurination involves the removal of a purine (guanine or adenine) from the DNA </li></ul><ul><ul><li>The covalent bond between deoxyribose and a purine base is somewhat unstable </li></ul></ul><ul><ul><ul><li>It occasionally undergoes a spontaneous reaction with water that releases the base from the sugar </li></ul></ul></ul><ul><ul><li>This is termed an apurinic site </li></ul></ul><ul><ul><li>Fortunately, apurinic sites can be repaired </li></ul></ul><ul><ul><ul><li>However, if the repair system fails, a mutation may result during subsequent rounds of DNA replication </li></ul></ul></ul>16-35
  37. 37. 16-36 Three out of four (A, T and G) are the incorrect nucleotide There’s a 75% chance of a mutation Spontaneous depurination Figure 16.8
  38. 38. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Deamination involves the removal of an amino group from the cytosine base </li></ul><ul><ul><li>The other bases are not readily deaminated </li></ul></ul>16-37 Figure 16.9 <ul><li>DNA repair enzymes can recognize uracil as an inappropriate base in DNA and remove it </li></ul><ul><ul><li>However, if the repair system fails, a C-G to A-T mutation will result during subsequent rounds of DNA replication </li></ul></ul>
  39. 39. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Deamination of 5-methyl cytosine can also occur </li></ul>16-38 <ul><li>Thymine is a normal constituent of DNA </li></ul><ul><li>This poses a problem for repair enzymes </li></ul><ul><ul><li>They cannot determine which of the two bases on the two DNA strands is the incorrect base </li></ul></ul><ul><li>For this reason, methylated cytosine bases tend to create hot spots for mutation </li></ul>Figure 16.9
  40. 40. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>A tautomeric shift involves a temporary change in base structure </li></ul><ul><ul><li>The common, stable form of thymine and guanine is the keto form </li></ul></ul><ul><ul><ul><li>At a low rate, T and G can interconvert to an enol form </li></ul></ul></ul><ul><ul><li>The common, stable form of adenine and cytosine is the amino form </li></ul></ul><ul><ul><ul><li>At a low rate, A and C can interconvert to an imino form </li></ul></ul></ul><ul><li>These rare forms promote AC and GT base pairs </li></ul><ul><li>For a tautomeric shift to cause a mutation it must occur immediately prior to DNA replication </li></ul>16-39
  41. 41. 16-40 Figure 16.10 Rare Common
  42. 42. 16-41 Figure 16.10
  43. 43. 16-42 Figure 16.10 Temporary tautomeric shift Shifted back to its normal form
  44. 44. Types of Mutagens Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>An enormous array of agents can act as mutagens to permanently alter the structure of DNA </li></ul><ul><li>The public is concerned about mutagens for two main reasons: </li></ul><ul><ul><li>1. Mutagens are often involved in the development of human cancers </li></ul></ul><ul><ul><li>2. Mutagens can cause gene mutations that may have harmful effects in future generations </li></ul></ul><ul><li>Mutagenic agents are usually classified as chemical or physical mutagens </li></ul>16-52
  45. 45. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-53
  46. 46. Mutagens Alter DNA Structure in Different Ways Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Chemical mutagens come into three main types </li></ul><ul><ul><li>1. Base modifiers </li></ul></ul><ul><ul><li>2. Intercalating agents </li></ul></ul><ul><ul><li>3. Base analogues </li></ul></ul>16-54
  47. 47. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Base modifiers covalently modify the structure of a nucleotide </li></ul>16-55 <ul><ul><li>For example, nitrous acid , replaces amino groups with keto groups (–NH 2 to =O) </li></ul></ul><ul><ul><li>This can change cytosine to uracil and adenine to hypoxanthine </li></ul></ul><ul><ul><ul><li>These modified bases do not pair with the appropriate nucleotides in the daughter strand during DNA replication </li></ul></ul></ul><ul><ul><li>Refer to Figure 16.13 </li></ul></ul><ul><ul><li>Some chemical mutagens disrupt the appropriate pairing between nucleotides by alkylating bases within the DNA </li></ul></ul><ul><ul><ul><li>Examples: Nitrogen mustards and ethyl methanesulfonate (EMS) </li></ul></ul></ul>
