Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO I                                                IN...
ateriosclerótico5-6. También se han considerado como factores de riesgo lahipertensión arterial, la diabetes7 y el tabaqui...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAfactores de riesgo hacen desaparecer la influencia de los tr...
del tejido conectivo (fibrilar y no fibrilar) y los factores mecánicos del fluidohemodinámico.La aterogénesis considerada ...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAEl endotelio elabora diversas sustancias de capital importan...
en grupos de riesgo que permite tomar las decisiones terapéuticas correspondientesy una evaluación del riesgo absoluto 37....
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDASi las tensiones se ubican en diferentes categorías, a la pe...
DiabetesEl 75% de los diabéticos fallecen por enfermedad coronaria. Austin y colaboradoresdemostraron que la presencia pre...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDALa apoE se encuentra en las lipoproteínas ricas en triacilgl...
Además de la asociación con los niveles de colesterol, la variabilidad de apoE hasido relacionada con un extenso grupo de ...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAagregación de la LDL en la pared vascular. Se sabe que la LD...
0.8% para E4/2. Si se toma el alelo más común, e3, como tipo silvestre, el alelo e4representa una mutación a nivel del ami...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO II                                                 ...
Recientes estudios prueban que incluso una reducción leve de los nivelessanguíneos de colesterol disminuye el riesgo de mu...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAniveles elevados de colesterol, especialmente en la subfracc...
Objetivos generales1- Determinar la prevalencia de los factores de riesgo para eldesarrollo de la enfermedad ateroscleróti...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO III                                                ...
VariablesLas variables del estudio fueron:   Edad: Medida en años cumplidos (variable cuantitativa continua)   Sexo: Mas...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA   Genotipo de apo E: isoforma correspondiente : E4/4, E3/3...
 Determinación de colesterol – HDLLos quilomicrones, las lipoproteínas de muy baja densidad y las lipoproteínas debaja de...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAestablecer su calidad y concentración aproximada por electro...
de un fragmento del gen de apo E por PCR y clivaje del ADN obtenido con la enzimade restricción Hha I tal como lo describe...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO IV                                                 ...
En la tabla 2 se presenta la distribución por municipio de la muestra seleccionada.Tabla 2. RESIDENCIA POR MUNICIPIO DE LA...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAque el 78.4% de las mujeres presentan una talla menor a 1.6 ...
consideran que hay obesidad si el I.M.C es superior a 27; para las mujeres el I.M.Cnormal oscila entre 18.3 y 23.8; mientr...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDATABLA 7. DISTRIBUCIÓN POR GÉNERO DE LA FRECUENCIA DETENSION ...
TABLA 8. DISTRIBUCIÓN POR AREA (RURAL Y URBANA)Y SEXO DE LA FRECUENCIA PORCENTUAL DE LAS PRESIONES ARTERIALES       P. A. ...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDATABLA 9. DISTRIBUCIÓN DE LOS PROMEDIOS DE COLESTEROLTOTAL, C...
TABLA 10. DISTRIBUCIÓN DEL PERFIL LIPIDICO POR GÉNERO Y AREACOLESTEROL            TOTAL %          HOMBRES %        MUJERE...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDApropósito de comparar los habitantes del área rural y los ha...
APOLIPOPROTEINA EEn la figura 1 se muestran los productos de amplificación por PCR de una parte delgen de apo E correspond...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDALa tabla 12 muestra la distribución de frecuencias de cada u...
MUTACION Apo B3500En la propuesta inicial se recomendaba realizar este ensayo para todas lasmuestras que tuvieran colester...
FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACORRELACIONESSe estudiaron algunas correlaciones entre los p...
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Upcoming SlideShare
Loading in …5
×

Libro factores de riesgo cardiovascular Risaralda

2,054 views

Published on

Published in: Health & Medicine
  • Be the first to comment

  • Be the first to like this

Libro factores de riesgo cardiovascular Risaralda

  1. 1. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO I INTRODUCCION Y ANTECEDENTESEn Colombia la enfermedad cardiovascular (ECV) es la principal causa de muerteNO violenta y su incidencia aumenta año tras año 1. En la ciudad de Pereira lamuerte por ECV ocupó el primer lugar durante los años de 1994 y 1995; pero sisumamos las causas: Insuficiencia cardiaca, enfermedad cerebrovascular aguda einfarto agudo del miocardio; duplican la mortalidad producida por armas de fuego yexplosivos en los años 1994, 1995, 1996, 1997 2.A pesar de todos los esfuerzos por disminuir su incidencia, la ECV continúa siendola primera causa de muerte en el mundo occidental 3. Es importante identificar losfactores de riesgo que más afectan a nuestra población, con el objeto de adelantaruna campaña que permita prevenir la aparición y el desarrollo de las lesionesateroscleróticas y en aquellas personas que tienen la placa puedan, al conocer yevaluar el riesgo, detener y hacer retroceder el proceso, poniendo en prácticahábitos sanos de dieta y ejercicio o utilizando adicionalmente fármacos si así lorequieren.Grandes avances se han llevado a cabo en los últimos 30 años con el fin deidentificar y valorar los factores de riesgo para la enfermedad cardiovascular.En los años 60 los médicos recomendaban dejar el cigarrillo como medidapreventiva para la ECV y el cáncer de pulmón. En los años 70 en los EstadosUnidos de América se realizó una gran campaña para disminuir la incidencia de lahipertensión arterial. En la década de los 80 se enfocó la lucha contra lahipercolesterolemia, tanto en su diagnóstico como en su tratamiento, y sepublicaron guías y conductas a seguir para controlar los niveles de colesterol sérico.El manejo y control de estos tres factores de riesgo (cigarrillo, hipertensión ehipercolesterolemia) ha contribuido a disminuir la morbimortalidad en paísesdesarrollados. En Estados Unidos se disminuyó la mortalidad por ECV en un 25%entre 1968 y 19874.A pesar de los esfuerzos para controlar la incidencia de la enfermedad, se consideraque en 1991, solo en EUA, el infarto agudo de miocardio (IAM) fue responsable deun millón de muertes. Se sabe que las campañas educativas sobre el colesterol y laECV tienen más efecto sobre las clases media y alta de la sociedad, pues hanaumentado las personas que acuden regularmente a los gimnasios y el consumo dealimentos ligeros o ricos en fibra y bajos en grasa saturada. Es bueno recordar queel efecto logrado tratando un sólo factor de riesgo es poco cuando coexisten variosde ellos, entre los que podemos mencionar: hipercolesterolemia, hipertensión, dietay sedentarismo.Los estudios epidemiológicos muestran que algunos factores de riesgo comocolesterol total elevado, colesterol LDL elevado, colesterol HDL bajo y triglicéridoselevados constituyen elementos importantes en el desarrollo del proceso 1
  2. 2. ateriosclerótico5-6. También se han considerado como factores de riesgo lahipertensión arterial, la diabetes7 y el tabaquismo8.A pesar del estudio de los factores de riesgo clásicos mencionados que explican lagénesis y el desarrollo de la ECV, ellos sólo correlacionan con un 40% de lamortalidad. Debido a esto se hace necesario aplicar nuevos métodos deinvestigación al estudio de esta enfermedad y poder evaluar el peso que cada uno delos factores de riesgo tiene sobre su génesis y su evolución.El primer estudio interpoblacional se publicó en 1980, es el conocido estudio de los7 países9, analizó 12.763 hombres de 16 regiones en 7 países, se encontró unarelación positiva entre los niveles séricos de colesterol total y la incidencia de laenfermedad coronaria. De igual forma se ha demostrado que cambios en el estilo devida conllevan a aumentar el colesterol y la enfermedad 10, la migración de losjaponeses hacia los Estados Unidos demostró esta influencia ambiental. Estudiosintra poblacionales igualmente han demostrado la relación entre estas dosvariables11 12 13 14 15.Para mencionar, de manera especial está el estudio MRFIT (Estudio De IntervenciónDe Múltiples Factores De Riesgo) que observó 160.000 hombres entre 35 y 57 añosde edad en los Estados Unidos y que demostró que en personas con niveles decolesterol total menores a 200 mg/dl se presenta una menor incidencia de laenfermedad. Este riesgo se duplica cuando los niveles de colesterol superan el valorde 240mg/dl y se cuadruplica16 con valores por encima de los 300 mg/dl 17.Otro factor clásico es el alto nivel de colesterol transportado por las lipoproteínas debaja densidad (Col-LDL). El estudio prospectivo cardiovascular de Munster(PROCAM) fue el primero en demostrar, sin lugar a dudas, que el alto nivel de Col-LDL es mejor pronóstico para la enfermedad coronaria que el colesterol total 18.Otros estudios lo han validado y hoy se toma en cuenta que lo ideal es tener Col-LDL < 130 mg/dl y que hay riesgo cuando Col-LDL > 160mg/dl19.El colesterol transportado por las lipoproteínas de alta densidad (Col-HdL) espronóstico para la enfermedad cuando está por debajo de los 35 mg/dl, hay variosestudios como el de Frammingham, el estudio MRFIT, el PROCAM, el estudio deOSLO20 y el Británico regional21 que demuestran la clara asociación inversa entrelos niveles de Col-HDL y la enfermedad coronaria. Un incremento de 0.2 mM (7.14mg/dl) está asociado con una disminución del 2% de riesgo para padecer laenfermedad coronaria. Así como se considera riesgo tener un Colesterol-HDL <35mg/dl, las cifras por encima de 60mg /dl se estiman como un factor de riesgonegativo para la enfermedad22.Es bueno recordar que mientras las LDL transportan colesterol hacia los tejidosextrahepáticos donde son recogidos por receptores específicos que reconocen la apoB100, las HDL transportan colesterol sobrante hacia el hígado para ser metabolizadoa ácidos biliares o reutilizado para la síntesis de VLDL, pues el anillo de ciclopentano perhidrofenantreno no es escindido en el catabolismo del colesterol.Los triacilglicéridos séricos elevados muestran relación positiva con la ECV 23. Larelación ha sido clara siempre en los estudios univariados, es decir, cuando sólo setiene en cuenta el nivel de triglicéridos ya que en análisis multivariado los otros 2
