Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
I6S RIBOSOMAL DNA SEQUENCE 
ANALYSIS 
Abdulrahman Mohammed 
School of Public Health & Zoonoses 
GADVASU
INTRODUCTION 
• The rRNA gene is the most conserved (least variable) 
DNA in all cells. Portions of the rDNA sequence from...
Note on terminology 
• Several pieces of RNA are important for 
proper ribosome function. 
• This RNA is not translated to...
Ribosomal RNA
Universal phylogenetic tree as determined from 
comparative ribosomal RNA sequencing.
• Although the three domains of living 
organisms were originally defined by 
ribosomal RNA sequencing, subsequent 
studie...
Detailed phylogenetic tree of the major lineages 
(phyla) of Bacteria based on 16S ribosomal RNA 
sequence comparisons
RIBOSOMAL RNA 
• To infer relationships that span the diversity of known 
life, it is necessary to look at genes conserved...
• Most prokaryotes have three rRNAs, called the 5S, 16S 
and 23S rRNA. Bacterial 16S, 
• 23S, and 5S rRNA genes are typica...
Secondary structure 
of small subunit ribosomal RNA
Types 
• In prokaryotes: 23S, 5S,16S 
• In eukaryotes: 28S, 5.8S, 5S, 18S
rRNA gene 
sequencing
16S rDNA gene – codes for making SSU rRNA 
Forward primer Reverse primer 
5’ 3’ 
Conserved region Variable regions 
Stems ...
Ribosomal RNAs in Prokaryotes: 
NAME SIZE (NUCLEOTIDES) LOCATION 
5S 120 Large subunit of ribosome 
16S 1500 Small subunit...
• The 16s rDNA sequence has hypervariable regions, where 
sequences have diverged over evolutionary time. 
• Strongly cons...
Why is the small subunit rRNA gene so useful ? 
 Conserved in parts – highly variable 
in other parts. Thus it a very goo...
Which hyper-variable regions to 
sequence? 
Region Position # b.p. 
V1 69-99 30 
V2 137-242 105 
V3 338-533 195 
V4 576-68...
454-based 16S amplicon sequencing
RFLP Fingerprinting Analysis 
• RFLP = restriction fragment length polymorphism 
• RFLP analysis involves cutting DNA into...
TRFLP Analysis 
• TRFLP = (terminal restriction fragment length polymorphism 
analysis) 
• A way to separate multiple PCR ...
Automated DNA analyzer 
Gel 
electrophoresis 
analysis 
0 100 200 300 400 500 600 700 
Fragment Length 
Relative Abundance...
TRFLP (Terminal Restriction Fragment Length 
Polymorphism) 
• Mixed population is amplified 
using a 16S primer with a 
fl...
TRFLP (cont.) 
 Advantages 
 Very sensitive 
 Fast, easy and cheap 
 Disadvantages 
 Can NOT cut bands to get sequenc...
Southern Blot Hybridization 
• SBH analysis is a method named after its developer, Southern, E, M. (1979) 
that facilitate...
Microarrays 
Constructed using probes for a known nucleic acid sequence or for a series of targets, a 
nucleic acid sequen...
DNA extraction 
PCR 
Gel electrophoresis 
Bacteria 
identification 
DNA sequencing 
ACAGATGTCTTGTAATCCGGC 
CGTTGGTGGCATAGG...
Secondary structure 
of 16S rRNA in E. coli 
Molecular 
Phylogenetics 
Step 1. Select a DNA 
region that is homologous, 
o...
2. Amplify and Sequence this region across isolates…. 
ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT 
AGGGAAAGGACATTTAGTGAAAGAAATTGATG...
3. Sequence alignment is crucial for inferring how DNA 
sites have changed. 
Poor alignment 
Implies that species “I” is 
...
4. Estimate relationships based on extent of DNA similarity. 
G 
B 
C 
D 
A 
J 
F 
E 
K 
H 
I 
ATGTTGGCAGTCCGATGTAAGC 
ATG...
Example: Molecular 
phylogenies have 
revealed unexpected 
features of bacterial 
evolution. 
For instance, an 
endosymbio...
2. Amplify and Sequence this region across isolates…. 
ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT 
AGGGAAAGGACATTTAGTGAAAGAAATTGATG...
