Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Kestelman oral

  • Login to see the comments

  • Be the first to like this

Kestelman oral

  1. 1. Kestelman Valentin M2 SVS :Biologie des interactions du gène aux populationsEncadrantsDr. Lorraine Bottin; Dr. Thierry Thibaut & Doctorante Pauline RobvieuxEA 4228 Ecomers1
  2. 2. Algues structurantesStructurent l’habitat : ingénieur de l’écosystème(sensu Jones et al. 1994)Disparition de l’algue  Perte de la biodiversité(Benedetti-Cecchi, 2001)Pacifique : KelpsAtlantique : Laminaria ou FucusMéditerranée : Cystoseira(Mann, 1973)(Steneck et al., 2003)2(Photo : T.Thibaut)
  3. 3. Cystoseira en MéditerranéeGenre Cystoseira : 28 taxons dont 20endémiquesDepuis la surface jusqu’à 80 m deprofondeurEn forte régression (Thibaut et al., 2005)causes anthropiques :SurpâturageRejet d’eaux usées, eutrophisationSensibles aux perturbations : mesurela qualité de l’environnement littoralmarin (Ballesteros et al., 2007)3La saupe, un herbivorePopulation impactée(Photos: T.Thibaut)
  4. 4. Cystoseira amentacea var. strictaDiploïde, cycle monogénétique(Gomez-Garreta et al., 2000)Zygotes 100 µm, membranecollante (Susini, 2006)Dispersion estimée très faible40 cm max (Mangialajo et al., 2012)Isolement par la distance attenduSource : Gomez-Garreta et al., 2000Animation : Amber Rais4Cartographie Ceinture dense(Photo: P. Robvieux)
  5. 5. Etat des connaissancesEtudes préliminaires :RAPDs, marqueurs dominants, difficilement reproductibles(Susini et al., 2007)Microsatellites neutres, codominants, polymorphes8 marqueurs disponibles  Structuration inter-population(Robvieux et al., 2012)Existe-t-il une structuration intra-population ?Objectifs de l’étudeDécrire la structure génétiqueClarifier la distance de dispersion des recruesEffet de perturbations anthropiques sur la structuregénétique5
  6. 6. Matériel et méthodesTerrainLocalisation des populationsP1n = 43P2n = 45nP1n = 45nP2n = 45ÉchantillonnagePerturbation Population fragmentée 6(Photos: T.Thibaut & A. Blanfuné)
  7. 7. 7P1P2nP1nP2xyxyxyxy(Diagrammes : A. Blanfuné)
  8. 8. Matériel et méthodesLaboratoireExtraction d’ADNPCR microsatellitesAnalyse des génotypesTraitement des données 8Génotypage
  9. 9. Hypothèses testéesEn panmixie (reproductionaléatoire)Equilibre de Hardy-Weinberg (HW) : He = HoEcart à HW : He ≠ HoEcart à la panmixie(Consanguinité, EffetWahlund)F (Fis et Fst)Déficit en hétérozygoteAutocorrélation spatialeDétecter une structuregénétique dans l’espace9Effet WahlundStructure génétique spatiale(Hamilton, 2009)
  10. 10. Résultats :Richesse, Fis et DifférentiationP1 P2 nP1 nP2Richesse allélique 3,252 3,097 3,645 2,880Fis 0,112 *** 0,092 *** 0,077 *** 0,004 nsP1 P2 nP1 nP2P1 -P2 0,372 *** -nP1 0,419 *** 0,304 *** -nP2 0,500 *** 0,479 *** 0,415 *** -Richesse allélique et écart à la panmixieFst par paires de populations10P : PerturbénP : Non perturbé
  11. 11. Autocorrélation spatialePanmixie Isolement par la distanceHamilton 200911I de moranDistance entre paires d’individus
  12. 12. Résultats : autocorrélation spatiale Absence de structuregénétique spatiale Pas d’isolement parla distance à cetteéchelle Pourtant déficit en Hopour nP1 Consanguinité à nP1et pas nP2 ?Distance en cmPairwise kinship coefficientErreur StandardIC 95 %12
  13. 13. Résultats : autocorrélation spatialeStructuregénétique spatiale< 30 cmStructure liée à lataille des patchs ?Pairwise kinship coefficient13Erreur StandardIC 95 %Distance en cm
  14. 14. Pollution et structuregénétiqueHypothèses :Fragmentation depuis la perturbation,bottleneck (goulot d’étranglement)Disparition locale, puis recolonisation Pas à pas De manière aléatoire1952 1997 2012Rejets des eaux usées deToulon sans traitementUsine de traitementdes eaux opérationnelle Structure génétiquespatiale observée14(Photos: T.Thibaut)
  15. 15. ConclusionPopulations non perturbées : non fragmentéesFis nul ou faiblePas d’isolement par la distancePopulations perturbées, fragmentéesStructure génétique, effet WahlundPatch d’individus apparentés Effet des perturbations15
  16. 16. PerspectivesLien entre génétiqueet environnementPente / VaguesDispersion des zygotes / gamètesTransplantationAugmenter le nombre de sites àéchantillonnerRelargage et survie des gamètesGamètes in vitroStimulus  Relargage gamètes ?Influence des vagues ?16(Photo: P.Robvieux)