  3. 3. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAfactores de riesgo hacen desaparecer la influencia de los triacilglicéridos, pero se hapropuesto que una correlación de bajos niveles de HDL y alto nivel detriacilglicéridos potencia el riesgo a padecer la ECV24. Las técnicas de la biologíamolecular ofrecen mejores posibilidades de aproximación 25 y así se han idodiferenciando nuevos factores de riesgo basados en estudios de tipo molecular comolos relacionados con las apoproteínas de las lipoproteínas26 y sus correspondientesreceptores celulares27 28.En Colombia se han realizado pocas investigaciones sobre factores de riesgo para laECV. Podemos citar las realizadas por Suárez y López 29 en las poblaciones de SanJuan de Pasto y San Andrés. Ellos reportaron los siguientes resultados: Colesteroltotal elevado (>220mg/dl) en el 40% de las personas estudiadas; Col-LDL elevado(>130mg/dl) en el 37.5%; Col-HDL bajo (<45mg/dl en mujeres y <35mg/dl enhombres) en el 41% de las mujeres y el 15% de los hombres; TAG>150mg/dl,considerados altos, en el 24% y el 14.7% de hombres y mujeres respectivamente.En Risaralda ya son varios los estudios realizados en los que se demuestra laexistencia de Col-HDL bajo tanto en hombres como en mujeres. El presente trabajose enfoca en los factores de riesgo clásicos, aunque va más allá. Es el primerestudio en Colombia que utiliza las técnicas de la biología molecular para realizaruna Genotipificación de la apoproteína E y una búsqueda de la mutación apo B3500.AterogénesisEl colesterol es un componente básico de todas las membranas de las célulasanimales y por este motivo todas están en capacidad de sintetizarlo. El colesterol esel precursor obligado de las hormonas esteroides, de los ácidos biliares, del dolicol yes indispensable en el proceso de mitosis para la formación de membranas.El colesterol en el organismo humano proviene de dos fuentes básicas: La dieta y elsintetizado de novo a partir del Acetil-CoA, llamado colesterol endógeno, que puedesuperar al dietario en una persona que consume una dieta mixta. El colesterol dela dieta es absorbido en el intestino en un 50%, este porcentaje de absorción puededisminuir ante altos niveles presentes en la dieta.Los únicos tejidos que tienen la capacidad de sintetizar colesterol para serexportado son el hígado y el intestino. Como el colesterol es una sustanciainsoluble en agua debe acoplarse con proteínas, formar lipoproteínas, que lepermitan su paso a través del plasma. Cuando su concentración en sangre eselevada se acumula en las arterias y da origen a los ateromas, responsables de losgraves problemas de salud en el mundo occidental. En personas mayores de 15años ya aparecen rasgos incipientes de estrías grasa en la pared arterial. La OMSrealizó un estudio en 5 ciudades Europeas, con 17.827 personas menores de 15años, fallecidas por diversas causas; de todos los casos estudiados solamente unvarón y dos mujeres no presentaron lesión arteriosclerótica identificable 30.La arteriosclerosis es producto de una serie de reacciones en cascada queinvolucran varios factores tanto genéticos como medioambientales; en ellasparticipan células de la pared arterial especialmente las células endoteliales y lascélulas musculares lisas; elementos formes de la sangre (monocitos y plaquetas),proteínas del plasma incluyendo las lipoproteínas y en especial las LDL; elementos 3
  4. 4. del tejido conectivo (fibrilar y no fibrilar) y los factores mecánicos del fluidohemodinámico.La aterogénesis considerada holísticamente, es la interacción de los factores queconllevan a la injuria de la arteria y la respuesta anormal que se produce en unmedio hiperlipémico. La modulación de la respuesta está determinada por unaserie de factores y componentes que se dan en la inflamación, tales como:Citoquinas, agentes quimiotácticos y mitógenos.La placa aterosclerótica exhibe una topografía focal que sirve de evidencia parapostular la participación de la hemodinámica local tanto en su iniciación como ensu evolución31.Cómo las señales hemodinámicas son reconocidas por las células de la paredarterial y subsecuentemente son transducidas para modificar su función; es unainteresante pregunta en la fisiología de la aterogénesis. En el mismo contexto esválido preguntarse cómo los factores hemodinámicos modifican el comportamientode algunos componentes sanguíneos como monocitos, plaquetas, y lipoproteínas.El estrés provocado por los cambios de flujo hemodinámico altera la geometría delas células endoteliales, elongación celular y orientación en dirección del flujo, esmuy probable que estos cambios se reflejen in vivo y provoquen un aumento en elnúmero de receptores y la acumulación de LDL en un sitio específico de la íntima 32.Esta probabilidad ha sido explorada con células de la aorta bovina en cultivossometidos a flujos hemodinámicos variables. Es pertinente anotar que estoscambios en la geometría de las células endoteliales ocurren bajo concentracionesnormales de LDL y se hace más dramático cuando utilizan suerohipercolesterolémico.Otro cambio que se deriva de la célula endotelial modificada es la variación delsistema fosfoinosítido que incrementa la actividad de la fosfolipasa C, que produceel trifosfato de inositol (IP3), agente regulador del flujo intracelular de calcio, que asu vez provoca cambios en el citoesqueleto y en la función de los receptores. Seinduce un aumento en el contacto endotelio-macrófago que provoca un incrementoen la liberación de interleucina-1, estimula la adhesión de leucocitos al endotelio yla migración de monocitos y liberación del factor de crecimiento de las célulasmusculares lisas (SMC-CF). Una vez los monocitos han ingresado a la intimaarterial sufren diferenciación y asumen las características funcionales yestructurales de los macrófagos.Bajo condiciones fisiológicas normales, un pequeño número de monocitos esreclutado en el espacio subendotelial; allí cumplen su papel de recoger detritos paraluego catabolizarlos. En la aterogénesis, el reclutamiento de monocitos es muy altoy se convierten en una buena fuente de células espumosas. El endotelio vascularque tapiza la cara interna de los vasos sanguíneos se le considera actualmentecomo un órgano complejo que cumple funciones endocrinas, paracrinas yautocrinas; actúa como barrera semipermeable para el paso de sustancias hacialos tejidos y al estar en contacto continuo con la sangre tiene actividadesantiadherentes y de respuesta a los cambios circulatorios locales o sistémicos. 4
  5. 5. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAEl endotelio elabora diversas sustancias de capital importancia para la economíalocal y general, prostaciclina (PGI2), factor relajante del endotelio (NO), endotelina(ET), factor hiperpolarizante derivado del endotelio (EDHF) y tromboxano A 2 (TXA2).La síntesis de estos elementos está regulada principalmente por los estímulosfísicos y químicos captados por el endotelio, los estímulos celulares provenientes dela interacción del endotelio con leucocitos o plaquetas, bien directamente o porintermedio de las moléculas de adhesión (ELAM, ICAM, VCAM, GMP) 33, producenuna respuesta endotelial marcada por la liberación de citoquinas.El endotelio presenta las siguientes actividades entre otras: Transporte selectivo deagua y solutos, prevención de la adhesión de células sanguíneas a la paredvascular, producción y liberación de factores hemostáticos (factor VIII), regulaciónde lípidos (especialmente triacilglicéridos), producción y liberación de inhibidores yactivadores del crecimiento del músculo liso, activación e inactivación de sistemashormonales, síntesis y liberación de sustancias vasoactivas34.El cambio en laproducción de oxido nítrico altera la respuesta vasomotora normal de estaestructura, también se produce pérdida en la inhibición de la adhesividadplaquetaria y leucocitaria35.Las causas más frecuentes de disfunción endotelial, son consideradas tambiénfactores de riesgo para la enfermedad aterotrombótica: Diabetes mellitus,hipertensión arterial, tabaquismo, dislipidemia, turbulencia de flujo, estrés en lapared arterial y niveles elevados de homocisteina. Como factor adicional seencuentra la lipoproteína de baja densidad oxidada (LDLox), que ocasiona liberaciónde sustancias inflamatorias y quimiotácticas, a su vez producen adherencia demonocitos a la pared vascular. Una vez allí, se convierten en macrófagos que através de receptores no saturables se llenan de esas LDL oxidadas y luego encélulas espumosas, que al aglomerarse se transforman en las estrías grasas.La presencia de células espumosas, plaquetas y endotelio disfuncional estimula laliberación de factores de crecimiento que inducen la proliferación de célulasmusculares lisas y forman una cápsula lisa de núcleo lipídico, que con ayuda deltejido fibroso permite establecer de manera definitiva la placa ateromatosa. Luegovienen el crecimiento y la ruptura de la placa que es la causa directa de lossíndromes coronarios agudos. La lesión de la placa es favorecida por la presenciade factores de riesgo.El síndrome coronario se presenta en el 7% de individuos que no tienen factores deriesgo cardiovasculares conocidos, en el 17% de personas con más de un factor y enun 75% de personas con eventos isquémicos previos 36.Hipertensión arterial sistémica (HTS)Existe una clara relación entre hipertensión arterial y enfermedad coronaria, lahipertensión incrementa los eventos coronarios por daño vascular directo; además,su efecto no es solo cuantitativo, sino cualitativo, pues induce daño en órganosblanco y potencia otros factores de riesgo como el tabaquismo, la dislipidemia y ladiabetes.Basados en esta evaluación y en el nivel de presión arterial puede establecerse elriesgo del paciente. Luego se realiza una estratificación de los pacientes hipertensos 5
  6. 6. en grupos de riesgo que permite tomar las decisiones terapéuticas correspondientesy una evaluación del riesgo absoluto 37.El grupo A incluye los pacientes con presión arterial normal–alta o estados 1,2 o 3pero sin enfermedad cardiovascular, daño en órganos blanco o presencia de otrosfactores de riesgo. Las personas del grupo A con HTA de estado 1, deben controlarsu presión y modificar el estilo de vida.El grupo B incluye las personas con HTA que no tienen enfermedad cardiovascularen curso o daño en órgano blanco, pero si tienen al menos uno de los factores deriesgo que se presentan en la tabla 1, a excepción de la diabetes mellitus. A estegrupo pertenece la gran mayoría de los pacientes hipertensos.El grupo C incluye los pacientes de riesgo con hipertensión y manifestaciones deECV, con o sin factores de riesgo adicionales. Pacientes con presión arterial normalalta (tabla 2) e insuficiencia renal, insuficiencia cardiaca o diabetes mellitus debenser considerados en este grupo.Tabla 1. COMPONENTES DE RIESGO CARDIOVASCULAR PARAESTRATIFICACIÓN DE PACIENTES CON HIPERTENSIÓNFACTORES DE RIESGO MAYORESTabaquismoDislipidemiaDiabetes mellitusEdad mayor de 60 añosGénero masculinoMujeres posmenopáusicasHistoria familiar de ECVDAÑO EN ORGANO BLANCO / ECV CLÍNICA.Enfermedades cardiacas:Hipertrofia ventricular izquierdaAngina o infarto previoRevascularización coronaria previaFalla cardiacaTabla 2. CLASIFICACIÓN DE LA PRESIÓN ARTERIALCATEGORÍA SISTÓLICA (mm Hg) DIASTÓLICA (mm Hg)Optima <120 Y < 80Normal <130 Y <85Normal-alta 130-139 O 85-89Hipertensión:Estado 1 140-159 O 90-99Estado 2 160-179 O 100-109Estado 3 >180 O >110 6
