<ul><li>Bioinformatica :  recopilación y almacenamiento de información biológica </li></ul><ul><li>(AND/ARN) proteina </li...
Source: http://ccb.wustl.edu/ ¿Que es Bioinformática/  Biología Computacional?
<ul><li>No se busca la solución “exacta” sino la biológicamente relevante </li></ul><ul><ul><li>No interesan los mínimos g...
<ul><li>Es prioritario analizar  conjuntos de soluciones quasi-óptimas , en lugar de únicamente la óptima. </li></ul><ul><...
<ul><li>Oferta/Demanda: Hay muy poca gente con una formación adecuada en biología e informática </li></ul><ul><li>Los proy...
Evolution Genetics Gregor Mendel  (1822-1884) Charles Darwin  (1807-1882) Discovery of nuclein  Friedrich Miescher (1844-1...
H. influenzae 1.8  Mbp (1995) S. cerevisiae 12  Mbp (1997) C. elegans 100  Mbp (1998) Drosophila 180  Mbp (2000) H. sapien...
Number of Entries in EMBL Database June 2002:  23.860.228.282 Bases ;  17.807.526  Entries Un poco de Historia Source HUSAR
15 February 2001 Un poco de Historia Secuenciacion completa del genoma  humano <ul><li>It is small </li></ul><ul><li>It is...
Comparación de genomas ORGANISM CHROMOSOMES GENOME SIZE GENES Homo sapiens  (Humans) 23 3,200,000,000 ~ 30,000 Mus   muscu...
46 La complejidad del genoma NO se correlaciona con el número cromosomas 250 Lysandra atlantica Ophioglossum  reticulatum ...
La complejidad del genoma NO se correlaciona con su tamaño Homo sapiens 3,4 x 10  9  bp Amoeba dubia 6,7 x 10  11  bp
La complejidad del genoma NO se correlaciona con el número de genes ~31,000 genes ~26,000 genes ~50,000 genes
CHIMP GENOME   Chimpanzees are similar to humans in so many ways: they are socially complex, sensitive and communicative, ...
From Olson and Varki (2002) Nat Rev Gen 4: 20-28 Humanos  vs  Primates Homo sapiens y Pan troglodytes (Orangutan)     99....
Dogma Central de  la Biología Molecular The central dogma states that once “information” has passed into protein, it canno...
<ul><li>El dogma:   </li></ul><ul><ul><li>No se puede aplicar a todas las funciones biológicas. </li></ul></ul><ul><li>Los...
<ul><li>Células </li></ul><ul><li>ADN (DNA) </li></ul><ul><li>ARN (RNA) </li></ul><ul><li>Amino Acidos (AA) </li></ul><ul>...
<ul><li>Sistema complejo envuelto en una membrana </li></ul><ul><li>Los organismos pueden ser unicelulares (bacteria, leva...
<ul><li>Eucariotas : tienen una membrana nuclear y orgánulos (plantas, animales, hongos,…) </li></ul>Biología Molecular: P...
GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGG...
Image source:  www.biotec.or.th/Genome/whatGenome.html   ¿Que es el ADN? <ul><li>DNA: Deoxyribonucleic Acid (ácido dexosir...
<ul><li>Bases nitrogenadas </li></ul><ul><li>Purinas (A and G) </li></ul><ul><li>Pirimidinas (C and T) </li></ul><ul><li>U...
<ul><li>Los cuatro nucleótidos pueden unirse mediante fosfatos para formar cadenas de nucleótidos </li></ul><ul><li>Los fi...
El ADN en realidad está formado por dos cadenas  Doble hebra de ADN Las cadenas avanzan en sentido opuesto  y que están li...
<ul><li>La doble hélice es la estructura más estable del ADN. </li></ul>Image source;  www.ebi.ac.uk/microarray /  biology...
<ul><li>RNA can be: </li></ul><ul><ul><li>Hebra simple </li></ul></ul><ul><ul><li>Hebra doble </li></ul></ul><ul><ul><li>H...
<ul><li>ARN mensajero (mRNA) </li></ul><ul><ul><li>Contiene la información para construir una proteina. </li></ul></ul><ul...