3. Sequence alignment is crucial for inferring how DNA 
sites have changed. 
Poor alignment 
Implies that species “I” is 
...
4. Estimate relationships based on extent of DNA similarity. 
G 
B 
C 
D 
A 
J 
F 
E 
K 
H 
I 
ATGTTGGCAGTCCGATGTAAGC 
ATG...
Example: Molecular 
phylogenies have 
revealed unexpected 
features of bacterial 
evolution. 
For instance, an 
endosymbio...
How does this organism fit into the world of available 
sequence data? 
ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT 
AGGGAAAGGACATTT...
? 
ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT 
AGGGAAAGGACATTTAGTGAAAGAAATTGATG 
CGATGGGTGGATCGATGGCTTATGCTATCGATC 
AATCAGGAATTCAAT...
Some Databases 
• National Center for Biotechnology Information 
(www.ncbi.nlm.nih.gov) 
• Ribosomal Database Project II 
...
Guidelines for interpretation of 16S rRNA gene 
sequence-based results for identification of 
medically important aerobic ...
Only 0–2 and 2–13 % of staphylococci, and 0 and 0–10 % of 
nocardia, can be confidently and doubtfully identified, 
respec...
Definitions 
“A bacterium species is defined as ‘confidently identified by 
16S rRNA gene sequencing’ if there is >3% diff...
THANK YOU FOR 
YOUR ATTENTION
16S Ribosomal DNA Sequence Analysis
Upcoming SlideShare
Loading in …5
×

16S Ribosomal DNA Sequence Analysis

19,758 views

Published on

Published in: Health & Medicine

16S Ribosomal DNA Sequence Analysis

  1. 1. I6S RIBOSOMAL DNA SEQUENCE ANALYSIS Abdulrahman Mohammed School of Public Health & Zoonoses GADVASU
  2. 2. INTRODUCTION • The rRNA gene is the most conserved (least variable) DNA in all cells. Portions of the rDNA sequence from distantly related organisms are remarkably similar. This means that sequences from distantly related organisms can be precisely aligned, making the true differences easy to measure. For this reason, genes that encode the rRNA (rDNA) have been used extensively to determine taxonomy, phylogeny (evolutionary relationships), and to estimate rates of species divergence among bacteria. Thus the comparison of 16s rDNA sequence can show evolutionary relatedness among microorganisms. • Carl Woese, who proposed the three Domain system of classification - Archaea, Bacteria, and Eucarya - based on such sequence information, pioneered this work
  3. 3. Note on terminology • Several pieces of RNA are important for proper ribosome function. • This RNA is not translated to protein, the ribosomal RNA is the active component. • Thus we can refer to the “rRNA gene” or “rDNA” to designate the DNA in the genome that produces the ribosomal RNA.
  4. 4. Ribosomal RNA
  5. 5. Universal phylogenetic tree as determined from comparative ribosomal RNA sequencing.
  6. 6. • Although the three domains of living organisms were originally defined by ribosomal RNA sequencing, subsequent studies have shown that they differ in many other ways • Large public databases available for comparison. • Ribosomal Database Project currently contains >1.5 million rRNA sequences.
  7. 7. Detailed phylogenetic tree of the major lineages (phyla) of Bacteria based on 16S ribosomal RNA sequence comparisons
  8. 8. RIBOSOMAL RNA • To infer relationships that span the diversity of known life, it is necessary to look at genes conserved through the billions of years of evolutionary divergence. • Examples of genes in this category are those that define the ribosomal RNAs (rRNAs). • In Bacteria, Archaea, Mitochondria, and Chloroplasts, the small ribosomal subunit contains the 16S • rRNA (where the S in 16S represents Svedberg units). The large ribosomal subunit contains two rRNA species (the 5S and 23S rRNAs).