  7. 7. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDASi las tensiones se ubican en diferentes categorías, a la persona siempre se leclasifica según el valor más alto. La hipertensión debe ser tratada para disminuir elriesgo de enfermedad cardiovascular y de accidente cerebrovascular.ObesidadEl índice de masa corporal (I.M.C) resulta de la división del peso en kilogramosentre la altura en metros elevada al cuadrado (kg /m2) y hoy es utilizado como basepara la clasificación de la obesidad. La tabla 3 se utiliza para la interpretación:Tabla 3. ÍNDICE DE MASA CORPORAL Y GÉNERO CATEGORÍA MUJERES HOMBRESNormal 18.3-23.8 20-25Sobre peso 24-27 25-27ObesidadGrado 1 27-30 27-30Grado 2 31-40 31-40Grado 3 >40 >40La obesidad está definida como un índice de masa corporal mayor al 120% delnormal y se acompaña de un aumento del riesgo para la enfermedad cardiovascular38.Cuando la obesidad va acompañada de otros factores metabólicos el riesgo de ECVaumenta sinergisticamente. En pacientes con resistencia periférica a la insulina, sepresentan por lo general LDL pequeñas y densas que son más aterogénicas, susHDLs son ricos en triacilglicéridos y cuentan con una capacidad catabólica para laslipoproteínas ricas en triacilglicéridos bastante disminuida, con episodios dehiperlipidemia post-prandial. Ocurre glucosilación de HDL y LDL que hace que losmacrófagos las acepten ávidamente y que se conviertan en células espumosas,elemento iniciador del proceso aterogénico.TabaquismoEl tabaquismo está relacionado al 90% de los cánceres del pulmón, tráquea, faringey lengua. Es un factor de riesgo primario en todas las enfermedadescardiovasculares y con frecuencia la isquemia de los miembros inferiores estápresente39. El uso de anticonceptivos orales en mujeres fumadoras incrementa elriesgo de infarto al miocardio, trombosis y otros desórdenes coronarios. Hammonady Garfinkel realizaron el mayor y mejor estudio que correlaciona el fumar con elinfarto y la enfermedad isquémica (358.854 hombres y 445.835 mujeresfumadoras). Ellos concluyeron que el riesgo para la enfermedad aterosclerótica estres veces mayor en fumadores y la muerte súbita está presente en fumadores conuna incidencia cuatro veces superior que en personas no fumadoras. 7
  8. 8. DiabetesEl 75% de los diabéticos fallecen por enfermedad coronaria. Austin y colaboradoresdemostraron que la presencia predominante de LDL pequeñas (subclase de LDL delfenotipo B) es un factor de riesgo para el desarrollo de diabetes mellitus nodependiente de insulina y de enfermedad arteriocoronaria en personasprediabéticas40.La ECV es la causa mayor de mortalidad en los pacientes diabéticos,particularmente en los países occidentales donde la aterosclerosis es lacomplicación más común. La aterosclerosis es generalizada y aparece antes que enel resto de la población. Se ignora la causa de esa evolución acelerada; al parecer,las lesiones ateroescleróticas se inician por acción de las lipoproteínas de bajadensidad (LDL) que se oxidan. Tanto las HDL como los antioxidantes son capaces dereducir la oxidación de las LDL, ejercen así un efecto antiaterógeno.En los pacientes diabéticos ocurre una mayor oxidación de las LDL lo que puedecolaborar con el temprano desarrollo de la enfermedad cardiovascular. Aunque laslipoproteínas suelen estar dentro de los límites normales, los niveles de HDLtienden a ser bajos, mientras que los de colesterol-LDL son normales-altos o altos.Un cociente HDL/LDL bajo favorece la aterosclerosis, posiblemente porque haymenor aclaramiento del colesterol de las arterias.La aterosclerosis produce síntomas en diversos sitios, las lesiones periféricaspueden causar claudicación intermitente, gangrena y en los varones impotenciaorgánica de origen vascular. La reparación quirúrgica de las lesiones de los grandesvasos en algunos casos fracasa debido a que la enfermedad puede haberseextendido simultáneamente a los pequeños vasos.Los factores de riesgo en la población general incluyen tabaquismo, hipertensión,hiperlipidemia, hipercoagulación, obesidad, sedentarismo, género masculino,historia familiar relacionada y tratamiento con estrógenos; mientras que en laspersonas diabéticas se considera que los factores de riesgo que juegan un papelimportante son: hiperglicemia, dislipidemia, hiperinsulinemia y proteinuria. Esinteresante resaltar que, en contraste con la población no diabética, ambos sexosestán afectados por igual. Recientemente se ha atribuido el papel más importante ala glicosilación y especialmente al estado pretrombótico causado por anormalidadesen la hemostasis41 quizá sea determinante la glucosilación no enzimática de laslipoproteínas.Las lipoproteínas son complejos macromoleculares que transportan los lípidosplasmáticos hidrófobos, en especial el colesterol y los triacilglicéridos en el plasma;su superficie está ocupada también por una familia de proteínas, las apoproteínas,que sirven de interfase adicional entre el medio lipídico y el medio acuoso42. Estasproteínas desempeñan papeles cruciales en la regulación del transporte de lípidos yel metabolismo de las lipoproteínas. Entre ellas se encuentra la apoproteína E(apoE) la cual está involucrada en la homeostasis del colesterol y varios fenotiposejercen diferente influencia en el nivel sérico, síntesis y eliminación del mismo; en laremoción de los remanentes de quilomicrones e inclusive en el riesgo deenfermedad de las arterias coronarias. 8
  9. 9. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDALa apoE se encuentra en las lipoproteínas ricas en triacilglicéridos, quilomicrones yVLDL y sus remanentes; también está presente en pequeñas cantidades en las HDL.La apoE es una glicoproteína rica en arginina y, al igual que apoB, sirve comoligando para el receptor de las lipoproteínas de baja densidad (LDL) y receptoresrelacionados; tiene un peso molecular de 34.200 Da y forma parte de laslipoproteínas con alto contenido de colesterol; en estas lipoproteínas actúa comoligando para varios tipos de receptores.La molécula de apoE ubicada sobre la superficie de los remantes de QM y de las IDLes el ligando que determina la depuración mediada por receptores de estaspartículas. Tres tipos de receptores pueden interactuar con apoE: el receptor deIDL; la proteína relacionada con el receptor de LDL (LRP), la cual también actúacomo receptor de alfa 2-macroglobulina; y el proteoglicano heparan sulfato (HSPG),recientemente postulado como receptor para estas lipoproteínas 43ApoE participa en la distribución de los lípidos entre los diferentes órganos delcuerpo por su asociación a VLDL y quilomicrones. Aunque, como ya se dijo, lamayor tasa de síntesis se presenta en el hígado, también es sintetizada por cerebro;en este órgano se ha encontrado que las células encargadas de su síntesis son losastrocitos y las células de la microglia. ApoE es la principal apoproteína encontradaen cerebro y liquido cefalorraquídeo, por esto se piensa que participa en lamovilización y distribución de lípidos durante el normal desarrollo del sistemanervioso y en la regeneración de nervios periféricos después de su lesión.Existen tres alelos de apoE denominados e4, e3 y e2 que difieren uno de otro poruna unidad de carga neta debida a la sustitución de un único par de bases y doscodones en los cuatro exones del gen de apoE en el brazo largo del cromosoma 19.En consecuencia, pueden ser detectados seis fenotipos de apoE en el plasma: apoE2/2, E3/2, E3/3, E4/2, E4/3, E4/4, los cuales difieren por la sustitución deaminoácidos en uno o ambos sitios (residuos 112 y 158).Las isoformas de apoE también difieren en su interacción con el receptor de LDL.Mientras que apoE3 y apoE4 se unen normalmente, apoE2 presentaaproximadamente el 2% de la capacidad normal de unión. Esta unión defectuosaestá asociada con una dislipidemia conocida como hiperlipoproteinemia tipo III,entidad que cursa con niveles elevados de colesterol y triglicéridos y con una mayorpropensión a padecer enfermedad cardiovascular 44.En estudios realizados con variaciones de dieta en niños se ha comprobado que elfenotipo de apoE tiene varias implicaciones clínicas; el grupo E2 se asocia con unabaja concentración y el grupo 4 con una alta concentración de colesterol LDL sérico.Además el grupo E4 en comparación con el grupo E2 presenta mayor eficiencia enla absorción del colesterol y menor nivel de síntesis de colesterol y remoción deapoB de LDL. A causa de las diferentes afinidades de apoE4 y apoE2 al receptor deLDL y a los receptores proteicos relacionados, el nivel de aclaración de losremanentes de las lipoproteínas se mostró bajo en sujetos con el fenotipo apoE2/2y alta en los del fenotipo 4/4. Según estos datos los sujetos del grupo E4, encomparación con los del grupo E2, responden generalmente, mas no siempre, amodificaciones del colesterol en la dieta45. 9
  10. 10. Además de la asociación con los niveles de colesterol, la variabilidad de apoE hasido relacionada con un extenso grupo de factores metabólicos implicados en laresistencia a la insulina. Algunos autores sugieren que la variación en el gen deapoE puede ser un factor relacionado con la hipertrigliceridemia y la insuficienciarenal presente en pacientes con NIDDM y que la presencia de apoE2 puede agravarlas anormalidades lipídicas en NIDDM con falla renal.En un estudio para apoE2 en pacientes diabéticos tipo 1 y 2 con hiperlipidemiaspersistentes se concluyó que a pesar de encontrarse irregularidades similares, estasson inducidas por heterocigotos en la diabetes insulinodependiente y porhomocigotos en NIDDM. Otros reportes señalan que los fenotipos E4/4 y E4/3modulan el riesgo de enfermedad coronaria en hombres con NIDDM, también hayquienes han encontrado relación entre la ECV y apoE4 en sujetos no diabéticospero no en individuos con NIDDM e inclusive en algunos grupos de estudio no seha logrado establecer una relación entre el polimorfismo de apoE y lahipertrigliceridemia en pacientes con NIDDM 46.Lo anterior nos da una imagen del interés que ha suscitado apoE como factor deriesgo cardiovascular en la NIDDM, sugiere una etiología multifactorial de laexpresión de las complicaciones CVs y muestra diferencias sustanciales en distintaspoblaciones; lo cual da pie a futuras investigaciones para determinar el conjunto defactores que asocian a apoE con las alteraciones cardiovasculares en NIDDM.Algunos autores sostienen que el descenso en los índices de mortalidad porenfermedad coronaria se debe fundamentalmente a las medidas higiénico-dietéticasbien conducidas, tales como la dieta controlada, abandono del hábito del cigarrillo,la reducción del peso corporal y el control de la presión arterial.RETENCIÓN Y AGREGACIÓN DE LIPOPROTEÍNASNo se conocen con exactitud los mecanismos que dan lugar a la retención delipoproteínas, pero el tejido conectivo (colágeno, elastina, glicosaminoglicanos yproteoglicanos) sintetizado por las células musculares lisas del tejido vascular(CMLV), parece desempeñar un papel muy importante. La LDL que ha interactuadocon los glicosaminoglicanos cuando se disocia presenta numerosas modificacionesestructurales, como exposición de residuos de lisina anteriormente no expuestosque dan lugar a mayor susceptibilidad a proteólisis y a oxidación. También se hademostrado que la lipoproteinlipasa forma puentes entre LDL y ciertosglicosaminoglicanos como el heparán sulfato lo que facilita la retención de la LDL eimpide su salida del tejido vascular.La esfingomielinasa también incrementaría la asociación de LDL conglicosaminoglicanos mediada por lipoproteinlipasa. Los agregados están organizadosen gotitas lipídicas que se componen de lípido neutro, colesterol libre y fosfolípidos.Estos hallazgos dieron lugar a la teoría de que el núcleo lipídico hallado en laslesiones ateroscleróticas podría formarse sin intervención celular (hipótesis de ladeposición extracelular de lípido en la aterosclerosis). Otros resultados apoyan estateoría ya que los ácidos grasos del colesterol esterificado encontrado en el núcleolipídico de la placa fibrosa son similares a los encontrados formando parte de lasLDL plasmáticas. Queda sin embargo por descubrir qué estímulos dan origen a la 10