  48. 48. 16-56 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display These mispairings create mutations in the newly replicated strand Mispairing of modified bases Figure 16.13
  49. 49. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Intercalating agents contain flat planar structures that intercalate themselves into the double helix </li></ul><ul><ul><li>This distorts the helical structure </li></ul></ul><ul><ul><li>When DNA containing these mutagens is replicated, the daughter strands may contain single-nucleotide additions and/or deletions resulting in frameshifts </li></ul></ul><ul><ul><li>Examples: </li></ul></ul><ul><ul><ul><li>Acridine dyes </li></ul></ul></ul><ul><ul><ul><li>Proflavin </li></ul></ul></ul><ul><ul><ul><li>(Ethidiumbromide (ook gebruikt om DNA zichtbaar te maken in een gel)) </li></ul></ul></ul>16-57
  50. 50. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Base analogues become incorporated into daughter strands during DNA replication </li></ul><ul><ul><li>For example, 5-bromouracil is a thymine analogue </li></ul></ul><ul><ul><ul><li>It can be incorporated into DNA instead of thymine </li></ul></ul></ul>16-58 Figure 16.14 Normal pairing This tautomeric shift occurs at a relatively high rate Mispairing
  51. 51. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-59 Figure 16.14 In this way, 5-bromouracil can promote a change of an AT base pair into a GC base pair
  52. 52. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Physical mutagens come into two main types </li></ul><ul><ul><li>1. Ionizing radiation </li></ul></ul><ul><ul><li>2. Nonionizing radiation </li></ul></ul><ul><li>Ionizing radiation </li></ul><ul><ul><li>Includes X rays and gamma rays </li></ul></ul><ul><ul><li>Has short wavelength and high energy </li></ul></ul><ul><ul><li>Can penetrate deeply into biological molecules </li></ul></ul><ul><ul><li>Creates chemically reactive molecules termed free radicals </li></ul></ul><ul><ul><li>Can cause </li></ul></ul><ul><ul><ul><li>Base deletions </li></ul></ul></ul><ul><ul><ul><li>Single nicks in DNA strands </li></ul></ul></ul><ul><ul><ul><li>Cross-linking </li></ul></ul></ul><ul><ul><ul><li>Chromosomal breaks </li></ul></ul></ul>16-60
  53. 53. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-61 <ul><li>Nonionizing radiation </li></ul><ul><ul><li>Includes UV light </li></ul></ul><ul><ul><li>Has less energy </li></ul></ul><ul><ul><li>Cannot penetrate deeply into biological molecules </li></ul></ul><ul><ul><li>Causes the formation of cross-linked thymine dimers </li></ul></ul><ul><ul><li>Thymine dimers may cause mutations when that DNA strand is replicated </li></ul></ul>Figure 16.15
  54. 54. Testing Methods Can Determine If an Agent Is a Mutagen Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Many different kinds of tests have been used to evaluate mutagenicity </li></ul><ul><ul><li>One commonly used test is the Ames test </li></ul></ul><ul><ul><ul><li>Developed by Bruce Ames </li></ul></ul></ul><ul><ul><ul><li>The test uses a strain of Salmonella typhimurium that cannot synthesize the amino acid histidine </li></ul></ul></ul><ul><ul><ul><ul><li>It has a point mutation in a gene involved in histidine biosynthesis </li></ul></ul></ul></ul><ul><ul><ul><li>A second mutation (i.e., a reversion) may occur restoring the ability to synthesize histidine </li></ul></ul></ul><ul><ul><ul><li>The Ames test monitors the rate at which this second mutation occurs </li></ul></ul></ul>16-62
  55. 55. 16-63 Provides a mixture of enzymes that may activate a mutagen The control plate indicates that there is a low level of spontaneous mutation The Ames test for mutagenicity Figure 16.16
  56. 56. <ul><li>Since most mutations are deleterious, DNA repair systems are vital to the survival of all organisms </li></ul><ul><ul><li>Living cells contain several DNA repair systems that can fix different type of DNA alterations </li></ul></ul><ul><li>In most cases, DNA repair is a multi-step process </li></ul><ul><ul><li>1. An irregularity in DNA structure is detected </li></ul></ul><ul><ul><li>2. The abnormal DNA is removed </li></ul></ul><ul><ul><li>3. Normal DNA is synthesized </li></ul></ul>16.3 DNA REPAIR Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-64
