Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Acidos Nucleicos

40,151 views

Published on

Published in: Travel, News & Politics
  • porque no me abre en mi power point el mio es 2010, porque cuando lo descargo no quiere abrir y me sale error?? que puedo hacer?
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • okei bakano
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here

Acidos Nucleicos

  1. 1. Ácidos Nucleídos<br />Alexandra Castaño<br />Sindy Zapata<br />Univesidad Santiago de Cali<br />
  2. 2. Descubrimiento<br /><ul><li>El descubrimiento de los ácidos nucleícos se debe a Friedrich Miescher, quien en el año 1869 aisló de los núcleos de las células una sustancia ácida a la que llamó nucleína, nombre que posteriormente se cambió a ácido nucleico.</li></li></ul><li>¿ Que son ?<br /><ul><li>Son macromoléculas constituidas por nucleótidos encadenados, que se encuentran en las células de todos los seres vivos y en los virus. Se unen mediante enlaces fosfodiéster, que se produce entre un grupo hidroxilo (–OH)en el carbono 3' y un grupo fosfatoH3PO4.</li></li></ul><li>Componentes: Los Nucleótidos<br />Son las unidades estructurales de los ácidos nucleicos. Están<br />compuestos por:<br /><ul><li>Una base nitrogenada BN
  3. 3. Un azúcar o pentosa A P A BN
  4. 4. Un acido fosfórico P</li></ul>Están formados por la unión de bioelementos tales como:<br />C ,H ,O, N, P<br />
  5. 5. Estructura de un NUCLEOTIDO<br />A<br />P<br />BN<br />Fosfoester<br />N-glicosidico<br />
  6. 6. Diferencia entre:<br />Es la molécula resultante de la unión entre la pentosa y una base nitrogenada.<br />Es un compuesto monomérico formado por una base nitrogenada, una pentosa y un grupo fosfato.<br />Nucleósido<br />Nucleótido<br />
  7. 7. Componentes de un NUCLEOTIDO<br />Pentosa puede ser:<br /><ul><li>Dexosirribosa
  8. 8. Ribosa</li></ul>Las bases nitrogenadas pueden ser:<br /><ul><li>Adenina A
  9. 9. CitosinaC
  10. 10. Guanina G
  11. 11. Timina T
  12. 12. UraciloU</li></li></ul><li>Azucares o Pentosas<br />El azúcar que interviene en los nucleótidos puede ser o la ribosa (R) o<br />la desoxirribosa (DR). <br />Conviene destacar que la única diferencia entre ambas está en que en<br />el carbono 2 de la desoxirribosa hay un hidrógeno (-H) en lugar del<br />grupo alcohol (-OH).<br />
  13. 13. Bases Nitrogenadas<br />Las bases nitrogenadas son parte fundamental de los nucleótidos. Biológicamente, existen sólo cinco bases nitrogenadas divididas en dos tipos, purinas y pirimidinas. <br />Citosina<br />Timina<br />Uracilo<br />Adenina<br />Guanina<br />Pirimidinas<br />Purinas<br />
  14. 14. ¿Cuales son?<br />Los Ácidos nucleídos están representados por: <br />ADN<br />ARN<br />Acido Ribonucleico: actúan<br />como transmisores de dicha<br />información (ARN mensajero),<br />como componentes de los<br />ribosomas (ARN ribosomal) o<br />como transferidores de<br />aminoácidos (ARN de<br />transferencia)<br />Acido desoxirribonucleicos : son<br />los almacenadores de la<br />información biológica<br />
  15. 15. AcidoDexosirribonucleico ADN<br />Todas las células vivas codifican el material genético en forma de<br />ADN, ácido nucleíco contenido en los cromosomas de las células y<br />portador de la información genética (gen). <br />La estructura de la doble hélice constituye la base para la<br />Transmisión inalterable de los genes a través de millones de<br />generaciones de células, ya que las cadenas de ADN tienen la<br />propiedad de autoduplicarse para formar moléculas hijas<br />idénticas (replicación). <br />