<ul><li>Molécula linear que contiene información genética copiada del AND. Tiene regiones codificadoras y regiones no codi...
ARN transferente Tienen una estructura tridimensional muy bien definida Juega un papel crítico en la sintesis de proteinas...
ARN ribosomal Componente mayoritario de los ribosomas Los ribosomas llevan a cabo la síntesis de proteínas asociándose con...
<ul><li>4 nucleótidos posibles (A, C, G, U) </li></ul><ul><li>Un codón tiene 3 bases </li></ul><ul><li>4 * 4 * 4 = 64 codo...
<ul><li>Todos los organismos usan el mismo código genético </li></ul><ul><li>Un amino ácido esta codificado por 3 nucleóti...
<ul><li>Solo existen 20 amino acidos  – pero 64 codones posibles  </li></ul>Redundancia del Código genético
<ul><li>Elementos constitutivos de las proteinas   (20 different) </li></ul><ul><li>Tienen un grupo radical variable que l...
Los ARNm se pueden leer en tres diferentes marcos de lectura, pero solo uno de ellos codifica la proteína correcta Código ...
Proteínas Los aa se unen mediante enlaces peptídicos entre el grupo  carboxilo terminal de un aa y el grupo amino de otro....
Proteínas Estructura secundaria:   producto del establecimiento de puentes de hidrógeno entre distintos átomos de los aa  ...
Proteínas Estructura secundaria:   producto del establecimiento de puentes de hidrógeno entre distintos átomos de los aa  ...
Proteínas Estructura terciaria:   Es la forma global de cada proteína. Depende de las interacciones entre los grupos radic...
Proteínas Estructura cuaternaria:   Es propia de las proteínas globulares y es la conformación tridimensional de la unión ...
Volvemos al principio… “ El dogma central” ADN ARN Proteína Trascripción Translación Traducción
Upcoming SlideShare
Loading in …5
×

Introduccion3 bc

1,109 views

Published on

diapositivas que nos ayudaran a l mejor entendimiento de la genetica

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,109
On SlideShare
0
From Embeds
0
Number of Embeds
12
Actions
Shares
0
Downloads
16
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • Desarrollo de Bases de datos, algoritmos para el analisis de datos moleculares: identificacion, transformacion, modelado y prediccion Desarrollo de programas para estos fines
  • Erst sehr viel später entsetzte Darwin seine Zeitgenossen mit “The origin of species” . Er formuliert in diesem Werk eine Evolutionstheorie, die auch schon andere Vordenker (z.B. Thomas Malthus) postuliert hatten. Alle Arten haben gemeinsamen Vorfahren und haben sich, da sie verschiedene ökologische Nischen besiedelten verschieden entwickelt. Ein Zeitgenosse Darwins war Gregor Mendel. Er gilt als Begründer der Genetik oder Vererbungslehre. Mitlerweile weis man, dass er die Ergebnisse seiner Erbsen-Versuche geschönt hat, um seine mendelschen Vererbungsregeln zu beweisen. Trotzdem wird er noch heute verehrt, weil er der erste war, der wissenschaftlicheMethodik anwandte. Exaktes Experimentdesign, eindeutiger Ausgang: ja/nein, Zählen statt ungenaue Beschreibungen. Mitte der 70ger: Entdeckung der Restriktions Enzyme (Alber)
  • jkkj
  • Rise in the mid 90s: mostly due to ESTs (expressed sequence tags). Late 90s: rise mostly due to large genomic fragments: geneprediction becomes more &amp; more essential.
  • Perhaps not surprising!!!
  • No olvidar contar que las bases son perpendiculares a los fosfatos, que los fosfatos estan en el exterior y las bases en el interior , centro hidrofóbico y exterior cargado negativamente.
  • Introduccion3 bc

    1. 1. <ul><li>Bioinformatica : recopilación y almacenamiento de información biológica </li></ul><ul><li>(AND/ARN) proteina </li></ul><ul><li>Biología computacional: El desarrollo de algoritmos y métodos estadísticos para el análisis de datos biológicos. </li></ul><ul><li>Aunque en concepto son diferentes, los términos Bioinformática y Biología computacional se usan indistintamente. </li></ul>¿Que es Bioinformática/ Biología Computacional?