  11. 11. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAagregación de la LDL en la pared vascular. Se sabe que la LDL oxidada pormieloperoxidasa, así como el hipoclorito generado por la actuación de esta enzima,inducen la agregación de LDL. La esfingomielinasa también puede dar lugar a laagregación de LDL in vivo47.OXIDACIÓN DE LA LDLDiferentes mecanismos podrían conducir a la oxidación de la LDL. Uno de ellossería por medio de la enzima mieloperoxidasa que se expresa en los macrófagospresentes en las lesiones ateroscleróticas. Otro sería la glicosilación, ya que laglucosa promovería la oxidación acelerada de la LDL. La mayor parte de laspartículas de LDL aisladas de lesiones humanas son mínimamente oxidadas ypresentan muchas propiedades aterogénicas, entre ellas el reclutamiento demonocitos en sitios específicos de la pared arterial y su diferenciación enmacrófagos.Recientemente se ha descrito que el componente biológicamente activo en la LDLmínimamente oxidada posee las mismas características que el factor activador deplaquetas (FAP))48. La oxidación de las LDL mínimamente oxidadas hasta una formareconocida por los receptores “basureros” (scavenger) de los macrófagos es un pasoregulador de la formación de células espumosas. El grado de oxidación de la LDLresultaría del balance entre las propiedades oxidantes y las antioxidantes de lapared arterial.El óxido nítrico producido básicamente por las células endoteliales desempeña unpapel muy importante en el mantenimiento del tono vascular y puede suprimir laoxidación de lipoproteínas. En las arterias normales existe suficiente óxido nítricocomo para impedir la oxidación lipoproteica. En condiciones de hipercolesterolemiao en las lesiones ateroscleróticas, la síntesis de óxido nítrico es normal o inclusoelevada, pero una proporción muy importante de este óxido nítrico puede serconsumido por un exceso de radicales superóxido. A su vez, la LDL oxidada puededisminuir las concentraciones de óxido nítrico, por lo que existe menos óxido nítricopara proteger la LDL que entra en la pared.Influencia de ApoE sobre los niveles de LDLLos niveles de colesterol-LDL pueden estar influenciados por una variación del genpara apo E. En humanos este gen tiene una longitud de 3,7 Kb y está localizadosobre el cromosoma 19 q13. El gen tiene cuatro exones, tres intrones y los codonespara el polipéptido apo E que incluye un péptido señal de 18 aminoácidos y unaproteína madura de 299 aminoácidos.Apo E es producida principalmente por el hígado, aunque virtualmente todos lostejidos hacen pequeñas cantidades de esta proteína. La molécula de apo E ubicadasobre la superficie de los remanentes de QM y de las IDL es el ligando que gobiernala depuración, mediada por receptores, de estas partículas. Los tres alelos comunesy sus frecuencias son: e4, 15%; e3, 77%; y e2, 8%. Estos producen seis fenotiposcomunes con las siguientes frecuencias: E4/4, 2%; E3/3, 59%; E2/2, 1%; E4/3,23% E372, 12%; y E4/2, 2% según estudios realizados en una muestra poblacionalAlemana49. En la población turca el alelo e3 se presenta con una frecuencia del86% y la frecuencia encontrada para cada uno de los fenotipos es de 1.1% paraE4/4, 12.9% para E4/3, 74.2% para E3/3, 10.6% para E3/2, 0.4% para E2/2 y 11
  12. 12. 0.8% para E4/2. Si se toma el alelo más común, e3, como tipo silvestre, el alelo e4representa una mutación a nivel del aminoácido 112, cisteína que cambia porarginina. e2 resulta de la mutación en el aminoácido 158, arginina cambia porcisteína. La mutación e2 produce una proteína con solo el 2% de la actividad deunión al receptor mostrada por e4 y e3. En las poblaciones estudiadas se hanotado que los individuos con el fenotipo E4/3 tiene niveles de colesterol de 5 a 10mg/dl más altos que personas con el fenotipo E3/3; y aquellos con el fenotipo E3/2tienen niveles de colesterol entre 10 y 20 mg/dl más bajos, comparados con los quepresenta el fenotipo E3/3. La razón exacta para estas diferencias es incierta, peropueden existir dos mecanismos posibles:1) La depuración hepática de la grasa dietaria en la forma de remanentes de QM es más rápida en personas con el fenotipo E4/3 y más lenta en el fenotipo E3/2 comparadas en el fenotipo de E3/3. Esto podría afectar el contenido de lípidos hepáticos y ser la causa por la cual los individuos con el fenotipo E4/3 presentan niveles más bajos de receptores para LDL en hígado con niveles más altos de colesterol-LDL en plasma y, además, que personas con el fenotipo E3/2 presenten niveles más altos de receptores LDL en hígado, acompañados de niveles más bajos de colesterol LDL en plasma.2) Ensayos in vitro sugieren que apo E es necesaria para la conversión eficiente de IDL en LDL y que, en este sentido, e3 funciona mejor que e2. Sí este fenómeno se presenta in vivo, los individuos con el alelo e2 formarán LDL a partir de IDL con más lentitud, lo que conduciría a niveles más bajos de esta partícula en el plasma. Recientemente se ha reportado una asociación entre fenotipo E3/2 y aterosclerosis de las arterias carótidas. Esta observación se explica por un empeoramiento del catabolismo terminal de los remanentes del lipoproteínas, lo que a su vez se debe a la presencia de la isoforma apo e2 funcionalmente defectuosa50.Mutación apo B3500Otro de los factores genéticos que está asociado con niveles elevados de colesterol yLDL, es un tipo de anormalidad a nivel del gen para apo B que se presenta en eldesorden autosómico dominante llamado defecto familiar de apo B-100. La causade este desorden es una mutación en la secuencia de codones para el gen de apo B,la cual cambia el codón CGG para el aminoácido 3500, que es arginina por el codónCAG que corresponde a la glutamina. La mutación se da en la región de unión alreceptor LDL y en consecuencia el resultado es una proteína con una actividad deunión al receptor de sólo un 2 a 4% de lo normal. El nivel plasmático de LDL seincrementa cuando se interrumpe el catabolismo de esta partícula mediado por sureceptor. Los individuos afectados tienen niveles de colesterol –LDL entre 60 a 80mg/dl más altos, comparados con el de los miembros de la familia no afectados.La mutación apo B3500 ha sido identificada en poblaciones de Estados Unidos,Canadá y Europa, donde se estimó que ocurre con frecuencia de aproximadamente1/50051. También se ha reportado que está difundida en la población caucásicadonde su frecuencia ha sido estimada en el rango de 1/700 a 1/500 sin embargo,en un estudio realizado por Mahley y Col.(49) en la población turca con 1.063individuos hipercolesterolémicos y 1.387 individuos de la población general no sedetectó esta mutación 12
  13. 13. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO II JUSTIFICACIÓN Y OBJETIVOSLa cardiopatía coronaria, la insuficiencia cardiovascular y la enfermedad oclusivaarterial periférica; todas ellas manifestaciones clínicas de la aterosclerosis son laprimera causa de muerte en los países industrializados. En Colombia sigue siendoel homicidio y las lesiones infligidas intencionalmente por otra persona la primeracausa de muerte en la población comprendida entre 5 y 44 años, pero en lapoblación mayor de 44 años la primera causa de muerte es la enfermedadisquémica del corazón. A pesar de todos los esfuerzos llevados a cabo paradisminuir la violencia en nuestro país, ésta va en aumento según el InstitutoNacional de Salud (INS).La principal causa de muerte no violenta es la aterosclerosis y su incidenciaaumenta año tras año. Según las estadísticas del DANE el infarto agudo delmiocardio fue la causa del 5% del total de defunciones en 1.970, del 6.8% en 1975 ydel 9.8% en 1.988. En 1992, en el grupo de 45 a 64 años de edad, la enfermedadisquémica del corazón fue responsable del 13.0% de las muertes.Este aumento en la mortalidad por la enfermedad cardiovascular tiene variasexplicaciones. La principal de ellas es el cambio de estilo de vida del hombrecolombiano, pues en los últimos 50 años Colombia pasó de ser un país rural a unpaís urbano. La transformación trajo consigo el aumento en los factores de riesgopara la enfermedad arteriocoronaria: Cambio en la dieta, la tendencia alsedentarísmo, el incremento en el estrés, aumento en el consumo de alcohol y ladisminución de la actividad física. De hecho la población urbana representaba en1951 el 39%, mientras que en 1985 representa el 67%, con una tendencia alaumento por la migración del campesino hacia los cordones de miseria de lasgrandes ciudades, ocasionada por la violencia. Por otra parte, la pirámidepoblacional, al igual que en todo el mundo civilizado (excepto la culturaMusulmana), está cambiando al reducir la base infantil y aumentar en los gruposde mediana y mayor edad. La proporción de la población colombiana mayor de 30años se incrementó del 28 al 35% entre 1964 y 1985.Es preciso señalar que Colombia tiende a comportarse desde el punto de vistaepidemiológico igual que los países desarrollados. Si hubiese una pacificación delpaís, la enfermedad aterosclerótica sería de lejos la primera causa demorbimortalidad y tendríamos que enfrentarnos al flagelo sin conocer susprincipales causas, ni el comportamiento genético poblacional y con una granignorancia de nuestros ciudadanos en torno al tema.En los países desarrollados se han emprendido campañas de educación sobre elcolesterol y prevención de la enfermedad. Esta campaña ha rendido sus frutos, seha disminuido la muerte por cardiopatia coronaria y poblaciones sensibilizadas handisminuido los niveles de colesterol, colesterol LDL y triaciglicéridos, mientras quehan aumentado los niveles de colesterol HDL. 13
