Presentation from Bioconference Live 2010

1,027 views

Published on

Published in: Technology, Business
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,027
On SlideShare
0
From Embeds
0
Number of Embeds
9
Actions
Shares
0
Downloads
8
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Presentation from Bioconference Live 2010

  1. 1. Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens. Agnieszka M. Lichanska, Clark Tibbetts, and Matthew C. Lorence TessArae, LLC, Potomac Falls, Virginia, USA TessArae, LLC, Proprietary Information
  2. 2. Overview  Re-sequencing technology vs. traditional diagnostic techniques  How does re-sequencing work?  How are the techniques different?  Identification of new pathogens - an example: novel H1N1 flu  Additional examples of use of RPM-Flu 3.1 assay  Summary TessArae, LLC, Proprietary Information
  3. 3. Shift in Microbial Diagnostics TessArae Inc. TessArray RPM-Flu v3.1 Respiratory Pathogen Panel P/N: 520-191 TessArray™ Phenotypic detection Genotypic detection and identification and identification Mainly single result per test Multiple results per one test Multiple signatures per pathogen Detection and confirmation TessArae, LLC, Proprietary Information
  4. 4. RPM Strategy GTATGGTAGTTGAGATAATTAGCTT Probes to interrogate GTATGGTAGTTGCGATAATTAGCTT center position of first complementary target GTATGGTAGTTGGGATAATTAGCTT strand GTATGGTAGTTGTGATAATTAGCTT Target GTATGGTAGTTGGGATAATTAGCTTGATGT CATACCATCAACCCTATTAATCGAACTACA CATACCATCAACACTATTAATCGAA Probes to interrogate CATACCATCAACCCTATTAATCGAA center position of second complementary target CATACCATCAACGCTATTAATCGAA strand CATACCATCAACTCTATTAATCGAA 25-base window of 8 transducers Hemagglutinin A/Goose/Guangdong/1/96/H5N1 TessArae, LLC, Proprietary Information
  5. 5. RPM Strategy GTATGGTAGTTGGAATAATTAGCTTG GTATGGTAGTTGGCATAATTAGCTTG GTATGGTAGTTGGGATAATTAGCTTG GTATGGTAGTTGGTATAATTAGCTTG GTATGGTAGTTGGGATAATTAGCTTGATGT CATACCATCAACCCTATTAATCGAACTACA CATACCATCAACCATATTAATCGAAC CATACCATCAACCCTATTAATCGAAC CATACCATCAACCGTATTAATCGAAC CATACCATCAACCTTATTAATCGAAC Hemagglutinin A/Goose/Guangdong/1/96/H5N1 TessArae, LLC, Proprietary Information
  6. 6. RPM Strategy GTATGGTAGTTGGGATAATTAGCTTGA GTATGGTAGTTGGGCTAATTAGCTTGA GTATGGTAGTTGGGGTAATTAGCTTGA GTATGGTAGTTGGGTTAATTAGCTTGA GTATGGTAGTTGGGATAATTAGCTTGATGT CATACCATCAACCCTATTAATCGAACTACA CATACCATCAACCCAATTAATCGAACT CATACCATCAACCCCATTAATCGAACT CATACCATCAACCCGATTAATCGAACT CATACCATCAACCCTATTAATCGAACT Hemagglutinin A/Goose/Guangdong/1/96/H5N1 TessArae, LLC, Proprietary Information
  7. 7. Influenza A HA1 Coronavirus (229E) Influenza A HA2 Coronavirus (OC43) Influenza A HA3 Coronavirus (NL63) Influenza A HA4 Coronavirus (SARS Urbani) TessArray® Influenza A HA5 Influenza A HA6 Cytomegalovirus (HHV-5) Enteroviruses: Influenza A HA7 • Coxsackievirus (5 types) RPM-Flu 3.1 Influenza A HA8 Influenza A HA9 • Echovirus (8 types) • Rhinovirus (27 types) TessArae, LLC Influenza A HA10 Measles Virus TessArray RPM-Flu v3.1 Respiratory Pathogen Panel Influenza A HA11 Metapneumovirus (types A, B) P/N: 520-191 