    2. 2. Source: http://ccb.wustl.edu/ ¿Que es Bioinformática/ Biología Computacional?
    3. 3. <ul><li>No se busca la solución “exacta” sino la biológicamente relevante </li></ul><ul><ul><li>No interesan los mínimos globales porque la función de costo es heurísitca y puede tener mínimos irrelevantes. </li></ul></ul><ul><ul><li>Se introduce la noción de significado biológico de una solución óptima o quasi-óptima desde el punto de vista matemático </li></ul></ul><ul><li>La definición del problema es imprecisa (entre otras cosas por falta de conocimiento) </li></ul>¿Que es diferente en BC?
    4. 4. <ul><li>Es prioritario analizar conjuntos de soluciones quasi-óptimas , en lugar de únicamente la óptima. </li></ul><ul><li>La validación experimental de los algoritmos tiene precedencia sobre el análisis matemático. </li></ul><ul><li>La definición del modelo es la parte mas relevante de la resolución del problema. </li></ul><ul><li>Bioinformática =/= Biología + Computación </li></ul>¿Que es diferente en BC?
    5. 5. <ul><li>Oferta/Demanda: Hay muy poca gente con una formación adecuada en biología e informática </li></ul><ul><li>Los proyectos de secuenciación genómica, análisis en microchips (microarrays), proteómica, metabolómica, etc.… estan produciendo enormes cantidades de datos que tienen que ser analizados. </li></ul><ul><li>Ahorra gran cantidad de tiempo y dinero </li></ul>¿Porqué está de actualidad la BC?
    6. 6. Evolution Genetics Gregor Mendel (1822-1884) Charles Darwin (1807-1882) Discovery of nuclein Friedrich Miescher (1844-1895) DNA is the genetic material Hershey-Chase Molecular structure of DNA Chargaff, 1962 Nobel Prize James Watson, Francis Crick Recombinant DNA, DNA sequencing 1980 Nobel Prize Walter Gilbert, Frederick Sanger, Paul Berg Amplification of DNA (PCR) Kary Mullis & others, 1993 Nobel Prize 1869 1952 1953 1970 1983 Un poco de Historia Classification in biology Carl von Linne (1707-1778)
    7. 7. H. influenzae 1.8 Mbp (1995) S. cerevisiae 12 Mbp (1997) C. elegans 100 Mbp (1998) Drosophila 180 Mbp (2000) H. sapiens 3200 Mbp (2001) Overview: TIGR (The institute of genomic research) http://www.tigr.org/tdb/mdb/mdbcomplete.html http://www.tigr.org/tdb/mdb/mdbinprogress.html Un poco de Historia
    8. 8. Number of Entries in EMBL Database June 2002: 23.860.228.282 Bases ; 17.807.526 Entries Un poco de Historia Source HUSAR
    9. 9. 15 February 2001 Un poco de Historia Secuenciacion completa del genoma humano <ul><li>It is small </li></ul><ul><li>It is empty </li></ul><ul><li>It is unoriginal </li></ul><ul><li>It is repetitive </li></ul>El genoma humano es:
    10. 10. Comparación de genomas ORGANISM CHROMOSOMES GENOME SIZE GENES Homo sapiens (Humans) 23 3,200,000,000 ~ 30,000 Mus musculus (Mouse) 20 2,600,000,000 ~30,000 Drosophila melanogaster (Fruit Fly) 4 180,000,000 ~18,000 Saccharomyces cerevisiae (Yeast) 16 14,000,000 ~6,000 Zea mays (Corn) 10 2,400,000,000 ???