  14. 14. Recientes estudios prueban que incluso una reducción leve de los nivelessanguíneos de colesterol disminuye el riesgo de muerte en pacientes conenfermedad arteriocoronaria establecida. La disminución de la enfermedadarteriocoronaria en los EEUU se correlacionó con la disminución de los niveles decolesterol sanguíneo en la población durante los últimos 5 años, lo que se debe enparte a la vigorosa campaña de salud pública emprendida.Existen otros factores de riesgo como la edad, el género masculino, la diabetesmellitus, la obesidad, el sedentarismo, la historia familiar de las enfermedadescardiovasculares, altos niveles de lipoproteína [a], presencia de las isoformas de laapoproteínas E2 en quilomicrones y las lipoproteínas de muy baja densidad (VLDL),que, aunque son secundarios, no dejan de ser importantes. Estos factores de riesgose dividen en modificables y no modificables. De estos últimos, la edad es un factorde riesgo ya que la aterosclerosis aparece después de muchos años de formación delas placas ateromatosas. El sexo masculino es un factor importante de riesgo. Sedesconoce la causa, pero los hombres desarrollan aterosclerosis con una mayorfrecuencia que las mujeres. Algunos individuos presentan una predisposiciónheredada a padecer aterosclerosis.Los reportes de datos epidemiológicos en el ámbito internacional muestran unaasociación estadísticamente significativa entre varios constituyentes de la dieta y latasa de mortalidad por la enfermedad arteriocoronaria. Se toma como punto departida los datos recogidos en 22 países, publicados en un reporte de laOrganización Mundial de la Salud. Entre los nutrientes encontrados quecorrelacionan positivamente con la enfermedad cardiovascular se incluyen grasasaturada, colesterol y calorías. Otro factor dietario que induce aterosclerosis es elalto consumo de sal que genera hipertensión en personas genéticamentesusceptibles.Ya que uno de los factores de riesgo no modificables es la edad, se debe detectar elriesgo de padecer la enfermedad lo más temprano posible, con el fin de tratar decambiar aquellos factores modificables que estimulan la aparición de la enfermedad.En Colombia no hay estudios que permitan establecer el riesgo de la población depadecer la enfermedad aterosclerótica. Tampoco hay estudios genéticos queestablezcan la incidencia de factores como la mutación de la apoproteína B-100 o lapresencia de las isoformas tipo2 de la Apo E. Conocer la predisposición genética apadecer la enfermedad es importante para el médico, ya que un hombre cuyospadres desarrollaron la enfermedad aterosclerótica antes de los 60 años enfrenta unriesgo 5 veces mayor que aquel cuyos padres no desarrollaron la enfermedad. Lahistoria familiar de una persona, al tiempo que sirve para determinar su riesgo, esmuy importante en la motivación de los pacientes para que acepten los cambios ensu estilo de vida y prevengan la aparición de la enfermedad.Entre los factores de riesgo modificables, la hipercolesterolemia sigue siendo el másimportante, particularmente el colesterol encontrado en la subfracción de las LDL.Varias investigaciones realizadas en los Estados Unidos han demostrado un mayorriesgo a padecer enfermedades arteriocoronarias con el aumento de los niveles decolesterol. En los países industrializados un alto porcentaje de la población tiene 14
  15. 15. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAniveles elevados de colesterol, especialmente en la subfracción de lipoproteínas debaja densidad, significa que muchas personas se encuentran en un alto riesgo depadecer la enfermedad arteriocoronaria.Para el Departamento de Risaralda y en particular para la ciudad de Pereira no hay,hasta el momento, datos concluyentes que nos permitan determinar el grado deriesgo de su población. Cediel V. y Rodríguez J. valoraron una muestra de 585voluntarios aparentemente sanos de la ciudad de Pereira que no conocían su perfillipídico. Encontraron que el 41.1% de este grupo presentó niveles de colesterolsuperior a 200 mg/dl y el 15% presentó niveles superiores a 240 mg/dl lo cualconstituye una cifra altamente preocupante. Los resultados obtenidos se asemejana los encontrados en las poblaciones de países desarrollados. En este estudio esimportante resaltar los altos niveles de colesterol transportados por la subfracciónLDL en las personas con colesterol superior a 240 mg/dl. el valor promedioencontrado fue de 172.4 mg/dl, que está muy por encima del valor recomendadointernacionalmente que es de 130 mg/dl.En los últimos años se han logrado adelantos importantes en el estudio ytratamientos de la aterosclerosis en los que se destaca la importancia de prevenir omodificar los factores de riesgo. Se ha entendido que la reducción del riesgomediante modificaciones en los hábitos higiénico-dietético es un hecho cierto.Estudios realizados mediante arteriografías han demostrado la regresión de laslesiones ateromatosas en los vasos coronarios mediante la complementación de unadieta y ejercicio adecuados. La prevención primaria es la campaña ideal, y losobjetivos de dicha campaña deben conducir a la reducción del sobrepeso, a lareducción del consumo de cigarrillos; a la modificación de hábitos dietarios asícomo también, a la disminución del consumo de sal en las comidas. 15
  16. 16. Objetivos generales1- Determinar la prevalencia de los factores de riesgo para eldesarrollo de la enfermedad aterosclerótica en la población delDepartamento del Risaralda.2- Comparar la frecuencia y la severidad de los factores de riesgo parala enfermedad aterosclerótica por género y su variación con la edad. Objetivos específicos1- Hacer una evaluación de los lípidos sanguíneos en la población de Risaralda, incluyendo colesterol total, colesterol LDL, colesterol HDL y triglicéridos.2- Determinar la presencia y frecuencia de la mutación Arg 3500 Gln de Apo B en la población de Risaralda3- Determinar la frecuencia de la presencia de los alelos e2, e3, e4, de Apo E y los genotipo E 4/4, E 3/3. E 2/2. E 3/2, y E 4/2 en la población de Risaralda4- Determinar la prevalencia de la hipertensión arterial en la población de Risaralda. 16
  17. 17. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO III MATERIALES Y MÉTODOSTipo de estudioEste es un estudio de tipo descriptivo que pretende cuantificar la prevalencia yseveridad de algunos factores de riesgo cardiovascular en la población deldepartamento de Risaralda.Población universoSe consideró la población del departamento de Risaralda.Población muestralEl estudio incluye personas mayores de 14 años de edad. Se realizó un muestreoestratificado multietápico basado en el aporte porcentual según la pirámidepoblacional establecida por el censo de 1993. Según el DANE la poblaciónproyectada a 1997 es de 905.780 habitantes, distribuidos de la siguiente manera:Población Urbana 678.797 74.9%Población Rural 226.983 25.1%Hombres 445.552 49.2%Mujeres 460.228 50.8%Población Menor de 15 años 288.674 31.8%Población Mayor de 15 años 617.106 68.2%Las unidades primarias fueron definidas por las condiciones de distribución de lapoblación en el área metropolitana y en los demás municipios.Características de la selección de la muestra- Aleatoria, estratificada, bietápica.- Nivel de confianza del 95%- Error máximo permisible del 10%- Proporción del evento a estudiar del 12.3%.Se tomó el 12.3%, porque a pesar de que en diferentes estudios realizados en elmundo este porcentaje es variable, los estudios hechos para Colombia no estánconsolidados y se considera la prevalencia más conservadora posible.La muestra se tomó en forma estratificada teniendo en cuenta la edad, el sexo y suestrato socioeconómico, definido previamente por la clasificación del barrio realizadapor las empresas públicas del municipio correspondiente. En el área rural no setomó en cuenta el estrato social, así como en los municipios donde tal clasificaciónno se ha realizado.Tamaño de la muestraSe escogió una muestra de tamaño n=782 y se extendió a 1050 encuestas paraprever deserciones en la toma de la muestra sanguínea. 17
  18. 18. VariablesLas variables del estudio fueron: Edad: Medida en años cumplidos (variable cuantitativa continua) Sexo: Masculino, femenino (variable categórica) Lugar de residencia: Predominantemente rural o urbano (variable categórica) Estatus de migrante: Últimos dos años en el mismo lugar de residencia (variable categórica). Ocupación: Clasificada por el propio entrevistado (variable categórica) Logros educativos: Ninguno, primaria, secundaria, universitaria, otros- tecnológico. ( variable categórica ordenada). Antecedentes personales de salud: Presencia o ausencia de enfermedades como diabetes, hipertensión arterial, infarto al corazón, accidente cerebrovascular. ( variables categóricas) Hábito de fumar: Si fuma, es exfumador o no fuma (variable categórica ordenada). La duración del hábito (variable cuantitativa continua). Intensidad en cigarrillos por día (variable cuantitativa discreta). Consumo de alcohol: Frecuencia con la que consume alcohol: no consumidor regular, consumidor semanal o consumidor diario (variable categórica ordenada) y la cantidad consumida en mililitros (variable cuantitativa continua). Auto - percepción del estado de salud: excelente, buena, regular, mala y muy mala (variable categórica ordenada) Actividad física: Realiza regularmente actividad física durante la semana por fuera de su actividad laboral (variable categórica) Antecedentes familiares de salud: Si algún familiar padece de diabetes, hipertensión arterial, infarto al corazón, accidente cerebrovascular, identificando el grado de parentesco (Variable categórica), o ha fallecido de alguna de estas enfermedades (variable categórica). Edad a la cual ha fallecido el familiar (variable cuantitativa continua) Peso: En kilogramos, ajustado a un decimal (variable cuantitativa continua). Talla: En metros, ajustado a dos cifras decimales (variable cuantitativa continua). Índice de masa corporal: En Kg de peso por metro cuadrado de talla (variable cuantitativa continua). Tensión arterial sistólica: En mm de Hg (variable cuantitativa continua). Tensión arterial diastólica: En mm de Hg (variable cuantitativa continua). Relación cintura/cadera: Perímetro de la cintura sobre el de la cadera en cm. Se ajustó a dos cifras decimales (variable cuantitativa continua). Colesterol total: Concentración plasmática de colesterol medida en mg/dl después de un ayuno de doce horas (variable cuantitativa continua). Colesterol – LDL: Concentración plasmática de colesterol en mg/dl, calculado por la fórmula de Friedwald (variable cuantitativa continua). Colesterol – HDL: Concentración plasmática de colesterol- HDL medido en mg/ dl después de un ayuno de doce horas (variable cuantitativa continua). Triacilglicéridos: Concentración plasmática de triacilglicéridos, medido en mg/dl después de un ayuno de doce horas (variable cuantitativa continua). Glicemia en ayunas: Concentración plasmática de glucosa, medida en mg/dl después de un ayuno de doce horas (variable cuantitativa continua) 18