  9. 9. • Most prokaryotes have three rRNAs, called the 5S, 16S and 23S rRNA. Bacterial 16S, • 23S, and 5S rRNA genes are typically organized as a co-transcribed operon. There may • be one or more copies of the operon dispersed in the genome (for example, E coli has • seven). The Archaea contains either a single rDNA operon or multiple copies of the operon • rRNA targets were studied originally, most researchers now target the corresponding ribosomal DNA (rDNA) because DNA is more stable and easier to analyse
  10. 10. Secondary structure of small subunit ribosomal RNA
  11. 11. Types • In prokaryotes: 23S, 5S,16S • In eukaryotes: 28S, 5.8S, 5S, 18S
  12. 12. rRNA gene sequencing
  13. 13. 16S rDNA gene – codes for making SSU rRNA Forward primer Reverse primer 5’ 3’ Conserved region Variable regions Stems (sites that rarely mutate & are conserved) Use of primers to copy the 16S rDNA gene in bacteria Loops (sites that are more free to mutate & evolve faster) Ribosome synthesizing a protein Bacterium with ribosomes Campbell & Reece, 6th Ed. Atomic structure of the small subunit a ribosome. The rRNA, shown in orange, helps match the mRNA (codon) to the tRNA (anticodon). Small subunit ribosomal RNA F R Copied DNA (using PCR)
  14. 14. Ribosomal RNAs in Prokaryotes: NAME SIZE (NUCLEOTIDES) LOCATION 5S 120 Large subunit of ribosome 16S 1500 Small subunit of ribosome 23S 2900 Large subunit of ribosome
  15. 15. • The 16s rDNA sequence has hypervariable regions, where sequences have diverged over evolutionary time. • Strongly conserved regions often flank these hypervariable regions. • Primers are designed to bind to conserved regions and amplify variable regions. • The DNA sequence of the16S rDNA gene has been determined for an extremely large number of species. In fact, there is no other gene that has been as well characterized in as many species. • Sequences from tens of thousands of clinical and environmental isolates are available over the Internet through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov) and the Ribosomal Database Project (http://rdp.cme.msu.edu/). • These sites also provide search algorithms to compare new sequences to their database.
  16. 16. Why is the small subunit rRNA gene so useful ?  Conserved in parts – highly variable in other parts. Thus it a very good phylogenetic marker  VERY large database of sequences  Cell have many ribosomes which can be targeted with probes (e.g. FISH, &TRFLP) for community analysis  16S rRNA gene sequencing is now the gold standard for community analysis
  17. 17. Which hyper-variable regions to sequence? Region Position # b.p. V1 69-99 30 V2 137-242 105 V3 338-533 195 V4 576-682 106 V5 822-879 57 V6 967-1046 79 V7 1117-1173 56 V8 1243-1294 51 V9 1435-1465 30 E.coli 16S SSU rRNA hyper-variable regions
  18. 18. 454-based 16S amplicon sequencing
  19. 19. RFLP Fingerprinting Analysis • RFLP = restriction fragment length polymorphism • RFLP analysis involves cutting DNA into fragments using one or a set of restriction enzymes. • For chromosomal DNA the RFLP fragments are separated by gel electrophoresis, transferred to a membrane, and probed with a gene probe. • One advantage of this fingerprinting technique is that all bands are bright (from chromosomal DNA) because they are detected by a gene probe. AP-PCR, ERIC-PCR, and REP-PCR all have bands of variable brightness and also can have ghost bands. • For PCR products a simple fragment pattern can be distinguised immediately on a gel. This is used to confirm the PCR product or to distinguish between different isolates based on restriction cutting of the 16S-rDNA sequence “ribotyping”. Also developed into a diversity measurement technique called “TRFLP”.