  16. 16. ADN<br />La secuencia de bases el ADN (código genético) contiene la<br />Información genética para la síntesis de proteínas. A partir del <br />ADN se sintetizan moléculas complementarias de ARNm (ácido <br />ribonucleico mensajero) en el proceso denominado<br />transcripción. <br />Cada uno de estos nucleótido se halla unido covalentemente,<br />Por medio de su grupo fosfato, a la ribosa del nucleótido<br />Contiguo (puente fosfodiéster entre el grupo hidróxilo 5' de un <br />nucleótido y el 3‘Del siguiente).<br />
  17. 17. ADN<br />Se pueden distinguir 3 niveles estructurales:<br /><ul><li>Estructura primaria: La secuencia de los nucleótidos.
  18. 18. Estructura secundaria: La doble hélice.
  19. 19. Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado.</li></li></ul><li>Estructura PRIMARIA DEL ADN:<br /><ul><li>Es la secuencia de nucleótidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula.
  20. 20. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica.</li></ul>Así, por ejemplo:<br /> 5'ACGTTTAACGACAAGGACAAGTATTAA3'<br />
  21. 21. Estructura secundaria del adn:<br />La concentración de Adenina es igual a la de Timina, y la de Citosina a la de Guanina. <br />Los grupos fosfato estarían hacia el exterior y de este modo sus cargas negativas interaccionarían con los cationes presentes en el nucleoplasma dando más estabilidad a la molécula.<br />Las dos primeras establecen dos puentes de hidrógeno entre ellas, y las últimas tres puentes. <br />La cantidad de purinas es igual a la cantidad de pirimidinas.<br />Ambas cadenas serían antiparalelas, una iría en sentido 3‘-5' y la otra en sentido inverso, 5' - 3'.<br />
  22. 22. EstructuraSecundaria<br />
  23. 23. Estructura Terciaria<br />Se encuentra súper empaquetada , ocupando así menos espacio en el núcleo celular , y además como mecanismo para facilitar su transcripción; En las células eucariotas el ADN se encuentra en el núcleo asociado a ciertas proteínas: formando la cromatina (Constituye el Cromosoma).<br />
  24. 24. Replicación del ADN<br />Proceso mediante el cual el ADN se copia para poder ser transmitido a nuevos individuos. Y <br />es fundamental para la descendencia genética.<br />Síntesis por la DNA-polimerasa de la hebra conductora (izquierda) y de la hebra seguidora en fragmentos de la derecha.<br />Unión de todos los fragmentos por la DNA-ligasa<br />Formación de una horquilla de replicación<br />
  25. 25. Acido Ribonucleico ARN <br />El ARN es un filamento de una sola cadena, no forma doble hélice. En el ARN hay cuatro bases nitrogenadas: adenina, guanina - citosina, y uracilo. Los ácidos ribonucleicos se encuentran en el núcleo celular, en el citoplasma y en los ribosomas de todos los seres vivos. <br />Ciertos tipos de ARN tienen una función diferente y toman parte en la síntesis de las proteínas que una célula produce.<br />
  26. 26. Clases de ARN<br /><ul><li>ARNm: (Mensajero) Codifica la secuencia de aminoácido de un polipéptido. (5%)
  27. 27. ARNt(Transcripción) Lleva los aminoácidos a los ribosomas durante la traducción. (80%)
  28. 28. ARNr(Ribosomatico) Con proteínas ribosomales y los ribosomas actúan con el ARNm. Forman los ribosomas (15%)
  29. 29. ARNnp(nuclear pequeño): Con proteínas, forma complejos que son usados en el proceso de ARN en las células eucarióticas (no se encuentra en las células procarióticas).</li></li></ul><li>ARN Mensajero<br /><ul><li>Su función es transportar la información de un gen a la maquinaria (Ribosoma) que sintetiza proteínas donde actúan como molde para formar una secuencia especifica de aminoácidos y así, formar una molécula de proteína especifica, producto ultimo de un gen. </li></ul>ARN Transcripción<br /><ul><li>Transportaaminoácidos a los ribosomas para incorporarlos a las proteínas y realizar así la síntesis</li></li></ul><li>Sintesis de Proteina<br />Es el proceso mediante el cual anabólicamente se forman las proteínas a partir de los nucleótidos.<br />Las proteínas sirven para enviar información , formar estructuras, y almacenar sustacias., y sirven para favorecer reacciones metabólicas.<br />