  19. 19. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA Genotipo de apo E: isoforma correspondiente : E4/4, E3/3, E2/2, E3/2, E4/2, E4/3 (variable categórica). Mutación apo3500: Presencia o ausencia de la mutación (variable categórica)Plan de análisis estadísticoLos resultados de la presente investigación fueron analizados utilizando el programaEpi Info versión 6.04. La prevalencia de las variables categóricas seleccionadas y elnivel promedio de las variables continuas fueron calculadas utilizando el mismoprograma. La significación estadística de las diferencias entre los promedios de losniveles de lípidos distribuidos entre los subgrupos establecidos, fue determinadautilizando el ANOVA para variables con distribución normal y el KRUSKAL- WALLISpara las variables que no presentaron distribución normal.El análisis bivariado se realizó utilizando los cruces de variables en tablas de dospor dos, empleando la prueba de chi2 con un nivel de significancia del 95% comomedia de asociación entre las alteraciones del perfil lipídico y los diferentes factoresde riesgo estudiados. Para variables continuas se utilizaron métodos de correlacióny regresión que evalúan la colinearidad de las variables y establece la magnitud delas asociaciones, particularmente con la variable edad.Muestra de sangreDe cada uno de los participantes en el estudio se obtuvo una muestra de 7 mL desangre venosa, bajo consentimiento previamente firmado, en tubos vacutainerpreparados con EDTA para dar una concentración final del anticoagulante del 0.1%.La muestra se obtuvo siempre al nivel de la fosa cubital bajo condiciones de reposoy después de un ayuno de 12 horas. La sangre fue centrifugada a 3.000 x gdurante 10 minutos para separar el plasma y el paquete de células blancasdestinadas al aislamiento del ADN.El plasma se utilizó para la determinación de los parámetros sanguíneos propuestosen la presente investigación. Se utilizaron métodos enzimáticos e inmunológicos yse realizaron periódicamente curvas de calibración para valorar la estabilidad de losreactivos y cada una de las pruebas se hizo por duplicado, los resultadospresentados son el promedio de dichos duplicados.Parámetros sanguíneos Determinación del colesterol totalSe utilizó el método enzimático que utiliza la enzima colesterol esterasa parahidrolizar los ésteres de colesterol y luego el colesterol libre es oxidado acolestenona por la enzima colesterol oxidasa con liberación de peróxido dehidrógeno. Este último sirve de sustrato para que la enzima peroxidasa forme uncomplejo coloreado con la 4-aminofenazona y el fenol que absorbe a una longitud deonda de 500 nanómetros. Lo anterior se ilustra mediante las siguientes ecuaciones.Esteres de colesterol + agua  Colesterol + ácido grasoColesterol + O2  Colestenona + H2O22H2O2 + 4-aminofenazona + fenol  4-(p-benzoquinonamonoiminofenazona) + 4H2O 19
  20. 20.  Determinación de colesterol – HDLLos quilomicrones, las lipoproteínas de muy baja densidad y las lipoproteínas debaja densidad que se encuentran en el plasma precipitan en presencia de cloruro demagnesio y ácido fosfotúngstico. Después de centrifugar a 10.000 x g por 20minutos, se determina la concentración de colesterol en el sobrenadante por elmétodo enzimático. Determinación de triacilglicéridosLos triacilglicéridos son hidrolizados por la enzima triacilglicérido lipasa y liberanglicerol que a su vez es convertido en glicerol – 3- fosfato por la glicerolcinasa, laoxidación de este compuesto por la enzima glicerol fosfato oxidasa forma peróxidode hidrógeno que forma un complejo coloreado con la 4 – aminofenazona y elclorofenol en presencia de peroxidasa. Dicho complejo absorbe a una longitud deonda de 500 nm. La secuencia de reacciones es la siguiente:Triacilglicérido + 3 H2O  glicerol +3 RCOOHGlicerol + ATP  glicerol –3- fosfato + ADPGlicerol –3- fosfato + O2 dihidroxiacetonafosfato + H2O2H2O2 + 4-aminofenazona + 4-clorofenol  4-(p-benzoquinonamonoimino) fenazona +H2O + HCl Determinación del colesterol – LDL Para el calculo de la concentración de colesterol se utilizó el algoritmo de Friedwald: C-LDL = CT – C-HDL – TAG/5 Determinación de glucosaLa determinación de glucosa se realizó por el método de la glucosa oxidasa. Laglucosa es oxidada a ácido glucónico por la glucosa oxidasa. En dicha reacción seproduce peróxido de hidrógeno el cual forma un complejo con la 4- aminofenazona yfenol para formar un complejo coloreado en presencia de la enzima peroxidasa. Estecomplejo absorbe a una longitud de 510 nmPruebas de genética molecular Extracción de ADNEl ADN fue preparado a partir de un volumen de células de 0.5 mL separado en untubo eppendorf inmediatamente después de retirar el plasma. Se añadió un mL desolución salina – citrato 1x(0,15M NaCl, 15mM citrato trisódico) y después demezclar se centrifugó durante un minuto a 14.000 x g.Se removió el sobrenadante y se repitió una vez más esta etapa de lavado. Lascélulas se resuspendieron con 0,375 mL de acetato de sodio 0,2 M a pH 7,0 y setrataron con 10 microlitros de una solución de proteinasa K al 1% en Tris 10mM,pH 8,0 y 25 microlitros de dodecil sulfato sódico al 10%. Se incubó durante lanoche a 56 °C. Luego se hizo extracción dos veces con 0,120 mL de fenol/cloroformo(25:1) y una vez con 120 microlitros de cloroformo/alcohol isoamílico (24:1). ElADN fue precipitado de la fase acuosa con etanol y luego se resuspendió con 0,1mLde amortiguador TE 1x. De esta preparación se tomaron 5 microlitros para 20
  21. 21. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAestablecer su calidad y concentración aproximada por electroforésis en agarosa al1%. Finalmente se almacenó a –20°C hasta el momento de ser utilizado. Detección de la mutación apoB3500Para la determinación de la mutación apoB 3500 (CGG CAG) un segmento del genpara la apo B fue amplificado por la reacción en cadena de la polimerasa (PCR) y elADN fue digerido por la enzima de restricción Msp 1 según el método descrito porHansen y col.(61). Para la amplificación fueron utilizados los siguientesoligonucleótidos como iniciadores:1. 5´- CCAACACTTACTTGAATTCCAAGAGCACCC – 3´ 10,628 – 10,6572. 5´- CTGTGCTCCCAGAGGGAATATATGGCGTTGG-3´ 10,776 – 10,747 El oligonucleótido 1 termina en la base que precede a la mutación (posición 10,657). Se utiliza porque genera un sitio de clivaje para la endocucleasa Msp I cuando la primera base incorporada por extensión es una guanina (G) (tipo salvaje). Por el contrario la incorporación de una adenina (A) (mutante) no crea el sitio de reconocimiento para Msp I.La PCR se efectuó utilizando el siguiente ciclo de temperaturas: desnaturalización a94°C durante un minuto, ligamiento de los iniciadores a 58°C durante un minuto,extensión de los iniciadores a 74°C durante cuatro minutos. El número de ciclos fuede 40. Se utilizó ADN polimerasa de Thermus aquaticus a una concentración de 20U/mL. La reacción se llevó a cabo en un volumen total de 100 microlitros, quecontenia 20 nmoles de dCTP, dGTP, dATP y TTP, 0,01mL de amortiguador deamplificación (amortiguador de amplificación 10X: KCl 500 mM, Tris-HCl 100mM,MgCl2 15mM, gelatina 0.1% w/v, pH 8,3), 2x10-7 gramos (22pmol) de cada iniciadory entre 0,2 y 0,4 microgramos de ADN genómico.El rendimiento de la amplificación fue determinado por electroforesis en gel deagarosa al 3% de 10 microlitros de la mezcla de reacción final. El gel de agarosa fuepreparado con bromuro de etidio a una concentración de 1mg/L. El ADN sevisualizó en un transiluminador UV.La digestión se realizó con 10 Unidades de Msp I a un volumen de 0,03mL delamplificado en amortiguador 1X de baja concentración salina (amortiguador 10X debaja concentración salina: Tris-HCl 10 mM, MgCl2 10mM, ditiotreitol 1mM, pH 7,5).Luego se incubó durante una noche a 37°C. Los productos de amplificación y clivajefueron analizados por electroforesis en gel de poliacrilamida al 12% a 200 Vdurante 2 horas. Seguidamente los geles se tiñeron con bromuro de etidio ensolución (1mg/L) durante 5 minutos. Los fragmentos de ADN fueron visualizados enun transiluminador UV. Se utilizó como marcador de peso molecular pUC18digerido con Msp I. Detección del genotipo para apolipoproteína ELa tipificación de la apolipoproeína E se realizó con todas las muestras de ADNcongeladas para tal fin. El genotipo para apo E se estableció mediante amplificación 21
  22. 22. de un fragmento del gen de apo E por PCR y clivaje del ADN obtenido con la enzimade restricción Hha I tal como lo describen Hixson y Vernier52.Los oligonucleótidos que se utilizaron como iniciadores fueron:F4: 5´-ACAGAATTCGCC CCGGCCTGGTACAC-3´F6: 5´-TAAGCTTGGCACGGCTGTCCAAGGA-3´Además del amortiguador de amplificación descrito anteriormente cada reacción deamplificación contenía 1 ug de ADN de leucocitos, 1 pmol/uL de cada iniciador,dimetil sulfóxido al 10% 0,05 unidades /uL de Taq polimerasa en un volumen finalde 60 uL. Cada mezcla de reacción se calentó a 95°C durante 5 minutos paradesnaturalización del ADN y fue sometida luego a 35 ciclos de amplificación contemperaturas de ligamiento del iniciador de 60°C durante un minuto, extensión a70°C durante dos minutos y desnaturalización de 95°C durante un minuto.Después de la amplificación por PCR se añadió directamente a cada mezcla dereacción 5 unidades de Hha I para la digestión de las secuencias de apo E y seincubó a 37°C por tres horas. Cada mezcla de reacción fue sometida a electroforesisno desnaturalizante en un gel de poliacrilamida al 8% de 1.5 mm de espesor por 20cm de largo. Se trabajó con una diferencia de potencial constante de 210 V durantecuatro horas. Se utilizó como marcador de peso molecular pUC 18 digerido conMspI después de la electroforesis el gel fue tratado con bromuro de etidio (1mg/L)durante cinco minutos y los fragmentos de ADN fueron visualizados con untransiluminador UV.Presión arterialLa presión arterial fue medida de acuerdo con el protocolo aprobado por elMinisterio de Salud y el Programa de Control de la Hipertensión Arterial (manual denormas técnico-administrativas del Ministerio de Salud).Para la medición de la presión se utilizaron tensiómetros de mercurio. Se hicierontres mediciones de presión arterial después de 15 minutos de reposo y se registró elpromedio de las dos últimas para evitar sesgos. 22
  23. 23. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO IV RESULTADOSCaracterísticas generales de la población estudiada.El Departamento de Risaralda formó parte del Departamento de Caldas desde 1905hasta 1967, cuando surgió como entidad territorial independiente. La comunidadde Risaralda está aún en proceso de formación e integración.Es importante anotar que los Antioqueños jugaron un papel primordial en elpoblamiento de la región y que hoy en día está recibiendo un aporte importante dela raza negra, sobre todo en el corregimiento de Santa Cecilia en Pueblo Rico y en elMunicipio de la Virginia.Una de las preguntas realizadas en la encuesta sobre el lugar de nacimiento nospermite tener una idea de la migración hacia el Departamento de Risaralda en losúltimos años. En la tabla 1, se presenta el aporte de las regiones a la muestrapoblacional. Nótese que los Departamentos de Antioquia, Caldas, Risaralda,Quindio y Valle son los principales aportantes a la muestra, por tal motivoconsideramos que esta población es paisa con los rasgos culturales que lacaracterizan. El Chocó hace un aporte del 7.0% pero es muy localizado en elMunicipio de Pueblo Rico.Tabla 1. NACIMIENTO POR DEPARTAMENTO EN LA MUESTRA ESTUDIADADEPARTAMENTO NÚMERO PORCENTAJEANTIOQUIA 57 5.4CALDAS 86 8.2CHOCO 74 7.0QUINDIO 40 3.8RISARALDA 655 62.7TOLIMA 15 1.2VALLE 80 7.7OTROS 43 4.0TOTAL 1050 100.0Se encuestaron 1050 personas de las cuales 547 (52.1%) eran mujeres, y 503(47.9%) eran hombres. Aspirábamos a que dicho porcentaje correspondieraestrictamente con los porcentajes en la población censada por el DANE, perocuando se visitaban los hogares seleccionados para el estudio se encontraban sobretodo mujeres, que en muchos casos representaban la cabeza de familia. Es buenorecordar que esta cifra está muy por encima del dato muestral, 782, propuesto en elproyecto inicial. 23