Influenza A HA12 Parainfluenza 1 Influenza A HA13 Parainfluenza 2 Influenza A HA14 Parainfluenza 3 Influenza A HA15 Parainfluenza 4a Influenza A HA16 Parainfluenza 4b RSV A Influenza A NA1 RSV B Influenza A NA2 Rubella Virus TessArray™ Influenza A NA3 Influenza A NA4 Bordatella pertussis Influenza A NA5 Corynebacterium diphtheriae Influenza A NA6 Chlamydia psittaci Simultaneous differential diagnosis Influenza A NA7 Chlamydia trachomatis Influenza A NA8 Chlamydophila pneumoniae of influenza-like illness Influenza A NA9 Haemophilus influenzae Influenza A Mtx Klebsiella pneumoniae 30 different types of viral and Influenza A NS Legionella pneumophila Influenza A PB2 Moraxella catarrhalis bacterial respiratory pathogens Influenza B HA1 Mycobacterium kansasii Influenza B HA2 Mycobacterium tuberculosis 938,032 oligonucleotide probes Influenza B NA1 Mycoplasma pneumoniae Neisseria meningitidis Influenza B Mtx Pseudomonas aeruginosa 117,254 nucleotides of targeted Staphylococcus aureus Adenovirus B Streptococcus agalactiae pathogen gene sequences per assay Adenovirus C Streptococcus pneumoniae Adenovirus D Streptococcus pyogenes Adenovirus E Variola major Bacillus anthracis Francisella tularensis Yersinia pestis TessArae, LLC, Proprietary Information
  8. 8. How the RPM Assay Works?  Control Template Live Influenza Vaccine (FluMist® 2004-2005)  Trivalent mixture of different influenza virus A/HN and B subtypes  A/Canterbury/20/1999 (H1N1)  A/Wyoming/3/2003 (H3N2)  B/Jilin/20/2003  Hemagglutinin and Neuraminidase Genes from these Vaccine Strains  Engineered by Reassortment with Cold-Adapted Master Strains  A/Ann Arbor/6/1960 (H2N2)  B/Ann Arbor/1/1966  Matrix and Other Viral Genes from Master Strains TessArae, LLC, Proprietary Information
  9. 9. Background Chip Segment Translation Key: Tile T C GA T G C A TGGAAAATGAAAGGACTTTGGATTTCCATGACTCCAATGTGAAGA Influenza A Virus segment 4 hemagglutinin (HA1) TessArae, LLC, Proprietary Information
  10. 10. >EV70UTR:NRL_KB_FluVaccine_082206 Start=12 End=707 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnncnannnnnngnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnng nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnncnnngnnnnnnnnnnnnn Enterovirus 70 UTR nnnnnnnnnnnnnnnnnnnnnnnnngnnnnntnnnnnnnnnnnnnnnncncnnnnnnnnnncnnnnnnnnnnnnnnnnnt nnnnnnnnnnntnngancnnnnngnnnnnnnnnnccnnnngnnnnnnnnnnnnnnnnnnggnnnnnnnnnnnncnnnnnn Negative nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnn >FLUAHA1:NRL_KB_FluVaccine_082206 Start=12 End=1487 agaagaatgtgacagngncncactctgtcaacctacttgaggacagtcacaatggaaaactatgtctactaaaaggaata gccccncnnnnnntgggtaattgcagcgttgccggatggatcttaggaaacccagaatgcgaattactgatttccaagga atcatggtcctacattgtagaaacaccaaatcctgagaatggaacatgttacccagggtatttcgccgactatgaggaac tgagggagcaattgagttcagtatcttcatttgagagattcgaaatattccccaaagaaagctcatggcccaaccacacc gtaaccggagtatcagcatcatgcncccnnnnngggaaaagcagtttttacagaaatttgctatggcngncnnnnnngaa tggnnnnnnnccaaacctgagcaagtcctatgtaaacaacaaagagaaagaagtccttgtactatgggcnntncntcacc cgcctaacanagggaaccaaagggccctctatcatacagaaaatgcttatgtctctgtagtgtcttcacattatagcaga