  57. 57. 16-65
  58. 58. Damaged Bases Can Be Directly Repaired Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>In a few cases, the covalent modifications of nucleotides can be reversed by specific enzymes </li></ul><ul><ul><li>Photolyase can repair thymine dimers </li></ul></ul><ul><ul><ul><li>It splits the dimers restoring the DNA to its original condition </li></ul></ul></ul><ul><ul><li>O 6 -alkylguanine alkyltransferase repairs alkylated bases </li></ul></ul><ul><ul><ul><li>It transfers the methyl or ethyl group from the base to a cysteine side chain within the alkyltransferase protein </li></ul></ul></ul><ul><ul><ul><ul><li>Surprisingly, this permanently inactivates alkyltransferase! </li></ul></ul></ul></ul>16-66
  59. 59. 16-67 Direct repair of damaged bases in DNA Figure 16.17
  60. 60. Base Excision Repair Removes a Damaged DNA Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Base Excision Repair (BER) involves a category of enzymes known as DNA N-glycosylases </li></ul><ul><ul><li>These enzymes can recognize an abnormal base and cleave the bond between it and the sugar in the DNA </li></ul></ul><ul><li>Depending on the species, this repair system can eliminate abnormal bases such as </li></ul><ul><ul><li>Uracil; Thymine dimers </li></ul></ul><ul><ul><li>3-methyladenine; 7-methylguanine </li></ul></ul>16-68
  61. 61. 16-69 Figure 16.18 Depending on whether a purine or pyrimidine is removed, this creates an ap urinic and an ap yrimidinic site, respectively Nick replication would be a more accurate term
  62. 62. Nucleotide Excision Repair Removes Damaged DNA Segments Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>An important general process for DNA repair is Nucleotide Excision Repair (NER) </li></ul><ul><li>This type of system can repair many types of DNA damage, including </li></ul><ul><ul><li>Thymine dimers and chemically modified bases </li></ul></ul><ul><ul><li>missing bases, some types of cross-link </li></ul></ul><ul><li>NER is found in all eukaryotes and prokaryotes </li></ul><ul><ul><li>However, its molecular mechanism is better understood in prokaryotes </li></ul></ul>16-70
  63. 63. Nucleotide Excision Repair Removes Damaged DNA Segments Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>In E. coli , the NER system requires four key proteins </li></ul><ul><ul><li>These are designated UvrA, UvrB, UvrC and UvrD </li></ul></ul><ul><ul><ul><li>Named as such because they are involved in U ltra v iolet light r epair of pyrimidine dimers </li></ul></ul></ul><ul><ul><ul><ul><li>They are also important in repairing chemically damaged DNA </li></ul></ul></ul></ul><ul><ul><li>UvrA, B, C, and D recognize and remove a short segment of damaged DNA </li></ul></ul><ul><ul><li>DNA polymerase and ligase finish the repair job </li></ul></ul><ul><ul><li>Refer to Figure 16.19 </li></ul></ul>16-71
  64. 64. 16-72 Figure 16.19
  65. 65. 16-73 Figure 16.19 Typically, the cuts are 4-5 nucleotides from the 3’ end of the damage, and 8 nucleotides from the 5’ end
  66. 66. Nucleotide Excision Repair Removes Damaged DNA Segments Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Several human diseases have been shown to involve inherited defects in genes involved in NER </li></ul><ul><ul><li>These include xeroderma pigmentosum (XP), Cockayne syndrome (CS) and PIBIDS </li></ul></ul><ul><ul><ul><li>A common characteristic of both syndromes is an increased sensitivity to sunlight </li></ul></ul></ul><ul><ul><li>Xeroderma pigmentosum can be caused by defects in seven different NER genes </li></ul></ul>16-74
  67. 67. Mismatch Repair Systems Detect and Correct A Base Pair Mismatch Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>A Base Mismatch is another type of abnormality in DNA </li></ul><ul><li>The structure of the DNA double helix obeys the AT/GC rule of base pairing </li></ul><ul><ul><li>However, during DNA replication an incorrect base may be added to the growing strand by mistake </li></ul></ul><ul><li>DNA polymerases have a 3’ to 5’ proofreading ability that can detect base mismatches and fix them </li></ul>16-75