    11. 11. 46 La complejidad del genoma NO se correlaciona con el número cromosomas 250 Lysandra atlantica Ophioglossum reticulatum 1260 Homo sapiens 46
    12. 12. La complejidad del genoma NO se correlaciona con su tamaño Homo sapiens 3,4 x 10 9 bp Amoeba dubia 6,7 x 10 11 bp
    13. 13. La complejidad del genoma NO se correlaciona con el número de genes ~31,000 genes ~26,000 genes ~50,000 genes
    14. 14. CHIMP GENOME Chimpanzees are similar to humans in so many ways: they are socially complex, sensitive and communicative, and yet indisputably on the animal side of the man/beast divide. Scientists have now sequenced the genetic code of our closest living relative, showing the striking concordances and divergences between the two species, and perhaps holding up a mirror to our own humanity. Comparación con genomas mas cercanos
    15. 15. From Olson and Varki (2002) Nat Rev Gen 4: 20-28 Humanos vs Primates Homo sapiens y Pan troglodytes (Orangutan)  99.0% identical Humans are not at all ori g inal in comparison with other vertebrates . La comparación del genoma humano con el de los Primates dio como resultado diferencias de solo el 1% Homo sapiens y Chimpance  99.9 % identical !!!!!
    16. 16. Dogma Central de la Biología Molecular The central dogma states that once “information” has passed into protein, it cannot get out again. The transfer of information from nucleic acid to nucleic acid, or from nucleic acid to protein may be possible, but transfer from protein to protein, or from protein to nucleic acid, is impossible. Information means here the precise determination of sequence, either of bases in the nucleic acid or of amino acid residues in the protein. Francis Crick , 1958 [1] Transcription [2] RNA processing (splicing) [3] RNA export [4] RNA surveillance RNA cDNA Phenotype DNA protein
    17. 17. <ul><li>El dogma: </li></ul><ul><ul><li>No se puede aplicar a todas las funciones biológicas. </li></ul></ul><ul><li>Los procesos celulares implican una gran cantidad </li></ul><ul><li>de productos genicos asi como interacciones entre ellos. </li></ul><ul><ul><li>Los procesos celulares son complejos </li></ul></ul><ul><ul><li>y multidimensionales. </li></ul></ul><ul><ul><li>Condiciones que llaman la atención sobre la </li></ul></ul><ul><ul><li>necesidad de hacer otro tipo de investigación…. </li></ul></ul><ul><ul><li>ahi es donde entra en juego la bioinformatica. </li></ul></ul>Gen Proteina Función Los límites
    18. 18. <ul><li>Células </li></ul><ul><li>ADN (DNA) </li></ul><ul><li>ARN (RNA) </li></ul><ul><li>Amino Acidos (AA) </li></ul><ul><li>Proteinas </li></ul>Biología Molecular: un resumen
    19. 19. <ul><li>Sistema complejo envuelto en una membrana </li></ul><ul><li>Los organismos pueden ser unicelulares (bacteria, levadura) o multicelulares </li></ul><ul><li>Humanos: </li></ul><ul><ul><li>60 trillion células </li></ul></ul><ul><ul><li>320 tipos de células </li></ul></ul>Célula Animal www.ebi.ac.uk/microarray / biology_intro.htm Biología Molecular: Células
    20. 20. <ul><li>Eucariotas : tienen una membrana nuclear y orgánulos (plantas, animales, hongos,…) </li></ul>Biología Molecular: Procariotas Vs Eucariotas <ul><li>Procariotas : no tienen una membrana </li></ul><ul><li>Que separe núcleo y orgánulos (bacteria) </li></ul><ul><li>NO todos los organismos unicelulares son procariotas (levadura) </li></ul>BIOS Scientific Publishers Ltd, 1999
    21. 21. GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGG ¿Que es el ADN? Es un alfabeto de 4 caracteres Este alfabeto de 4 caracteres contiene suficiente información para crear organismos complejos, mediante el uso de largas palabras Similitud con el codigo binario
    22. 22. Image source: www.biotec.or.th/Genome/whatGenome.html ¿Que es el ADN? <ul><li>DNA: Deoxyribonucleic Acid (ácido dexosiribonucleíco) </li></ul><ul><li>4 nucleotidos: </li></ul><ul><ul><li>Adenosina (A) </li></ul></ul><ul><ul><li>Citosina (C) </li></ul></ul><ul><ul><li>Guanina (G) </li></ul></ul><ul><ul><li>Timina (T) </li></ul></ul>
    23. 23. <ul><li>Bases nitrogenadas </li></ul><ul><li>Purinas (A and G) </li></ul><ul><li>Pirimidinas (C and T) </li></ul><ul><li>Un azúcar (deoxiribosa) </li></ul><ul><li>Un fosfato </li></ul>Image Source: www.ebi.ac.uk/microarray / biology_intro.htm Acidos nucleicos El bloque básico necesario es:
    24. 24. <ul><li>Los cuatro nucleótidos pueden unirse mediante fosfatos para formar cadenas de nucleótidos </li></ul><ul><li>Los finales de la hebra son distintos </li></ul><ul><li>Hay direccionalidad en la hebra de ADN </li></ul><ul><li>Por convencion se marca la hebra codificante como 5’ to 3’ </li></ul>http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookDNAMOLGEN.html Polinucleótidos de ADN
    25. 25. El ADN en realidad está formado por dos cadenas Doble hebra de ADN Las cadenas avanzan en sentido opuesto y que están ligadas por enlaces complementarios de bases nitrogenadas : A, T, G y C Eso significa que la segunda cadena es reversa y complementaria La doble hélice tiene siempre una anchura constante porque las purinas se enfrentan siempre a las pirimidinas.