  20. 20. TRFLP Analysis • TRFLP = (terminal restriction fragment length polymorphism analysis) • A way to separate multiple PCR products of the same size. These products can be generated by a 16S-rRNA PCR of community DNA • The PCR is performed as usual with two primers, but one is fluorescently labeled • The PCR products are then cut up using a restriction enzyme • The fluorescently labeled PCR pieces are detected • TRFLP steps: 1. Extract DNA 2. Perform 16S rRNA PCR using fluorescently-labeled primer 3. Choose a restriction enzyme for TRFLP that will give the greatest diversity in restriction product size
  21. 21. Automated DNA analyzer Gel electrophoresis analysis 0 100 200 300 400 500 600 700 Fragment Length Relative Abundance 0.10 0.08 0.06 0.04 0.02 0.00
  22. 22. TRFLP (Terminal Restriction Fragment Length Polymorphism) • Mixed population is amplified using a 16S primer with a fluorescent tag • PCR product is cut with a 4bp cutting restriction endonuclease • Different sequences will give different length fragments • Sample is injected into a capillary sequencer to sort fragments by fragment size size cut with 4bp RE FU
  23. 23. TRFLP (cont.)  Advantages  Very sensitive  Fast, easy and cheap  Disadvantages  Can NOT cut bands to get sequence data  Requires capillary sequencer  Hard to distinguish noise from little peaks sometimes
  24. 24. Southern Blot Hybridization • SBH analysis is a method named after its developer, Southern, E, M. (1979) that facilitates detection of a DNA fragment of interest among hundreds of other fragments generated by REA • Allows restriction digestion electrophoresis patterns to become interpretable • Restriction DNA fragments separated in agarose gel are transferred (blotted) onto a piece of nitrocellulose or nylon membrane • The membrane is then exposed to a DNA probe that has been labeled with a molecule that facilitates visual detection of a selected target DNA fragment • The probe, which is a piece of single-stranded DNA, specifically binds (hybridizes) to its complementary DNA sequence embedded in the membrane under appropriate conditions • When the SBH typing method uses ribosomal operon genes (rrn) found among restriction-digested fragments in a membrane as the target, it is called ribotyping
  25. 25. Microarrays Constructed using probes for a known nucleic acid sequence or for a series of targets, a nucleic acid sequence whose abundance is being detected. GeneChip microarrays consist of small DNA fragments (referred to also as probes), chemically synthesized at specific locations on a coated quartz surface. By extracting, amplifying, and labeling nucleic acids from experimental samples, and then hybridizing those prepared samples to the array, the amount of label can be monitored at each feature, enabling either the precise identification of hundreds of thousands of target sequence (DNA Analysis) or the simultaneous relative quantitation of the tens of thousands of different RNA transcripts, representing gene activity (Expression Analysis). The intensity and color of each spot provide information on the specific gene from the tested sample.
  26. 26. DNA extraction PCR Gel electrophoresis Bacteria identification DNA sequencing ACAGATGTCTTGTAATCCGGC CGTTGGTGGCATAGGGAAAG GACATTTAGTGAAAGAAATTG ATGCGATGGGTGGATCGATG GCTTATGCTATCGATCAATCA GGAATTCAATTTAGAGTACTT AATAGTAGCAAAGGAGCTGC TGTTAGAGCAACACGTGCTCA GGCAGATAAAATATTATATCG TCAAGCAATACGTAGTATTCT TGAATATCAAAAATTTTTGTTG GTTATTCA Bioinformatics
  27. 27. Secondary structure of 16S rRNA in E. coli Molecular Phylogenetics Step 1. Select a DNA region that is homologous, or similar across species due to common ancestry. Ribosomal RNA (rRNA) Ideal gene for phylogenetic studies because it : • is an essential gene that is present in all organisms. • is a common target for sequencing studies; large database for comparisons. • contains sites that are relatively conserved (stems) and sites that are more free to vary (loops).
  28. 28. 2. Amplify and Sequence this region across isolates…. ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT AGGGAAAGGACATTTAGTGAAAGAAATTGATG CGATGGGTGGATCGATGGCTTATGCTATCGATC AATCAGGAATTCAATTTAGAGTACTTAATAGTA GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT CAGGCAGATAAAATATTATATCGTCAAGCAATA CGT ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT AGGGAAAGGACATTTAGTGAAAGAAATTGATG CGATGGGTGGATCGATGGCTTATGCTATCGATC AATCAGGAATTCAATTTAGAGTACTTAATAGTA GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT CAGGCAGATAAAATATTATATCGTCAAGCAATA CGT ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT AGGGAAAGGACATTTAGTGAAAGAAATTGATG GTFTGGGTGGATCGATGGCTTATGCTATCGATC AATCAGGAATTCAATTTAGAGTACTTAATAGTA GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT CAGGCAGATAAAATATTATATCGTCAAGCAATA CGT ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT AGGGAAAGGACATTTAGTGAAAGAAATTGATG CGATGGGTGGATCGATGGCTTATGCTATCGATC AATTTAGAATTCAATTTAGAGTACTTAATAGTAG CAAAGGAGCTGCTGTTAGAGCAACACGTGCTC AGGCAGATAAAATATTATATCGTCAAGCAATAC GT Sequence the PCR product PCR
  29. 29. 3. Sequence alignment is crucial for inferring how DNA sites have changed. Poor alignment Implies that species “I” is divergent from the others, but this is not the case. Good alignment. Species “I” has probably experienced a deletion event at position #6 or #7.