  68. 68. Mismatch Repair Systems Detect and Correct A Base Pair Mismatch Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>If proofreading fails, the methyl-directed mismatch repair system comes to the rescue </li></ul><ul><li>Mismatch repair systems are found in all species </li></ul><ul><li>In humans, mutations in the system are associated with particular types of cancer </li></ul>16-76
  69. 69. Mismatch Repair Systems Detect and Correct A Base Pair Mismatch Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>The molecular mechanism of mismatch repair has been studied extensively in E. coli </li></ul><ul><ul><li>Three proteins, MutL, MutH and MutS detect the mismatch and direct its removal from the newly made strand </li></ul></ul><ul><ul><ul><li>The proteins are named Mut because their absence leads to a much higher mut ation rate than normal </li></ul></ul></ul><ul><ul><li>A key characteristic of MutH is that it can distinguish between the parental strand and the daughter strand </li></ul></ul><ul><ul><ul><li>Prior to replication, both strands are methylated </li></ul></ul></ul><ul><ul><ul><li>Immediately after replication, the parental strand is methylated whereas the daughter is not yet! </li></ul></ul></ul>16-77
  70. 70. 16-78 Acts as a linker between MutS and MutH Methyl-directed mismatch repair in E. coli Figure 16.21
  71. 71. 16-79 Methyl-directed mismatch repair in E. coli Figure 16.21
  72. 72. Double-Strand Breaks in DNA Can Be Repaired by Recombination Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>DNA Double-Strand Breaks are very dangerous </li></ul><ul><ul><li>Breakage of chromosomes into pieces </li></ul></ul><ul><ul><li>Caused by ionizing radiation and chemical mutagens </li></ul></ul><ul><ul><li>Also caused by free radicals which are the byproducts of cellular metabolism </li></ul></ul><ul><ul><li>10-100 breaks occur each day in a typical human cell </li></ul></ul><ul><ul><li>Breaks can cause chromosomal rearrangements and deficiencies </li></ul></ul><ul><ul><li>They may be repaired by two systems known as homologous recombination repair (HRR) and nonhomologous end joining (NHEJ) </li></ul></ul><ul><ul><ul><li>Refer to Figure 16.22 </li></ul></ul></ul>16-80
  73. 73. 16-81 Figure 16.22
  74. 74. 16-82 Figure 16.22
  75. 75. Repair of Actively Transcribed DNA Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>Not all DNA is repaired at the same rate </li></ul><ul><ul><li>Actively transcribed genes in eukaryotes and prokaryotes are more efficiently repaired than is nontranscribed DNA </li></ul></ul><ul><li>The targeting of DNA repair enzymes to actively transcribing genes has several biological advantages </li></ul><ul><ul><li>Active genes are more loosely packed </li></ul></ul><ul><ul><ul><li>May be more vulnerable to DNA damage </li></ul></ul></ul><ul><ul><li>Transcription may make DNA more susceptible to damage </li></ul></ul><ul><ul><li>DNA regions that contain active genes are more likely to be important for survival than nontranscribed regions </li></ul></ul>16-83
  76. 76. Repair of Actively Transcribed DNA Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>In E. coli , a protein known as transcription-repair coupling factor (TRCF) mediates between DNA repair and transcription </li></ul><ul><ul><li>It targets the NER system to actively transcribing genes having damaged DNA </li></ul></ul>16-84
  77. 77. 16-85 Figure 16.24
  78. 78. Repair of Actively Transcribed DNA Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display <ul><li>In eukaryotes, the mechanism that couples DNA repair and transcription is not completely understood </li></ul><ul><li>Several different proteins have been shown to act as transcription-repair coupling factors </li></ul><ul><ul><li>Some of these have been identified in people with high rates of mutation </li></ul></ul><ul><ul><li>For example, in Cockayne syndrome </li></ul></ul><ul><ul><ul><li>Two genes, CS-A and CS-B , encode proteins that function as transcription-repair coupling factors </li></ul></ul></ul>16-86
  79. 79. * Ataxia telangiectasia * Bloom syndrome * Cockayne's syndrome * Progeria (Hutchinson-Gilford Progeria syndrome) * Rothmund-Thomson syndrome * Trichothiodystrophy * Werner syndrome * Xeroderma pigmentosum Human diseases due to mutations in genes involved in DNA repair
  80. 80. End of Chapter 16

×