agattcaccccagaaatagccaaaagacccaaagtaagagatcaggaaggaagaatcaactactactggactctgcngga acctggggatacaataatatttgaggcaaatggaaatctaatagcgccatggtatgcttttgcactgagtagaggctttg Type A Flu - HA1 gatcaggaatcatcacctcaaatgcaccaatggatgaatgtgatgcgaagtgtcaaacacctcagggagctataaacagc Positive agtcttcctttccagaatgtacacccagtcacaataggagagtgtccaaagtatgtcaggagtgcaaaatnaaggatggn tacaggactaaggaacatcccntccattcaatccagaggtttgtttggagccattgccggtttcattgaagnnnngtgga ctggaatggtagatgggtggtatggttatcatcatcagaatgagcaaggatcnggnnnnnnnncagatcaaaaaagtnca caaaatgccattaacgggattacaaacaaggtgannnnnnnnnnnnagaaaatgaacactcaattcacngcngtgggcaa agaattcaacaaattggaaagaaggatggaaaacttaaataaaaaagttgatgatgggtttctagacatttggannnnnn nnncagaattgttggttctacTGGAAAATGAAAGGACTTTGGATTTCCATGACTCCAATGTGAAGAatctgtatgagaaa gtaaaaagccaattaaagaataatgccaaagaaataggaaacgggtgttttgaattctatcacaagtgtaacaatgaatg catggagagtgtgaaaaatggaacttatgactatccaaaatattccgaagaatcaaagttaaacagggagaaaattgatg gagtgaaattggaatcaatgggagtctatcagattc >FLUAHA10:NRL_KB_FluVaccine_082206 Start=12 End=787 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnngnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnngnnnnncnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn Type A Flu - HA10 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnannnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnn Negative nnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnncaggaangagnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nggnnnnnntnnnangnaggnnggnngnnnnnnnnnnnnnnnnnnncnnnnnnnnn… TessArae, LLC, Proprietary Information
  11. 11. How to Identify a Novel Pathogen? TessArae, LLC, Proprietary Information
  12. 12. RPM Detection of Novel Strains Old Strain New Strain TGGTAGTTGGGAAAATTAGCTTGAT Forward TGGTAGTTGGGAAAATTAGCTTGAT TGGTAGTTGGGACAATTAGCTTGAT strand TGGTAGTTGGGACAATTAGCTTGAT sequence TGGTAGTTGGGAGAATTAGCTTGAT TGGTAGTTGGGAGAATTAGCTTGAT variant TGGTAGTTGGGATAATTAGCTTGAT detection TGGTAGTTGGGATAATTAGCTTGAT CATACCATCAACCCTATTAATCGAACTACAGC target CATACCATCAACCCTGTTAATCGAACTACAGC GTATGGTAGTTGGGATAATTAGCTTGATGTCG GTATGGTAGTTGGGACAATTAGCTTGATGTCG ACCATCAACCCTATTAATCGAACTA Reverse ACCATCAACCCTATTAATCGAACTA ACCATCAACCCTCTTAATCGAACTA strand ACCATCAACCCTCTTAATCGAACTA ACCATCAACCCTGTTAATCGAACTA sequence ACCATCAACCCTGTTAATCGAACTA ACCATCAACCCTTTTAATCGAACTA variant ACCATCAACCCTTTTAATCGAACTA detection TessArae, LLC, Proprietary Information
  13. 13. Detection of Novel Strains TessArae, LLC, Proprietary Information
  14. 14. Novel H1N1 Influenza Detection TessArae, LLC, Proprietary Information
  15. 15. Detecting Seasonal Strains of Influenza RPM-Detector Tiles for Seasonal A/H1N1 and Seasonal A/H3N2 Influenza Viruse s Vir u s Target Gen e Detector Tile Sequence/Strai n Leng t h Prob e s A/H1 N 1 Hemagglutinin(A/HA1 ) A/New Caledonia/20/1999(H1N1) 1500 bp 12,000 A/H1 N 1 Neuraminidase(A/N A 1 ) A/New Caledonia/20/1999(H1N1) 1200 bp 9,600 A/H1 N 1 Matrix(A/H1N1-M ) A/Canterbury/100/2000(H1N1) 850 bp 6,800 A/H3 N 2 Hemagglutinin(A/HA3 ) A/Canterbury /125/2005(H3 N 2 ) 1500 bp 12,000 A/H3 N 2 Neuraminidase(A/N A 2 ) A/Canterbury /125/2005(H3 N 2 ) 1200 bp 9,600 A/H3 N 2 Matrix(A/H3N2-M ) A/Canterbury /125/2005(H3 N 2 ) 850 bp 6,800 TessArae, LLC, Proprietary Information