  30. 30. 4. Estimate relationships based on extent of DNA similarity. G B C D A J F E K H I ATGTTGGCAGTCCGATGTAAGC ATGTTGGCAGTCCGATGTAAGC ATGTTGGCAGTCCGATGTAACC ACGGTAGCAGTCTGATGTATCC ACGGTAGCAGTCTGATGTATCC ACGGTAGCAGTCTGATGTATCC CTGCTGGTAGTCGTTTGTAACC CTGCTGGTAGTCGTTTGTAACC CTGCTGGCAGTCGGTTGTAACC ATGCTGGCAGTCGGGTGTAACC ATGGTGGCAGTCGGGTGTCACC At variable DNA positions, related groups will tend to share the same nucleotide. The sheer number of characters is helpful to distinguish the ‘phylogenetic signal’ from noise. Molecular phylogeny of taxa A-I. Colored letters = different from top sequence (taxon G)
  31. 31. Example: Molecular phylogenies have revealed unexpected features of bacterial evolution. For instance, an endosymbiotic lifestyle has evolved several times independently. Moran and Wernegreen (2000)
  32. 32. 2. Amplify and Sequence this region across isolates…. ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT AGGGAAAGGACATTTAGTGAAAGAAATTGATG CGATGGGTGGATCGATGGCTTATGCTATCGATC AATCAGGAATTCAATTTAGAGTACTTAATAGTA GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT CAGGCAGATAAAATATTATATCGTCAAGCAATA CGT ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT AGGGAAAGGACATTTAGTGAAAGAAATTGATG CGATGGGTGGATCGATGGCTTATGCTATCGATC AATCAGGAATTCAATTTAGAGTACTTAATAGTA GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT CAGGCAGATAAAATATTATATCGTCAAGCAATA CGT ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT AGGGAAAGGACATTTAGTGAAAGAAATTGATG GTFTGGGTGGATCGATGGCTTATGCTATCGATC AATCAGGAATTCAATTTAGAGTACTTAATAGTA GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT CAGGCAGATAAAATATTATATCGTCAAGCAATA CGT ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT AGGGAAAGGACATTTAGTGAAAGAAATTGATG CGATGGGTGGATCGATGGCTTATGCTATCGATC AATTTAGAATTCAATTTAGAGTACTTAATAGTAG CAAAGGAGCTGCTGTTAGAGCAACACGTGCTC AGGCAGATAAAATATTATATCGTCAAGCAATAC GT Sequence the PCR product PCR
  33. 33. 3. Sequence alignment is crucial for inferring how DNA sites have changed. Poor alignment Implies that species “I” is divergent from the others, but this is not the case. Good alignment. Species “I” has probably experienced a deletion event at position #6 or #7.