  17. 17. Merci de votre attention17(Photos: P.Robvieux)
  18. 18. 18nP1 : St-Jean-Cap-Ferrat(Diagrammes : A. Blanfuné)
  19. 19. 19nP2 : Cap Martin(Diagrammes : A. Blanfuné)
  20. 20. 20P1 : Cap Sicié A(Diagrammes : A. Blanfuné)
  21. 21. 21P2 : Cap Sicié B(Diagrammes : A. Blanfuné)
  22. 22. 22680 km680 kmProvence Alpes Côte d’Azur RegionCorsicaC. amentacea : distribution of the species in France(Cartes fournis par P. Robvieux)
  23. 23. CSA CSB SJCF CM24 « monomorphe » : 154Par populationPar locus23
  24. 24. 24PATCHINESSAnalysis of Variance TableResponse: ArDf Sum Sq Mean Sq F value Pr(>F)Pop 7 0.3449 0.04928 0.1530 0.99276Locus 1 0.9963 0.99633 3.0943 0.08507 .Residuals 47 15.1333 0.32198---Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1> anova(glm(patchm,family=quasipoisson),test="Chisq")Analysis of Deviance TableModel: quasipoisson, link: logResponse: ArTerms added sequentially (first to last)Df Deviance Resid. Df Resid. Dev Pr(>Chi)NULL 55 9.9784Pop 7 0.21106 48 9.7673 0.9936Locus 1 0.59654 47 9.1708 0.0822 .---Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1Pas de variation détectableTrop peu d’individus…
  25. 25.  PCR product from: 9 to 168.Length: 160 bp.The sequence of the PCR primers replaces the templatesequence. GTGTGGTCCTTGCTTCGTCACGTATACAGCAATAGTTGTATAGCAGCAGCAGCAGCAGCAGCTCATGTGACTGTTTTTTGTCCACTATTTCATCCAAACCCATACACATTACACATCATCTGCCAATACGAACAAACAAAACCAGAGCTGTCAAGCATGC Amplicon attendu : 160 pb, observé (partout) 154 pb25
  26. 26. 263 Pics CSAImpair CSB??? SJCFPresque OK CM
  27. 27.  Uniquement population CSB (Locus 27)27En bleu sur le graphe…
  28. 28. Potentiellementcontaminés15 15Perdus7 0281 témoin pour 15 echantillons1 contamination : Mix2 (Locus 20 et 35)Témoin 3 : Locus 20 – 223/223 – Locus 35 – 188/201Certains individus « liés » au T3présentent un signal223 en hétérozygoteAucun individu « lié » au T3,Ne présente de signal à 201 pb
  29. 29. 29J.M. Butler (2005) Forensic DNA Typing, 2ndEdition ©2005 Elsevier Academic PressStuttering : Petits signal à 1 répétitionLarge allele dropout : Signal réduità plus grande pbQuantité/qualité de l’ADN+/- A à la fin de la séquenceAllèles nuls, pas de signalhttp://www.uvm.edu/~biology/Classes/296D/6_Biology.pdf
  30. 30. 30Tiré du manuel de micro-checkerMicro-checker
  31. 31. Connus : pour le pollen dispersion de type « Leptokurtique »,la grande majorité proche de la source mais aussi rares évènementà longue distanceEx : Centaurea corymbosa (Hardy, et al. 2004)31
  32. 32. (Gomez-garreta et al., 2000)n : Noyaufa : Flagelle antérieurefp : Flagelle postérieurem : mastigonemes(Clayton et al., 1992)D’un µ-envt à un autreGrande dispersion : Large + Courant32
  33. 33. 33Gomez-Garreta et al., 2000
  34. 34. Sites échantillonnésEtude des courants (Ifremer)34
  35. 35. Song et al., 1996FluorescencePhosphorescence35
  36. 36. 36
  37. 37. gabpq =1 - paa : p²ab : p*q + p*q = Hebb : q²Multi-allèleHomozygoteHe : 1 - Q(Hamilton, 2009)37
  38. 38.  Le nombre d’alléles observés dépend fortementde la taille de l’échantillon Méthode de raréfaction pour « lisser » lesdifférentes tailles Estime le nombre attendu d’allèles dans un sous-echantillon de 2n gènes, 2N ayant étéechantillonés. Terme sous la somme : probabilité d’échantillonerl’allèle i au moins une fois dans un echantillon detaille 2n38
  39. 39. 39
  40. 40. Le dénominateur du premier terme « pondère» la contribution des allèles etpermet à cet estimateur de ne pas souffrir de biais particulier en présenced’allèle de faible fréquence.Le second terme ajuste le biais attribuable à la taille d’échantillonnage.(d’après Oddou-Muratorio et al., 2004)Le numérateur est plus grand quand les paires d’individus (populations) ont des fréquencesalléliques qui sont chacune très différentes de la fréquence allélique moyenne. Valeurspossible de -1 à +1 avec une quantité suffisante d’échantillons.Valeur positive, signifie que les fréquences alléliques entre pairs d’individus, sont similaireen moyenne. Négative : les fréquences alléliques entre pairs d’individus diffèrent enmoyenne.Une valeur de zéro indique que les différences ne sont pas liées à la distance, ou que lavariation génétique est aléatoire dans l’espace. (d’après Hamilton, 2009)40

×