  24. 24. En la tabla 2 se presenta la distribución por municipio de la muestra seleccionada.Tabla 2. RESIDENCIA POR MUNICIPIO DE LA MUESTRA ESTUDIADA MUNICIPIO Frecuencia %APIA 48 4.6BALBOA 7 0.7BELEN DE UMBRIA 45 4.3DOSQUEBRADAS 101 9.6GUATICA 26 2.5LA CELIA 17 1.6LA VIRGINIA 23 2.2MARSELLA 31 3.0MISTRATO 25 2.4PEREIRA 304 29.0PUEBLORICO (Sta. Cecilia) 146 14.6QUINCHIA 55 5.2SANTA ROSA 43 4.1SANTUARIO 26 2.5TOTAL 1050 100Es importante anotar que el número total de encuestados no corresponde alnúmero de muestras sanguíneas obtenidas, que son 798, es decir un 76%, y que esen ellas donde se hicieron los análisis bioquímicos correspondientes con susrespectivas correlacionesEdad y sexoLa distribución por grupos de edades y sexo aparecen en la tabla 3, como se puedeobservar el 74% de la población es menor de 45 años.TABLA 3. DISTRIBUCIÓN DE LA POBLACIÓN POR RANGOS DEEDAD Y SEXO Edad - F/cia % F/cia % % (Años) Mujeres Acumulado Hombres Acumulado Total Acumulado 15 – 24 168 30.7 137 27.2 305 29.0 25 – 34 122 53.0 154 57.9 276 55.3 35 – 44 111 73.3 85 74.8 196 74.0 45 – 54 75 87.4 54 85.5 129 86.3 >55 71 100.0 73 100.0 144 100.0 TOTAL 547 503 1050La tabla 4 muestra la distribución general de la talla por sexo. El promedio para lasmujeres es de 1.534 ± 0.074 metros; para los hombres el promedio es de1.653 ± 0.075 metros, la diferencia es altamente significativa (P<10ˉ8) obsérvese 24
  25. 25. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAque el 78.4% de las mujeres presentan una talla menor a 1.6 metros mientras quesolo el 17.4% de los hombres presentan una talla inferior a 1.6 metros.TABLA 4. DISTRIBUCIÓN AGRUPADA DE LAS FRECUENCIAS DE TALLA PORSEXO TALLA (m) MUJERES % HOMBRES % ACUM % ACUM FREC. ACUM FREC. TOTAL < 1.49 147 28.2 13 2.6 160 15.5 1.5 – 1.59 269 78.4 73 17.4 342 48.8 1.6 – 1.69 106 98.7 268 71.8 374 85.1 1,7 – 1.79 14 100.0 126 97.4 140 98.7 > 1.8 0 ------- 13 100.0 13 100.0 TOTAL 536 493 1029PESOLa distribución general del peso por género aparece en la tabla 5 y los promediosfueron de 57.796 ± 12.13 Kg para las mujeres Y para los hombres 65.39 ± 12.1 conuna diferencia altamente significativa (P<10-4). Obsérvese que en el génerofemenino, el peso va en ascenso hasta los 55 años, mientras que para los hombresel aumento va hasta los 45 años y luego disminuye en los dos últimos grupo etarios.TABLA 5. DISTRIBUCIÓN DE LOS PROMEDIOS DE PESO PORRANGOS DE EDAD Y SEXO MUJERES HOMBRES AÑOS Kg. DESV. EST Kg. DESV. EST 15 – 24 54.0 ± 10.25 60.074 ± 10.67 10.67 25 – 34 57.35 ± 11.57 66.637 ± 12.048 12.048 35 – 44 60.16 ± 12.78 70.521 ± 12.975 12.975 45 – 55 62.13 ± 12.23 67.83 ± 9.81 9.81 55 y más 59.17 ± 11.28 64.67 ± 11.85 PROMEDIO 56.79 ± 11.820 65.3911.8512.13 ±La diferencia de peso por género va en aumento en los primeros 3 grupos etarios, lamáxima diferencia está a los 35 – 44 años (10.361 Kgs). En todos los casos ladiferencia de peso por género es altamente significativa (p<10-4). Este aumento depeso en ambos géneros refleja de alguna manera el comportamiento sedentario de lapoblación estudiada.Índice de masa corporalSe entiende como Índice de Masa Corporal (I.M.C.) la relación existente entre elpeso y la talla al cuadrado, cuando se mide en Kilogramos y metro cuadrado se 25
  26. 26. consideran que hay obesidad si el I.M.C es superior a 27; para las mujeres el I.M.Cnormal oscila entre 18.3 y 23.8; mientras que para los hombres se consideranormal entre 20 – 25 Kg /m². La obesidad es considerada un factor riesgo para laenfermedad aterosclerótica máxime si va acompañada por otros factores de riesgocomo la intolerancia a la glucosa, el hiperinsulinismo, bajos niveles de HDL y altosniveles de LDL o VLDL.En la tabla 6 se presenta la distribución de la frecuencia porcentual del ÍNDICE DEMASA CORPORAL por sexo, a manera de comparación podemos ver que el IMC parael género femenino es de 24.4 con una desviación estándar de 4.56, para el géneromasculino el promedio es 23.9 con una desviación estándar de 4.13, la diferenciano es significativa (t= 0.55 y p<0,1). De otra parte, es bueno anotar que elincremento en el I.M.C que se da en el mismo género con la edad se debeexclusivamente al aumento en el peso y esto se presenta en poblacionessedentarias.TABLA 6. FRECUENCIA PORCENTUAL DEL ÍNDICE DE MASA CORPORAL PORGÉNERO ( F. Femenino, M: masculino, n: número de datos)IMC Kg/ m2 Género F % Género M % ( n=536) (n=493)15 – 25 62.7 66.126 –30 26.1 27.231 – 33 7.1 3.734- 40 4.1 3.0En la tabla anterior se puede ver que en el género femenino el IMC mayor de 25representa un 37.3%, mientras que en los hombres representa un 32.9%; en elgénero femenino el porcentaje de la población que tiene un IMC mayor a 30 duplicaal género masculino.Presión arterialLa tabla 7 muestra la distribución de las presiones arteriales diastólica y sistólicapara toda la muestra discriminada por género. Se puede observar que el géneromasculino presenta una mayor frecuencia de tensión arterial alta, tanto ladiastólica como la sistólica. La hipertensión diastólica en mujeres es del 18.8 %,mientras que en los hombres es de 22.5%; la hipertensión sistólica en mujeres esdel 19.3% y en hombres es del 23.3%. Independiente del género con la nuevaclasificación de hipertensión el problema regional es preocupante. En poblacionessanas el incremento en las tensión arterial no debería ser tan alto, pero enpoblaciones que ganan peso con la edad debido al sedentarismo, su tensión arterialse incrementa con facilidad. 26
  27. 27. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDATABLA 7. DISTRIBUCIÓN POR GÉNERO DE LA FRECUENCIA DETENSION ARTERIAL PRESIÓN MUJERES HOMBRESDIASTÓLICA FRECUENCIA % FRECUENCIA % (mm. Hg) < 80 378 69.1 286 57.2 80 – 85 66 12.1 101 20.3 86 – 89 41 7.5 25 5.0 90 – 99 38 6.9 59 11.7 100 – 109 18 3.2 25 5.0 > 110 6 1.2 4 0.8SISTÓLICA < 120 365 66.9 282 51.6 120 – 129 68 12.6 133 24.3 130 – 139 48 8.3 68 12.5 140 – 159 50 9.0 46 8.4 160 – 179 10 2.0 14 2.4De otra parte se comparan las tensiones arteriales por área y se observan lasdiferencias: Para el sexo femenino los promedios de la Tensión Arterial Diastólicapor sitio de residencia fueron de 70.536 ± 12.24 mm. Hg y 76.839 ± 12.24 rural yurbana respectivamente. La diferencia es altamente significativa con un t = 8.02 yP<10¯4. La presión sistólica para el género femenino fue de 108.724 ± 1628 mm.Hg para el área rural y 118.75 ± 18.91 mm. Hg para el área urbana, la diferencia esaltamente significativa, con un t = 8.02 y un P<10-4. En el género masculino sepresentan las mismas tendenciasLas tensiones arteriales sistólicas fueron de 116.16 ± 13.8 (n=168) y 122.634 ±18.38 (n=331), para el área rural y urbana respectivamente, estas tensiones sonsignificativamente diferentes con un t=41.02 y una p<10-8; de igual manera alcomparar la tensión diastólica 75.91 ± 12.1 (n=168) para el área rural y 78.61 ±11.33 (n=331) para el área urbana, estos resultados presentan una diferenciasignificativa con t = 2.477 y p<0.01. 27
  28. 28. TABLA 8. DISTRIBUCIÓN POR AREA (RURAL Y URBANA)Y SEXO DE LA FRECUENCIA PORCENTUAL DE LAS PRESIONES ARTERIALES P. A. MUJERES (FREC.%) HOMBRES (FREC.%) SISTÓLICA RURAL (181) URBANO(366) RURAL (168) URBANO(331 ) <80 mm. Hg 73.5 66.9 56.5 57.1 <85 mm. Hg 89.0 77.3 80.4 73.1 85 – 89 4.4 9.0 4.1 8.2 90 – 99 5.5 7.7 9.5 13.0 100 – 109 1.1 4.1 5.4 4.8 >110 ___ 1.9 0.6 0.9DIASTÓLICA <120 79.6 60.7 56.0 49.2 <130 87.8 75.4 80.4 73.7 130 – 139 6.1 9.3 11.3 13.0 140 – 159 5.0 11.2 7.7 8.8 160 – 179 1.1 5.0 0.6 3.0 >180 — 1.1 — 1.5De la tabla 8 se puede deducir que los habitantes del área urbana, en ambosgéneros, presentan una mayor frecuencia de hipertensión así: las mujeres del áreaurbana presentan hipertensión diastólica del 13.7% mientras que las mujeres delárea rural sólo un 6.6% presentan hipertensión, la hipertensión sistólica en mujeresdel área urbana es del 17.3% mientras que en mujeres del área rural es el 6.1%.En los hombres, también los habitantes del área urbana presentan una mayorfrecuencia de hipertensión sistólica. 13.3% vs 8.3% para los hombres del árearural; para la tensión diastólica aunque la frecuencia de hombres con presión altadel área rural es 15.5%, la diferencia no es tan alta como en los otros gruposcomparados.BIOQUÍMICA SANGUINEA ColesterolLos promedios de Colesterol total para las mujeres son de 172.15 ± 38.57 (n = 410)y para los hombres de 167.71 ± 40.20 (n = 388), estos resultados sonsignificativamente diferentes con un t= 22.48 y p<10-6. Los valores promedio decolesterol LDL fueron de 110.13 ± 34.1 (n=402), para las mujeres y 104.96 ± 32.31(n = 377) para hombres, estas diferencias son significativas con un t = 7.83 y unp<10-5. Los resultados para el colesterol- HDL fueron 37.549 ± 9.58 (n = 410),para las mujeres y 34.36 ± 8.75 (n = 388) para hombres con un valor de t = 4.9 p <10-4. 28
  29. 29. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDATABLA 9. DISTRIBUCIÓN DE LOS PROMEDIOS DE COLESTEROLTOTAL, COLESTEROL – LDL Y COLESTEROL HDL, DISTRIBUIDOSPOR EDAD Y SEXO (Colesterol = mg/dl) MUJERESEDAD Colesterol total colesterol – LDL colesterol – HDL (mg/dl)15 – 24 159.54 ± 30.80 100.97 ± 28.67 38.16 ± 9.0425 – 34 166.21 ± 27.57 106.29 ± 35.65 38.88 ± 9.6035 - 44 170.81 ± 36.29 107.49 ± 31.31 36.25 ± 9.2745 – 54 198.88 ± 44.97 124.69 ± 41.53 37.59 ± 9.59 > 55 188.73 ± 56.70 123.39 ± 42.26 36.04 ± 10.6 HOMBRES15 –24 145.21 ± 32.78 90.10 ± 26.84 35.63 ± 7.4425 – 34 169.03 ± 32.38 106.16 ± 28.18 34.00 ± 8.0235 – 44 176.43 ± 44.86 109.30 ± 38.88 34.53 ± 8.1045 – 54 192.06 ± 46.27 118.61 ± 32.69 33.45 ± 12.8> 55 173.23 ± 36.16 114.92 ± 29.55 33.36 ± 8.62La tabla 9 presenta los promedios de colesterol total, colesterol LDL y colesterolHDL, agrupados por edad y género. Se puede observar que ambos géneros tienenun comportamiento similar al aumentar la edad hasta la quinta década. Elcolesterol total aumenta dramáticamente cuando se pasa de los 45 años, lasmujeres aumentan 18.07 mg/dl y los hombres 15,63 mg/dl. Este aumento se debeexclusivamente al colesterol transportado por las lipoproteínas de baja densidad, yaque el colesterol HDL disminuye en ambos géneros; es de anotar que en loshombres el mayor aumento del colesterol transportado por las lipoproteínas de bajadensidad se presenta a los 25 años: pasa de 90.1 a 106.16 mg/dl de colesterol LDL.De igual manera ocurre con los niveles de colesterol LDL, la población rural tienemayor frecuencia de normalidad que la población urbana: para las mujeres 83.3%vs 70.8; y para los hombres, 84.1% vs 74.5. Mientras que para los niveles decolesterol – HDL incluso la población rural presenta una mayor frecuencia deanormalidad col HDL < 35 mg/dl en mujeres 39.5% vs 39.2 y en hombres 55.2% vs52.8%, este último dato es una sorpresa para nosotros que pensábamos que loscampesinos, como personas que realizan una gran actividad física, deberíanpresentar altos niveles de colesterol- HDL. 29