  34. 34. 4. Estimate relationships based on extent of DNA similarity. G B C D A J F E K H I ATGTTGGCAGTCCGATGTAAGC ATGTTGGCAGTCCGATGTAAGC ATGTTGGCAGTCCGATGTAACC ACGGTAGCAGTCTGATGTATCC ACGGTAGCAGTCTGATGTATCC ACGGTAGCAGTCTGATGTATCC CTGCTGGTAGTCGTTTGTAACC CTGCTGGTAGTCGTTTGTAACC CTGCTGGCAGTCGGTTGTAACC ATGCTGGCAGTCGGGTGTAACC ATGGTGGCAGTCGGGTGTCACC At variable DNA positions, related groups will tend to share the same nucleotide. The sheer number of characters is helpful to distinguish the ‘phylogenetic signal’ from noise. Molecular phylogeny of taxa A-I. Colored letters = different from top sequence (taxon G)
  35. 35. Example: Molecular phylogenies have revealed unexpected features of bacterial evolution. For instance, an endosymbiotic lifestyle has evolved several times independently. Moran and Wernegreen (2000)
  36. 36. How does this organism fit into the world of available sequence data? ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT AGGGAAAGGACATTTAGTGAAAGAAATTGATG CGATGGGTGGATCGATGGCTTATGCTATCGATC AATCAGGAATTCAATTTAGAGTACTTAATAGTA GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT CAGGCAGATAAAATATTATATCGTCAAGCAATA CGT PCR Sequence the PCR product “Blast” sequence to Genbank GENBANK = NIH genetic database with all publicly available DNA sequences. As of 2004: > 44 billion bp, and > 40 million sequences Blast output: Lists sequences that are most similar to yours
  37. 37. ? ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT AGGGAAAGGACATTTAGTGAAAGAAATTGATG CGATGGGTGGATCGATGGCTTATGCTATCGATC AATCAGGAATTCAATTTAGAGTACTTAATAGTA GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT CAGGCAGATAAAATATTATATCGTCAAGCAATA CGT Is the bacterium really Wolbachia? PCR and sequence a gene of interest (e.g., 16S rDNA) YES!! Blast results: Wolbachia sp. 1 Wolbachia sp. 2 Wolbachia sp. 3 …. “Blast” sequence to Genbank
  38. 38. Some Databases • National Center for Biotechnology Information (www.ncbi.nlm.nih.gov) • Ribosomal Database Project II (http://rdp.cme.msu.edu/html/) • Ribosomal Differentiation of Medical Microorganisms (www.ridom.com) • MicroSeq 16S 500 Library (Applied Biosystems) • GenBank • Mayo Database
  39. 39. Guidelines for interpretation of 16S rRNA gene sequence-based results for identification of medically important aerobic Gram-positive bacteria(Woo et al., 2009) Full and 527 bp 16S rRNA gene sequencing and MicroSeq databases used for identifying medically important aerobic Gram-positive bacteria. Overall, full and 527 bp 16S rRNA gene sequencing can identify 24 and 40 % of medically important Gram-positive cocci (GPC), and 21 and 34 % of medically important Gram-positive rods (GPR) confidently to the species level, whereas the full-MicroSeq and 500- MicroSeq databases can identify 15 and 34 % of medically important GPC and 14 and 25 % of medically important GPR confidently to the species level. Among staphylococci, streptococci, enterococci, mycobacteria, corynebacteria, nocardia and members of Bacillus and related taxa (Paenibacillus, Brevibacillus, Geobacillus and Virgibacillus), the methods and databases are least useful for identification of staphylococci and nocardia.
  40. 40. Only 0–2 and 2–13 % of staphylococci, and 0 and 0–10 % of nocardia, can be confidently and doubtfully identified, respectively. However, these methods and databases are most useful for identification of Bacillus and related taxa, with 36– 56 and 11–14 % of Bacillus and related taxa confidently and doubtfully identified, respectively. A total of 15 medically important GPC and 18 medically important GPR that should be confidently identified by full 16S rRNA gene sequencing are not included in the full-MicroSeq database. A total of 9 medically important GPC and 21 medically important GPR that should be confidently identified by 527 bp 16S rRNA gene sequencing are not included in the 500-MicroSeq database. 16S rRNA gene sequence results of Gram-positive bacteria should be interpreted with basic phenotypic tests results. Additional biochemical tests or sequencing of additional gene loci are often required for definitive identification. To improve the usefulness of the MicroSeq databases, bacterial species that can be confidently identified by 16S rRNA gene sequencing but are not found in the MicroSeq databases should be included.
  41. 41. Definitions “A bacterium species is defined as ‘confidently identified by 16S rRNA gene sequencing’ if there is >3% difference between the16S rRNA gene sequence of the species and those of other medically important bacteria species. A bacterium species is defined as ‘not confidently identified by 16S rRNA gene sequencing’ if there is <2% difference between the 16S rRNA gene sequence of the species and that of one or more medically important aerobic Gram-positive bacterium species. A bacterium species is defined as ‘only doubtfully identified by 16S rRNA gene sequencing’ if there is 2–3 % difference between the 16S rRNA gene sequence of the species and that of one or more medically important aerobic Gram-positive bacterium species. (Woo et al., 2009)
  42. 42. THANK YOU FOR YOUR ATTENTION

×