NúCleo

7,865 views

Published on

Published in: Technology, Education
0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
7,865
On SlideShare
0
From Embeds
0
Number of Embeds
1,051
Actions
Shares
0
Downloads
143
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide

NúCleo

  1. 1. EL NÚCLEO El núcleo es un orgánulo ● característico de las células eucariotas. El material genético de la célula se encuentra dentro del núcleo en forma de cromatina. ADN y cromatina son términos relacionados: la cromatina es ADN – asociado íntimamente a proteínas básicas llamadas histonas. Cromatina y cromosomas son términos relacionados: el cromosoma – sería un paquete de cromatina muy compacto. El aspecto del núcleo varía a lo largo del ciclo celular: estudiaremos el – aspecto del núcleo interfásico y el aspecto del núcleo durante la división celular.
  2. 2. • Núcleo y citoplasma están separados por una envoltura nuclear. Está constituida por dos membranas con un espacio entre ellas. La envoltura nuclear proviene del retículo endoplasmático granular y está conectada con él. Adosados a la membrana exterior hay ribosomas, como ocurre en el retículo endoplasmático granular. • La envoltura nuclear no es continua, pues tiene un gran número de poros de 500 a 700 Å de diámetro con una MEMBRANA NUCLEAR compleja estructura formada por 8 partículas esféricas de naturaleza proteínica. Los poros permiten el paso de grandes moléculas (ARN, proteínas).
  3. 3. NUCLEOLO • El contenido del núcleo en interfase se revela al microscopio óptico como más o menos homogéneo, salvo por la presencia de pequeñas estructura esféricas llamadas nucleolos. • En el nucleolo se transcribe el ARNr y éste se une con proteínas ribosómicas entradas desde el citoplasma para ensamblarse en el nucleolo las subunidades ribosómicas mayor y menor. • El nucleolo deja de ser visible al comienzo de la división como consecuencia de condensarse la cromatina e impedirse por tanto la síntesis del ARNr
  4. 4. ESTRUCTURA DEL ADN Se pueden distinguir 3 niveles estructurales: Est. primaria: la secuencia de los nucleótidos. ● Representación simplificada de la secuencia Las dos hebras de ADN se enrrolan en sentido dextrógiro.Las bases quedan dentro, perpendiculares al eje Estr. secundaria: la doble hélice. ● Fibra nucleosómica -collar de perlas nucleosoma ADN Fibra de 30 nm Estr. terciaria: collar de perlas, ADN ● superenrollado. Cromosoma desenrrollado al quitarle histonas al ADN A partir de la estructura 3ª, se dan otros Visible esqueleto ● proteico cromosómico niveles de empaquetamiento de orden superior. Cromosomas metafásicos
  5. 5. Es la secuencia de nucleótidos ● ESTRUCTURA PRIMARIA DEL de una cadena. Para indicar la secuencia de una cadena de ADN. ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica. Así, por ejemplo: ● 5'ACGTTTAACGACAAGTATTAA GACAAGTATTAA3' La posibilidad de combinar ● cuatro nucleótidos diferentes y la gran longitud que pueden tener las cadenas, hacen que pueda haber un elevado número de polinucleótidos posibles, lo que determina que el ADN pueda contener el mensaje biológico o información genética y explica la diversidad del mensaje genético de todos los seres vivos.
  6. 6. Según el modelo de la doble hélice de ● ESTRUCTURA WATSON y CRICK: SECUNDARIA DEL ADN. 1º) El ADN estaría constituido por ● dos cadenas o hebras de polinucleótidos enrolladas helicoidalmente en sentido dextrógiro formando una doble hélice. 2º) Ambas cadenas serían ● antiparalelas, una iría en sentido 3'ð5' y la otra en sentido inverso. 3º) La desoxirribosa y el fosfato ● alternan formando una estructura sobre la que se enlazan las bases. 4º) Las bases nitrogenadas estarían ● hacia el interior de la hélice con sus planos paralelos entre sí y apareadas las de las dos hebras mediante puentes de hidrógeno. 5º) El apareamiento se realizaría ● únicamente entre A y T y G y C. Ambas cadenas serían complementarias.
  7. 7. ESTRUCTURA TERCIARIA Las grandes moléculas de ADN de ● las células eucariotas están muy DEL ADN EN LAS empaquetadas ocupando así menos CÉLULAS EUCARIOTAS. espacio y además como mecanismo para regular su transcripción. Histona H1 En las células eucariotas el ADN se ● encuentra en el núcleo asociado a proteínas básicas formando la cromatina -nucleoproteína- . Núcleo de 8 histonas del nucleosoma En la cromatina, la doble hélice de ● ADN se enrolla alrededor de unas proteinas globulares con muchas cargas +, las histonas, formando nucleosomas. Cada nucleosoma contiene 8 histonas y la doble hélice de ADN da dos vueltas a su alrededor (200 pares de bases). El conjunto, si no está más empaquetado aún, forma una estructura – arrosariada llamada “collar de perlas“. Pero los nucleosomas pueden empaquetarse formando fibras de un grosor de 30 nm (“fibra de 30 nm“). Según el modelo del solenoide las fibras se forman al enrollarse seis nucleosomas por vuelta alrededor de un eje formado por las histonas H1.
  8. 8. IMÁGENES A MICROSCOPIO ELECTRÓNICO Fibra de 10 nm o “collar de perlas” Fibra de 30 nm