  16. 16. A Sentinel Case April 2009:  Patient presents at Washington, DC hospital  Recently returned from vacation in Mexico  Convalescing from recent flu-like illness  Anxious about reports of novel influenza outbreak TessArray Outcomes: 01 May 2009 - Best Matches L20309, X90504 H influenzae outer membrane protein P5 A/duck/Guanxi/2004(H5N1); A/chicken/Yogjakarta/2004(H5N1) Very unusual result suggested patient had been infected by an avian influenza virus Database updated following week, new sequence records from Mexico outbreak isolates 05 May 2009 - Best Matches L20309, X90504 H influenzae outer membrane protein P5 A/California/07/2009(H1N1); A/Texas/04/2009(H1N1) Perfect Match to New CDC Strain! From a Test Designed in 2006 With No Prior Knowledge of New Strain TessArae, LLC, Proprietary Information
  17. 17. T S R A - A ML_CNMC_01_050109 (“RPM-Flu Sentinel Case”) Best Matches from VSRD Archive Best Matches from VSRD Archive Updated November 2008 Updated May 2009 A/chicken/Indonesia/7/2003(H5N1) A/chicken/Puebla/231-5284/98(H5N2) A/chicken/Puebla/231-5284/98 (H5N2) A/chicken/Yogjakarta/BBVet-IX/2004(H5N1) A/duck/Guangxi/1436/2006(H5N1) A/duck/Guangxi/351/2004(H5N1) A/duck/Guangxi/3548/2005(H5N1) A/duck/Guangxi/380/2004(H5N1) A/duck/Guangxi/4016/2005(H5N1) A/hooded vulture/Burkina Faso/2/2006(H5N1) A/mallard/Alberta/111/99(H4N6) A/mallard/Alberta/111/99(H4N6) A/mallard/Maryland/1235/2006(H3N6) A/mallard/Maryland/1235/2006(H3N6) A/quail/Tasikmalaya/BPPV4/2004(H5N1) A/swine/Hong Kong/1197/02(H3N2) A/swine/Hong Kong/1197/02(H3N2) A/swine/Iowa/930/01(H1N2) A/swine/Virginia/670/1987(H1N1) A/swine/Virginia/671/1987(H1N1) A/swine/British Columbia/28103/2005(H3N2) A/California/04/2009(H1N1) A/California/05/2009(H1N1) A/California/06/2009(H1N1) A/California/07/2009(H1N1) RPM detection and identification works for A/California/08/2009(H1N1) A/California/09/2009(H1N1) A/California/10/2009(H1N1) strains and variants A/California/14/2009(H1N1) A/Canada-ON/RV1527/2009(H1N1) that share at least 80% sequence similarity to A/New York/06/2009(H1N1) A/New York/10/2009(H1N1) array detector tiles A/New York/11/2009(H1N1) A/New York/15/2009(H1N1) A/New York/18/2009(H1N1) A/New York/19/2009(H1N1) A/New York/20/2009(H1N1) A/New York/22/2009(H1N1) A/Ohio/07/2009(H1N1) A/Texas/04/2009(H1N1) A/Texas/05/2009(H1N1) 190/215 = 88% The RPM-Flu 3.1 designed for A/H5N1 in 2006 is capable to sensitively detect and differentiate the Novel A/H1N1 SOIV from Seasonal A/H1N1 and Seasonal A/H3N2 subtypes without modification TessArae, LLC, Proprietary Information
  18. 18. Avian A/H5N1 matrix gene resequencing detector tile sequence (top sequence) 2009 Novel H1N1 (A/Pensacola/INS107/200 9(H1N1)) strain (middle sequence) Sequence from a high titer stock of a 2009 Novel H1N1 outbreak strain strain, A/NHRC- California/BRD_40116(H1N1) (bottom sequence) Legend: “x” = Mismatch “|” = Match TessArae, LLC, Proprietary Information
