Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Point Mutations
Presented by:
Muzhar Ali
Ali raza 4029
¤ Introduction of mutations
¤ Types of mutations
¤ Chromosomal mutation
¤ Point mutation
¤ Types of point mutations
¤ Caus...
What Are Mutations?
• Changes in the
nucleotide sequence of
• May occur in somatic
cells (aren’t passed to
Types of Mutations
Chromosome Mutations
• May Involve:
• Changing in the number of
chromosomes Lose or se
gain of chromosomes e.g.
• Down’s s...
Chromosome Mutations
• Down Syndrome
– Chromosome 21 does not separate
– They have 47 chromosomes in
stead of 4...
Chromosome Mutations
• Due to change in structure.
Chromosome Mutation
Point Mutation
• Change of a single
• Includes the deletion,
insertion, or substitution
of ONE nucleotide in a
–Point Mutations
– Base Substitution
–Silent mutation
– Sense mutation
–Nonsense mutation
Mutations: Substitutions
Substitution mutation
Substitutions will ...
Point Mutations
• Silent mutation = no change to protein
Point Mutation
• Sickle Cell disease is
the result of one
• Occurs in the
hemoglobin gene
Fig 4.4
Point Mutations
• Missense mutation = changes amino acid
Sickle cell anemia
• Hemoglobin protein in red blood cells
– strikes 1 out of 400 African Americans
– limits activity, pai...
Point Mutations
• Nonsense mutation = change to STOP
Frameshift Mutations
• Add or delete one or more bases
– changes the meaning of the whole protein
Frameshift Mutations
• Addition = add one or more bases
Frameshift Mutations
• Deletion = lose one or more bases
Gene Mutation Animation
Causes of Mutations
• Chemical cause the mutations are called
Mutagens. like
• Ionizing radiation
• Alpha, beta, gamma and...
Example of chemical mutations
Mrs Smith: Ch13: Mutations an
Chromosomal Abnormalities
Types of mutations
Types of mutations
Types of mutations
Types of mutations
Types of mutations
Types of mutations
Types of mutations
Types of mutations
Upcoming SlideShare
Loading in …5

Types of mutations

point mutation

  • Be the first to comment

Types of mutations

  1. 1. Point Mutations
  2. 2. Presented by: Muzhar Ali 4028 Ali raza 4029
  3. 3. Presented To: DR.M.Javed Iqbal Siddiqui
  4. 4. ¤ Introduction of mutations ¤ Types of mutations ¤ Chromosomal mutation ¤ Point mutation ¤ Types of point mutations ¤ Causes of mutations Contents
  5. 5. What Are Mutations? • Changes in the nucleotide sequence of DNA • May occur in somatic cells (aren’t passed to offspring) • May occur in gametes (eggs & sperm) and be passed to offspring
  6. 6. Types of Mutations
  7. 7. Chromosome Mutations • May Involve: • Changing in the number of chromosomes Lose or se gain of chromosomes e.g. • Down’s syndrome . • Change in the structure of chromosomes –gfgfgfggfgfgfgfghgfgvggfff
  8. 8. Chromosome Mutations • Down Syndrome – Chromosome 21 does not separate correctly. – They have 47 chromosomes in stead of 46. – Children with Down Syndrome develop slower, may have heart and stomach illnesses and vary greatly in their degree of inteligence.
  9. 9. Chromosome Mutations • Due to change in structure. –Deletion –Inversion –Translocation –Nondisjunction –Duplication
  10. 10. Chromosome Mutation Animation
  11. 11. Point Mutation • Change of a single nucleotide • Includes the deletion, insertion, or substitution of ONE nucleotide in a gene
  12. 12. –Point Mutations – Base Substitution –Silent mutation – Sense mutation –Nonsense mutation
  13. 13. Mutations: Substitutions Substitution mutation GGTCACCTCACGCCA ↓ CCAGUGGAGUGCGGU ↓ Pro-Arg-Glu-Cys-Gly Substitutions will only affect a single codon Their effects may not be serious unless they affect an amino acid that is essential for the structure and function of the finished protein molecule (e.g. sickle cell anaemia) Normal gene GGTCTCCTCACGCCA ↓ CCAGAGGAGUGCGGU Codons ↓ Pro-Glu-Glu-Cys-Gly Amino acids © 2010 Paul Billiet ODWS
  14. 14. Point Mutations • Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop
  15. 15. Point Mutation • Sickle Cell disease is the result of one nucleotide substitution • Occurs in the hemoglobin gene
  16. 16. Fig 4.4
  17. 17. Point Mutations • Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop
  18. 18. Sickle cell anemia • Hemoglobin protein in red blood cells – strikes 1 out of 400 African Americans – limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids
  19. 19. Point Mutations • Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop Really destroyed that protein!
  20. 20. Frameshift Mutations • Add or delete one or more bases – changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR Add one!Delete one! Does this change the sentence? A LOT!
  21. 21. Frameshift Mutations • Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA
  22. 22. Frameshift Mutations • Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA
  23. 23. Gene Mutation Animation
  24. 24. Causes of Mutations • Chemical cause the mutations are called Mutagens. like • Ionizing radiation • Alpha, beta, gamma and cosmic rays. • Nonionizing radiation • Uv light, • Chemical mutagens • Nitrous acid, Hydroxylamine
  25. 25. Example of chemical mutations 30/10/2015 Mrs Smith: Ch13: Mutations an Chromosomal Abnormalities 31