  30. 30. Cuadro comparativo entre el ADN y el ARN<br />
  31. 31. Cromosomas<br />Son los portadores de la mayor parte del material genético y condicionan la organización de la vida y las características hereditarias de cada especie, formado por la cromatina que es un material microscópico que lleva la información genética de los organismos eucariotas y está constituida por ADN asociado a proteínas especiales llamadas histonas. <br />
  32. 32.
  33. 33. Enfermedades<br />Cromosoma 6: <br />Ataxia espinocerebelosa<br />Diabetes<br />Hperplasia adrenal congénita por deficiencia de 21<br />hidroxilasa<br />Epilepsia<br />Hemocromatosis <br />Síndrome de Zellweger<br />Cromosoma 17: <br />Algunas enfermedades asociadas a mutaciones del cromosoma 17 son: <br />Cáncer de mama, <br />Enfermedad de Charcot-Marie-Tooth<br />Cromosoma 1: Enfermedad de Alzheimer Enfermedad de GaucherCáncer de próstataGlaucomaPorfiria cutánea tardía<br />Cromosoma X:<br />Hemofilia<br />Distrofia muscular de Duchenne<br />Síndrome de Rett<br />Síndrome de Lesh-Nyhan<br />Síndrome de Alport<br />Cromosoma 9: <br />Ataxia de Friedrich<br />Enfermedad de Tangier<br />Melanoma maligno<br />Esclerosis tuberosa<br />Cromosoma Y: <br />Azospermia,<br />Disgenesia gonadal<br />
  34. 34. Hemofilia<br />Consiste en la dificultad de la sangre para coagularse adecuadamente. Se caracteriza por la aparición de hemorragias internas y externas debido a la deficiencia parcial de una proteína coagulante denominada globulina antihemofílica (factor de coagulación).<br />Sindrome de Rett<br />Pueden observarse graves retrasos en la adquisición del lenguaje y en la adquisición de la coordinación motriz. A menudo, está asociado con retraso mental grave o leve. La pérdida de las capacidades es por lo general persistente y progresiva.<br />
  35. 35. Importancia Biologica<br />Pueden sufrir cambios o mutaciones, lo cual permite la evolución continua de los seres vivos. Las especies que tienen estructuras y funciones similares quizás tengan un origen o antecesor común.<br />Principalmente se encuentran en el<br />núcleo celular, contienen los genes<br />responsables de los rasgos biológicos<br />y son capaces de transmitirlos de una<br />generación a otra. También se<br />encuentran libres en las células.<br />Constituyen la base de los cromosomas y el fundamento de la forma de expresarse la información genética en la síntesis de las proteínas de cada individuo.<br />La utilización de técnicas para comparar ácidos nucleicos permiten determinar el parentesco familiar y la investigación.<br />
  36. 36. Otros Nucleótidos importantes<br />Coenzima A<br />Derivado de un nucleótido de Adenina. Tiene <br />3 grupos P y es de carácter funcional<br />CoA-SH <br />ATP<br />Almacena y libera energía, gracias a<br />Los enlaces fosfatos. Se le conoce<br />Como Moneda de intercambio<br />energético.<br />
  37. 37. Importante para Recordar…!! <br />Los polinucleótidos son polímeros de nucleótidos que presentan extremos 5’ y 3’.<br />La información genética de cada célula somática es prácticamente idéntica. La distinción entre una célula cerebral, muscular o hepática depende del patrón de genes expresados en estas células, las así llamada expresión especifica de tejido.<br />
  38. 38. Graciias!! ^^<br />

×