  19. 19. Analytical Sensitivity with Cultured Influenza Virus Seasonal H1N1 Seasonal H3N2 Novel H1N1 LoD (95%) TCID50/ml TessArray RPM-Flu CDC rRT-PCR (JBAIDS)  Novel A/H1N1 1,740  Novel A/H1N1 5,000  Seasonal A/H1N1 102  Seasonal A/H1N1 10  Seasonal A/H3N2 224  Seasonal A/H3N2 100 TessArae, LLC, Proprietary Information
  20. 20. Analytical Sensitivity Cultured Influenza Virus Seasonal Seasonal 2009 Novel Controls A/H1N1 A/H3N2 A/H1N1 SOIV Endpoint LoD Titration Seasonal A/H1N1 38/38 (100%) 0/41 (0%) 0/41 (0%) Seasonal A/H3N2 0/58 (0%) 44/44 (100%) 0/58 (0%) 2009 Novel A/H1N1(SOIV) 0/55 (0%) 0/55 (0%) 44/44 (100%) Positive Clinical Specimens Seasonal A/H1N1 13/13 (100%) 0/13 (0%) 0/13 (0%) Seasonal A/H3N2 0/31 (0%) 31/31 (100%) 0/31 (0%) 2009 Novel A/H1N1(SOIV) 0/8 (0%) 0/8 (0%) 8/8 (100%) Negative Controls Avian A/H5N1-positive 0/16 (0%) 0/16 (0%) 0/16 (0%) Other High Load Pathogens 0/24 (0%) 0/24 (0%) 0/24 (0%) Water Blanks 0/14 (0%) 0/14 (0%) 0/14 (0%) Clinical Negative by PCR 0/501 (0%) 0/501 (0%) 0/501 (0%) TessArae, LLC, Proprietary Information
  21. 21. Detecting Emergent Strains What’s on the Device: 2004-5 FluMist A/New Caledonia/20/1999(H1N1) Hemagglutinin A/New Caledonia/20/1999(H1N1) A/New Caledonia/20/1999(H1N1) Neuraminidase A/New Caledonia/20/1999(H1N1) A/Canterbury/100/2000(H1N1) Matrix A/Ann Arbor/6/1960(H2N2) A/Canterbury/125/2005 (H3N2) Hemagglutinin A/Wyoming/03/2003 (H3N2) A/Canterbury/125/2005 (H3N2) Neuraminidase A/Wyoming/03/2003 (H3N2) A/Canterbury/125/2005 (H3N2) Matrix A/Ann Arbor/6/1960(H2N2) What it Told Us: 2009-10 FluMist A/South Dakota/6/2007(H1N1) A/South Dakota/6/2007(H1N1) A/Ann Arbor/6/1960(H2N2) A/Uruguay/716/2007 (H3N2) TessArae, LLC A/Uruguay/716/2007 (H3N2) TessArray RPM-Flu v3.1 Respiratory Pathogen Panel A/Ann Arbor/6/1960(H2N2) P/N: 520-191 2006-7 FluZone A/New Caledonia/20/1999(H1N1) A/New Caledonia/20/1999(H1N1) A/Puerto Rico/8/1934(H1N1) A/Wisconsin/67/2005 (H3N2) TessArray™ A/Wisconsin/67/2005 (H3N2) A/Puerto Rico/8/1934(H1N1) 2009-10 FluVirin When Confronted With Different A/South Dakota/6/2007(H1N1) Strains the Array Still Tells Us A/South Dakota/6/2007(H1N1) A/Puerto Rico/8/1934(H1N1) What Is Present Based on the A/Uruguay/716/2007 (H3N2) A/Uruguay/716/2007 (H3N2) Sequences of the Organisms A/Puerto Rico/8/1934(H1N1) TessArae, LLC, Proprietary Information
  22. 22. Avian Influenza Subtypes: Differential Diagnostics Specimens from USDA ARS SEPRL reference archive (20 Mar 08) Sample RPM Assay Match SEPRL Reference Strain 1 H1N1 H1N1 A/Turkey/Kansas/4880/80 2 H2N8 H2N8 A/Herring Gull/DE/677/88 3 H3N2 H3N2 A/turkey/MN/366767/2005 4 H4N6 H4N6 A/Blue Winged Teal/LA/240B/88 6 H7N2 H7N2 A/quail/PA/20304/98 7 H8N4 H8N4 A/turkey/CO/169118-13/02 9 H10N7 H10N7 A/quail/NJ/25254-22/95 10 H11N3 H11N3 A/chicken/NJ/4645/96 11 H12N5 H12N5 A/duck/LA/188D/87 12 H13N6 H13N6 A/gull/MD/1824/78 13 AMPV, No AI AMPV, No AI Avian Metapneumovirus (Colorado Strain) 14 H5N3 H5N3 A/duck/Singapore/F119/97 15 H7N3 H7N3 A/chicken/Chile(F0)/176822/02 16 No AI No AI Avian Paramyxovirus I (NDV, RPM-TEI assay) 17 H5N2 H5N2 A/chicken/Mex/26654-1374/94 18 H7N1 H7N1 A/turkey/Italy/4580/99 19 H7N3 H7N3 A/chicken/Pakistan/1369-CR2/95 20 H7N7 H7N7 A/chicken/Victoria/85 21 H14N5 H14N5 A/mallard/Gurjev/263/82 22 H15N9 H15N9 A/Shearwater/W. Australia/2576/79 TessArae, LLC, Proprietary Information