  9. 9. Los siguientes niveles de ● NIVELES SUPERIORES DE empaquetamiento no están aún aclarados del todo pero, parece ser, que EMPAQUETAMIENTO cada fibra se volvería a enrollar formando un bucle (cada bucle tendría 50 millones de pares de bases); seis bucles se empaquetarían asociándose a un quot;esqueleto cromosómico no histónicoquot; produciéndose un rosetón; 30 rosetones formarían una espiral y 20 espirales formarían una cromátida. Todo ello produciría un gran acortamiento de las largas cadenas de ADN. En los espermatozoides el ADN se ● encuentra aún mucho más empaquetado, unido no a histonas sino a proteínas básicas llamadas protaminas. Los ADN de las bacterias, virus, ● mitocondrias y plastos no están asociados a histonas, aunque sí están asociados a otras proteínas reguladoras de la transcripción. Si las histonas pierden sus cargas (+) -modificando el pH- se consigue que no se unan al ADN. Así el EDN se desempaqueta y podemos ver el esqueleto cromosómico
  10. 10. DIVERSOS GRADOS DE La secuencia va desde el ADN hasta el ● EMPAQUETAMIENTO DE cromosoma. DNA Número 1: molécula de ADN, ● Número 2 , vemos el ADN unido a ● proteínas globulares básicas histonas, formando una estructura denominada 5 quot;collar de perlasquot;: repetición de unidades quot;nucleosomasquot;, que corresponderían a cada perla del collar. Número 3, estructura de orden superior 4 ● formando un quot;solenoidequot;. Número 4, aumento del empaquetamiento, ● formando la fibra de cromatina, nuevos 3 quot;buclesquot;. Número 5, llegamos al grado de mayor ● compactación, formando un denso 2 paquete de cromatina, un cromosoma. 1
  11. 11. • Un cromosoma es una molécula de ADN muy larga que contiene una serie de genes. Un cromosoma metafásico está formado por dos cromátidas idénticas en sentido longitudinal. En cada una de ellas hay un filamento de ADN replegado idéntico en ambas cromátidas. • Están unidas a través del centrómero. En las cromátidas se aprecia también un cinetócoro, centro organizador de microtúbulos que se forman durante la mitosis. El centrómero se encuentra en la constricción primaria. • En algunos puntos de las cromátidas hay otros estrechamientos llamadas constricciones secundarias que coinciden con heterocromatina. • Los telómeros o extremos de las cromátidas son importantes para mantener la integridad del cromosoma: si se pierden el cromosoma va acortándose en cada división celular.
  12. 12. CROMOSOMAS: CLASIFICACIÓN • Según la posición de la constricción primaria -del centrómero- los cromosomas se clasifican en: ✗ metacéntricos (M) con el A centrómero central en la cromátida; ✗ submetacéntricos (S) ✗ acrocéntricos (A) con el centrómero M muy desplazado hacia un extremo de la cromátida; T S ✗ telocéntricos (T) con el centrómero situado en un extremo de la cromátida • El total de la información genética contenida en los cromosomas de un organismo constituye su genoma.
  13. 13. Es la disposición ordenada de los ● cromosomas de una célula, agrupados por parejas de homólogos: primero los autosomas ordenados de mayor a menor tamaño; luego los cromosomas sexuales. Se realiza normalmente con los ● cromosomas metafásicos y por ello cada uno aparece formado por dos cromátidas. Para facilitar el reconocimiento de los ● homólogos se realizan tinciones de las que resultan los cromosomas con un CARIOTIPO bandeado cuya posición de las franjas humano con es idéntica en ambos homólogos (la 22 parejas de diferente captura de los colorantes se autosomas debe a la diferente proporción de bases y un par de en cada tramo). cromosomas El cariotipo permite reconocer sexuales ● anomalías cromosómicas (así en Par 23 del cariotipo humano masculino: amniocentesis) cromosomas sexuales XY
  14. 14. Las cromátidas hermanas son contienen dos ● hebras de ADN idénticas, unidas por el Célula diploide en metafase, centrómero, que han resultado de la heterocigota para el gen “A” y replicación del ADN original. Un cromosoma homocigota para el gen “B” está formado por dos cromátidas durante CROMOSOMAS profase y metafase; en anafase ls cromátidas HOMÓLOGOS hermanas se separan a polos opuestos y cada cromosoma queda formado por una sola cromátida. Los cromosomas homólogos emparejados en ● B B BB el cariotipo contienen los mismos genes -aunque con diferente variante alélica para AA aa muchos de ellos- pues cada cromosoma de la pareja de homólogos procede de un parental: uno de procedencia materna y otro de procedencia paterna. Sólo puede hablrase de cromosomas homólogos en el caso de células diploides. CROMÁTIDAS HERMANAS
  15. 15. EUCROMATINA Y HETEROCROMATINA N Durante la interfase, en ● cualquier célula, no toda la heterocromatina cromatina se expresa. Distinguimos: ✗ Eucromatina* o cromatina laxa, es decir poco compactada, correspondiente al ADN de los genes que se expresan en dicha célula. Al no estar compacta aparece clara en el núcleo. ✗ Heterocromatina o cromatina densamente compactada, correspondiente a los genes que no se expresan en dicha célula. Se sitúa en gran parte adosada a la membrana nuclear, presentándose como manchas oscuras *Eu = bueno, verdadero (así “eu-carionte” = con buen núcleo)
  16. 16. CROMOSOMAS: CLASIFICACIÓN • Según la posición de la constricción primaria -del centrómero- los cromosomas se clasifican en: ✗ metacéntricos (M) con el A centrómero central en la cromátida; ✗ submetacéntricos (S) ✗ acrocéntricos (A) con el centrómero M muy desplazado hacia un extremo de la cromátida; T S ✗ telocéntricos (T) con el centrómero situado en un extremo de la cromátida • El total de la información genética contenida en los cromosomas de un organismo constituye su genoma.

×