    26. 26. <ul><li>La doble hélice es la estructura más estable del ADN. </li></ul>Image source; www.ebi.ac.uk/microarray / biology_intro.htm 5’ G  T  A  A  A  G  T  C  C  C  G  T  T  A  G  C 3’ | | | | | | | | | | | | | | | | 3’ C  A  T  T  T  C  A  G  G  G  C  A  A  T  C  G 5’ Doble hélice
    27. 27. <ul><li>RNA can be: </li></ul><ul><ul><li>Hebra simple </li></ul></ul><ul><ul><li>Hebra doble </li></ul></ul><ul><ul><li>Hebra hibrida AND-AR </li></ul></ul>Acido Ribonucléico ARN <ul><li>Similar al ADN, el bloque consta de: </li></ul><ul><li>Bases nitrogenadas: A, C, G. </li></ul><ul><li>La Timina (T) se reemplaza </li></ul><ul><li>por un Uracilo (U) </li></ul><ul><li>Un azúcar, en este caso una Ribosa </li></ul><ul><li>Un fosfato </li></ul><ul><ul><li>El RNA puede formar estructuras terciarias </li></ul></ul>
    28. 28. <ul><li>ARN mensajero (mRNA) </li></ul><ul><ul><li>Contiene la información para construir una proteina. </li></ul></ul><ul><li>ARN ribosomal (rRNA) </li></ul><ul><ul><li>Componente mayoritario de los ribosomas </li></ul></ul><ul><li>ARN transferente (tRNA) </li></ul><ul><ul><li>Encargado de llevar los amino acidos a los ribosomas para la síntesis de proteinas </li></ul></ul>Tipos de ARN
    29. 29. <ul><li>Molécula linear que contiene información genética copiada del AND. Tiene regiones codificadoras y regiones no codificadoras como la cabeza o líder y la cola. </li></ul><ul><li>Los mensajeros de eucariotas tienen un cap o gorra en el extremo 5’ y una cola polyA en el extremo 3’. </li></ul><ul><li>Transcription : es el proceso por el cual una molécula de AND es copiada a una de ARN. </li></ul>ARN mensajero Dirección de la transcipción
    30. 30. ARN transferente Tienen una estructura tridimensional muy bien definida Juega un papel crítico en la sintesis de proteinas llevando aa al ribosoma <ul><li>Doble papel: </li></ul><ul><li>adaptador que reconoce al amino ácido </li></ul><ul><li>en el extremo 3’ </li></ul><ul><li>El anticodón se empareja con el codón en el ARNm </li></ul>Amino ácido 5’ G T AAA G T CCC TT T A G C 3’ Anti codon ARNm
    31. 31. ARN ribosomal Componente mayoritario de los ribosomas Los ribosomas llevan a cabo la síntesis de proteínas asociándose con los diferentes ARNm que proporcionan la secuencia de codificación real y los ARNt que les proporcionan los aa
    32. 32. <ul><li>4 nucleótidos posibles (A, C, G, U) </li></ul><ul><li>Un codón tiene 3 bases </li></ul><ul><li>4 * 4 * 4 = 64 codones posibles </li></ul><ul><li>Codón de inicio: AUG </li></ul><ul><li>Codón de parada o Stop: UAA, UAG, UGA </li></ul><ul><li>61 codones codifican amino ácidos (AUG también Metionina) </li></ul><ul><li>Solo existen 20 amino acidos – redundancia del código genetico code </li></ul>Código genético