  23. 23. Avian Influenza Subtypes: Differential Diagnostics Reconciliation of Inter-Platform Results Discrepancies by de novo DNA Sequencing of Viral Genes from Original Specimens CDC-Certified Ibis-T5000 HA RSLT (P1) TessArray® Gold Standard Sample ID H5 (Asian) PCR ESI-MS RPM-Flu v3.1 DNA Sequencing 2006900845 H5 H5N1 H5 H5N1 not tested 2006906089 H5 H5N1 H5 H5N1 not tested 2006900590 H5 H5N1 H5 H5N1 not tested 2006902838 H5 H5N1 H5 H5N1 not tested 2006902764 not tested H5N1 H5 H5N1 H5N1 2006905588 Flu UNKNOWN H7 H7N7 H7N7 2004909864 not tested H9N2 UNKNOWN H7N7 H7 2005912823 Flu H7N7 UNKNOWN H10N7 H10N7 2005912908 not tested H7N7 H10 H10N7 H10N7 2004900600 Flu H7N7 H10 H10N7 H10N7 2004900845 H5 H5N1 H10 H10N7 or H10N5 H10N7 2004900688 not tested H7N7 H11 H11N? H11 2005912306 Flu NEW UNKNOWN H13N6 or H13N8 H13 Lin et al PLOS 2009 = Conflict with de novo sequencing results = Results concordant with de novo sequencing TessArae, LLC, Proprietary Information
  24. 24. Longitudinal Data Analysis CT_Healthy_Control_080508 CT_Sick_Day4_080603 Metapneumovirus CT_Sick_050509 Rhinovirus But not the novel A/H1N1! CT_Sick_042010 Parainfluenza Virus TessArae, LLC, Proprietary Information
  25. 25. MLST-like Epidemiological Analysis: Genomic diversity of Haemophilus influenzae from 50 Different Patients at MCRD San Diego TessArae, LLC, Proprietary Information
  26. 26. MLST-Like Epidemiological Analysis: Clonal genomic uniformity of Adenovirus Type 4 in Same 50 Patients at MCRD San Diego TessArae, LLC, Proprietary Information
  27. 27. Summary  Real-time Epidemic/Pandemic Surveillance in Human and Animal Populations  Simultaneous Detection and Definitive Identification of Multiple Pathogens  Characterization of Difficult Cases  Superior to Benchmark Platform Sensitivity and Specificity  Limits of Detection ~ 102 Genome Equivalents/specimen  Zero False Positive Detection Events  Immediate Identification of Known and Unknown Strains and Variants  Surveillance of Shift and Drift in Populations  Same Day Results  RPM Sequence-based Detector Array  Six Sigma Data Quality  Basecall Error Rate ≥ 10-6 TessArae, LLC, Proprietary Information
  28. 28. Acknowledgements TessArae, LLC - Potomac Falls, VA Clark Tibbetts Brian Weslowski Leah Morris Matthew Lorence Lisa Borsuk Klaus Schafer Naval Health Research Center/Naval Respiratory Disease Laboratory, San Diego, CA David Metzgar Chris Myers Christian Hansen CDR Kevin Russell Jason Brown Larivhie Dela Cruz CDR Dennis Faix Miguel Osuna David Ortiz Naval Research Laboratory/Center for Bio/Molecular Science and Engineering - Washington, DC Joel Schnur Anthony Malanoski Nina Long David Stenger Baochuan Lin Carolyn Kidd Zheng Wang Dzung Thach Kate Blaney TessArae, LLC, Proprietary Information

×