  30. 30. TABLA 10. DISTRIBUCIÓN DEL PERFIL LIPIDICO POR GÉNERO Y AREACOLESTEROL TOTAL % HOMBRES % MUJERES %Total (mg/dl) Hombres Mujeres Urbano Rural Urbano Rural (388) (410) (271) (117) (296) (114)<200 80.2 79.0 76.8 88.0 75.7 87.7200 - 239 14.7 15.1 16.6 10.3 16.5 11.4>240 5.2 5.9 6.6 1.7 6.1 0.9LDL<130 77.6 74.4 74.2 83.8 70.6 83.3130 -159 16.0 17.3 17.0 13.7 20.0 11.4>160 6.4 8.3 8.9 1.7 9.5 5.3HDL<35 53.6 39.3 52.8 54.7 39.2 30.735 - 44 34.8 38.5 34.7 32.5 34.8 40.4>44 11.6 22.2 13.0 12.0 26.0 29.0TRIGLICERIDOS<200 55.7 83.4 55.4 80.3 84.1 81.6200 - 399 41.5 14.4 41.7 15.4 13.0 18.4>399 2.8 2.2 3.0 3.4 3.0 ---Al realizar un análisis de la variación de colesterol LDL y HDL con la edad y elgénero se puede observar que aumenta el riesgo aterosclerótico con la edad,particularmente preocupante en el género femenino cuando se pasa de la quintadécada, ya que las HDL han caído a 36 mg/dl y la LDL han alcanzado valores de120 mg/dl. La relación entre colesterol - LDL y edad es positiva en ambos géneroscon coeficientes de correlación de 0.38 para mujeres y de 0.24 para los hombres.La correlación de HDL con la edad es negativa con coeficientes de correlación de –0.09 para las mujeres y –0.04 para los hombres.Un análisis de los datos anteriores permiten concluir que la principal diferenciaentre hombres y mujeres se da en el colesterol transportado por las HDL, en lasegunda década donde se halla mayor diferencia t = 4.28 y p<10ˉ³ y en la terceradonde se encuentra la menor diferencia t = 0,598 y p<0.3 (esta ya no essignificativa).Si aceptamos como valores límites normales de colesterol HDL>45mg/dl paralas mujeres y >35 mg/dl para los hombres, tenemos que el 78.9% de lasmujeres y 53.6% de los hombres presentan niveles anormalmente bajos decolesterol HDL. Es preocupante que en la población femenina del Departamentode Risaralda se den valores tan bajos de HDL, pues el 77.8% tiene colesterol HDL,inferior a 45 mg/dl y un 39.3% tiene valores inferiores a 35 mg/dl, se supone queen la población femenina los valores normales están por encima de 45 mg/dl y estosólo ocurre en un escaso 22% de la población. La tabla 10 se construyó con el 30
  31. 31. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDApropósito de comparar los habitantes del área rural y los habitantes del áreaurbana, se puede deducir de esta tabla que el colesterol anormal (> 200 mg/dl) sepresenta con mayor frecuencia en hombres y mujeres del área urbanaESTATUS ECONÓMICOLa muestra escogida se dividió en seis estratos de acuerdo al sector donde reside,curiosamente al estrato 6 sólo pertenecen 3 personas, por tal motivo no se tomó encuenta para el análisis. El estrato 1 es el de menor ingreso familiar y el seis el demayor ingreso. La diferencia en los ingresos familiares es muy alta, pues personasdel estrato 2 tienen ingresos familiares de 1 y 1.5 salarios mínimos, <180 dólaresmensuales; mientras que familias del estrato 5 ó 6 pueden tener ingresos familiaresque están por encima de 10 salarios mínimos, >1350 dólares mensuales.En la tabla 11 se presenta la distribución de los promedios de colesterol total y susfracciones lipoproteicas, así como otros parámetros determinados en la presenteinvestigación, por estrato se puede observar que el colesterol en todas susfracciones se encuentra en mayor concentración en el estrato 5. La tensiónarterial diastólica y sistólica se encuentran más elevadas en los estratos 4 y 5con respecto a los estratos inferiores. Igual ocurre con los valores de TAG queaumenta conforme se asciende en estatus económico. Otro dato importante deanotar es que la tensión arterial tanto diastólica como sistólica se encuentran másaltas en los estratos mayores y los estratos 1 y 2 presentan los menores valorespromedio de los parámetros analizados. El ingreso familiar no redunda en unadisminución del riesgo cardiovascular, sino que por el contrario, algunosfactores se ven incrementados.TABLA 11. DISTRIBUCIÓN DE LOS PROMEDIOS POR ESTRATODEL PERFIL LIPIDICO, I.M.C. Y TENSION ARTERIALESTRATO 1 2 3 4 5PARAMETROCOLESTEROL 178.76 176.74 171.94 177.42 182.51 D.E 45.94 38.40 39.23 29.80 40.36 C – LDL 112.29 110.08 109.98 115.34 120.21 D.E 46.69 33.90 32.20 28.16 32.39 C – HDL 39.48 36.16 36.11 35.34 39.11 D.E 10.82 8.78 9.79 7.62 8.63 TAG 140.57 140.68 139.85 139.61 147.78 D.E 82.16 95.51 110.39 53.21 141.94 I.M.C. 24.91 24.61 24.08 26.58 25.30 D.E 2.77 4.33 4.32 4.02 4.69 T.A.D 72.86 78.71 78.19 84.42 81.67 D.E 6.78 11.96 11.08 12.40 14.87 T.A.S. 110.43 121.92 120.27 125.42 123.04 D.E 9.59 18.13 17.14 20.13 20.46 31
  32. 32. APOLIPOPROTEINA EEn la figura 1 se muestran los productos de amplificación por PCR de una parte delgen de apo E correspondiente a un segmento de 244 pares de bases. Como sepuede notar las bandas de amplificación se localizan en la región delimitada por losfragmentos de 353 y 242 pares de bases del marcador de tamaño molecular.Los productos de amplificación se sometieron a digestión con la enzima HhaI. Estaenzima reconoce la secuencia 5´-GCG¡C-3´ y corta en el sitio señalado. En el aleloe4 existen seis sitios de corte que generan siete fragmentos, de los cuales se puedenvisualizar los fragmentos de mayor tamaño que corresponden a las bandas de 72,48, 38 y 35 pares de bases (pb). En el alelo e3 no existe el sitio de corte en laposición 112, determinando la aparición de una banda de 91 pb junto con lasbandas de 48, 38 y35 pb. En el alelo e2 se observan las bandas de 91, 38 y 83 pb,esta última resulta de la fusión de las bandas 48 y 35 pb al desaparecer el sitio decorte de la posición 158.Figura 1 Polimorfismo de apo E. Se muestran los sitios de corte para la enzima derestricción Hha 1, los fragmentos que se generan y su separación utilizando laelectroforesis en gel de agarosa al 3%. 32
  33. 33. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDALa tabla 12 muestra la distribución de frecuencias de cada uno de los genotipos deapo E para las 654 personas incluidas en el presente estudio. Como se puedeobservar el genotipo de mayor prevalencia corresponde a 3/3 con una frecuencia de72.47%, mientras que la menor prevalencia corresponde al genotipo 4/4 con unafrecuencia de 0.91%.Tabla12. DISTRIBUCIÓN DE FRECUENCIAS DE LOS GENOTIPOS Y ALELOS DEApoE EN LA MUESTRA POBLACIONAL DE RISARALDA Genotipo N Frecuen.% E 2/2 12 1.83 E3/3 474 72.47 E4/4 6 0.91 E2/3 57 8.71 E2/4 14 2.14 E3/4 91 13.91 Alelo Frecuencia % E2 7.29 E3 83.78 E4 8.93En la tabla 13 se presentan los promedios de algunas de las variablesdeterminadas en el presente estudio, correspondientes a los diferentes genotipospara la apo E.Tabla 13. PROMEDIOS DE ALGUNOS PARÁMETROS BIOQUÍMICOS Y FÍSICOSDISCRIMINADOS POR GENOTIPOGeno- Col LDL HDL TAG Glu TAS TAD IMC tipo mg/dl mg/dl mg/dl mg/dl mg/dl mmHg mmHg Kg/m2 3/3 170.80 107.63 36.53 142.04 87.33 117.51 76.05 24.29 2/3 167.10 102.31 34.47 160.07 92.87 118.42 75.33 25.42 4/4 164.00 103.60 39.10 106.50 89.87 116.12 74.37 21.43 2/4 157.10 90.57 36.21 147.07 86.51 119.28 82.50 23.81Dado el bajo número de personas que presentan los genotipos 4/4 y 2/4 (6 y 14respectivamente) no se pudieron establecer diferencias estadísticas, pero es curiosoobservar que en el grupo de personas que tienen el genotipo 2/3 hay sietepersonas, de 57, con los niveles de glucosa por encima de 100 mg/dl y dosfrancamente diabéticas con niveles por encima de 300 mg/dl en el ayuno, esto serefleja en los niveles de triglicéridos que son altos con respecto a los otros grupos.Se necesita una muestra mayor que permita encontrar más personas pertenecientesa estos genotipos escasos y poder hacer análisis estadísticos confiables. 33
  34. 34. MUTACION Apo B3500En la propuesta inicial se recomendaba realizar este ensayo para todas lasmuestras que tuvieran colesterol por encima de 250 mg/dl, pero en las 798muestras recolectadas en todo el departamento sólo 32 estuvieron por encima deeste valor; por lo tanto se amplió este análisis a todas las personas que tuvieran elcolesterol por encima de 200 mg/dl, resultaron 153 muestras, de las cuales 81pertenecen al género femenino y 72 al género masculino.La amplificación por PCR con los iniciadores descritos en materiales y métodospermite la obtención de un fragmento de 149 pares de bases cuya presencia semonitoreó en todos los casos por medio de electroforésis en gel de agarosa al 3%.Cuando no existe la mutación en la posición 10.658 (cambio de C por T) dichofragmento se deja cortar por la enzima de restricción MspI a nivel de la secuencia 5’-C/CGG-3’ en el punto indicado, se obtienen dos fragmentos uno de 120 pares debases y otro de 29. La presencia de la mutación cambia el único punto dereconocimiento y en consecuencia no hay digestión por la enzima.El monitoreo de las productos de digestión se realizó mediante electroforésis depoliacrilamida al 12% utilizando siempre como control el amplificado de ADN sintratamiento enzimático. Para todos los casos estudiados se pudo detectar siempreuna banda de menor tamaño concordante con una longitud de 120 pares de bases,utilizando como marcador de peso molecular pUC18 digerido con MspI. Enconsecuencia, no se encontró la mutación en ninguna de las muestras analizadas.Es probable que el número de análisis realizados sean pocos y que para encontrarla mutación se requiera una muestra mucho mayor; pero también es buenorecordar el trabajo realizado en el medio oriente, donde a pesar de haber utilizadouna muestra poblacional amplia (superior a 1000) no encontraron la mutación, loque nos obliga a pensar que en nuestro medio es una mutación extremadamenterara o inexistente. 34
  35. 35. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACORRELACIONESSe estudiaron algunas correlaciones entre los parámetros evaluados y de esta formaencontrar asociación entre los datos del examen clínico con los diferentes valoresbioquímicos estudiados. Cuando solo están en juego dos variables, como es nuestrocaso, hablamos de correlación simple y regresión simple. Si X e Y son las dosvariables, un diagrama de dispersión muestra la localización de los puntos sobreun sistema rectangular de coordenadas. Si todos los puntos del diagrama dedispersión parecen estar en una recta, como es el caso que nosotros analizamos, lacorrelación se llama lineal. Una ecuación lineal es adecuada a efectos deregresión (o estimación). Si Y crece cuando X crece la correlación es positiva; si Ydecrece cuando X crece ( viceversa), la correlación es negativaLa figura 2 muestra la correlación entre el IMC y el colesterol. El coeficiente es de0.24 con límites de confianza 95% de 0.1<R<0.36. Para las mujeres la correlaciónes de 0.32 con límites de confianza para el 95% de 0.1<R<0.45 y para los hombresla correlación es de 0.26 con límites de confianza para el 95% de 0.17<R<0.45. Enambos géneros la correlación es positiva, al aumentar el IMC los niveles decolesterol en sangre también aumentan, ese aumento es más notable en lasmujeres. 350 300 250 Colesterol 200 Serie1 Lineal (Serie1) 150 100 50 0 0 5 10 15 20 25 30 35 40 45 50 Indice de Masa CorporalFigura 2. Correlación entre el Índice de Masa Corporal y el colesterol 35

×