    33. 33. <ul><li>Todos los organismos usan el mismo código genético </li></ul><ul><li>Un amino ácido esta codificado por 3 nucleótidos = Código genético </li></ul>Código genético es Universal <ul><li>4 nucleótidos posibles (A, C, G, U) </li></ul><ul><li>Un codón tiene 3 bases </li></ul><ul><li>4 * 4 * 4 = 64 codones posibles </li></ul><ul><li>Codón de inicio: AUG </li></ul><ul><li>Codón de parada o Stop: UAA, UAG, UGA </li></ul><ul><li>61 codones codifican amino ácidos (AUG también Metionina) </li></ul>
    34. 34. <ul><li>Solo existen 20 amino acidos – pero 64 codones posibles </li></ul>Redundancia del Código genético
    35. 35. <ul><li>Elementos constitutivos de las proteinas (20 different) </li></ul><ul><li>Tienen un grupo radical variable que los caracteriza </li></ul>Amino ácidos <ul><li>Los amino ácidos tienen diferentes características bioquímicas y </li></ul><ul><li>físicas, las cuales determinan su capacidad de ser reemplazados en </li></ul><ul><li>la evolución. </li></ul>C P G G A V I L M F Y W H K R E Q D N S T C SH S+S positivos cargados polares alifáticos aromaticos pequeños muy pequeños hidrofóbicos
    36. 36. Los ARNm se pueden leer en tres diferentes marcos de lectura, pero solo uno de ellos codifica la proteína correcta Código genético
    37. 37. Proteínas Los aa se unen mediante enlaces peptídicos entre el grupo carboxilo terminal de un aa y el grupo amino de otro. Péptido: Cadena corta de aa (< 30) P olipéptido: cadena larga de aa (hasta 4000 residuos). La secuencia de aa, su tipo y orden constituyen la Estructura primaria de la proteína Residuo amino terminal Residuo carboxilo terminal Tyr Gly Gly Phe Leu Val Ser
    38. 38. Proteínas Estructura secundaria: producto del establecimiento de puentes de hidrógeno entre distintos átomos de los aa Helices alfa: enrrollamiento espiral p.ejem proteinas fibrosas como piel y uñas Cada hélice tiene 3,6 aa por vuelta
    39. 39. Proteínas Estructura secundaria: producto del establecimiento de puentes de hidrógeno entre distintos átomos de los aa Beta plegada: estructura en zig-zag resistente y flexible p.ejem fibroína (proteína de la seda) Dos o mas polipéptidos se situan de forma paralela entre ellos y se unen mediante puentes de hidrógeno. Estos puentes de hidrógeno se establecen entre diferentes segmentos del polipétido a diferencia con las alfa hélices
    40. 40. Proteínas Estructura terciaria: Es la forma global de cada proteína. Depende de las interacciones entre los grupos radicales de la misma cadena polipetídica ocasionada por: puentes de hidrógeno, atración iónica, condición hidrofóbica o hidrofílica y puentes disulfuro. Figure shows the tertiary structure of Chain B of Protein Kinase C Interacting Protein Péptido individual doblado
    41. 41. Proteínas Estructura cuaternaria: Es propia de las proteínas globulares y es la conformación tridimensional de la unión de dos o más cademas polipeptídicas, generadas por las mismas interacciones anteriormente citadas . Agregado de dos o más péptidos Figure shows the tertiary structure of Chain B of Protein Kinase C Interacting Protein
    42. 42. Volvemos al principio… “ El dogma central” ADN ARN Proteína Trascripción Translación Traducción

    ×