hSMC2, novel transcriptionaltarget of Wnt signaling pathway              Lucía Suárez-López        Drug delivery and targe...
Colon cancer progression model                     Adapted from Davies, R. J., et al. 2005.
Colon cancer progression model       Pathway members altered in 90% of CRC                                       Adapted f...
Wnt pathway along the colon crypt                WNT OFF                WNT ON  Wnt ligands
Wnt pathway along the colon crypt                WNT OFF                WNT ON      Aberrant crypt foci                   ...
Wnt pathwayOFF
Wnt pathwayOFF        ON                C-MYC,                Cyclin D
SMC family: Structural Maintenance of Chromosomes ATPases highly conserved along evolution                    Arqueobacte...
SMC family: Structural Maintenance of Chromosomes ATPases highly conserved along evolution                    Arqueobacte...
Condensin complex is upregulated in CRC   • QPCR on CRC samples     SMC2              CAP-G     CAP-G2    CAP-H        ***...
Condensin complex is upregulated in CRC   • QPCR on CRC samples     SMC2              CAP-G     CAP-G2    CAP-H        ***...
SMC2 is upregulated in CRC• Western Blot on CRC paired samples         Case       31           35           36           3...
SMC2 is upregulated in CRC• Western Blot on CRC paired samples         Case       31           35           36           3...
SMC2 is upregulated in CRC• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts.
SMC2 is upregulated in CRC• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts.               ...
SMC2 is upregulated in CRC• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts.               ...
SMC2 expression is linked to β-catenin            Wnt signaling activation   Nuclear accumulation of β-catenin            ...
SMC2 expression is linked to β-catenin            Wnt signaling activation          Nuclear accumulation of β-catenin     ...
Is SMC2 a target of Wnt/β-catenin pathway?
SMC2 is down-regulated upon Wnt inhibition         Ls174T/dnTCF4                                                    Ls174T...
SMC2 is down-regulated upon Wnt inhibition         Ls174T/dnTCF4                                                    Ls174T...
SMC2 is down-regulated upon Wnt inhibition         Ls174T/dnTCF4                                                    Ls174T...
TCF4 is bound to SMC2 promoter in vivo  TATA   Sp1       Sp1   TATA TSS   Sp1  -595   -561     -301   -12   +1   +219
TCF4 is bound to SMC2 promoter in vivo      TATA   Sp1                             Sp1          TATA TSS       Sp1      -5...
TCF4 is bound to SMC2 promoter in vivo      TATA   Sp1                             Sp1          TATA TSS       Sp1      -5...
Identification of the TCF4 responding element in SMC2                        promoter   • Luciferase reporter assays      ...
Identification of the TCF4 responding element in SMC2                        promoter   • Luciferase reporter assays      ...
Identification of the TCF4 responding element in SMC2                        promoter   • Luciferase reporter assays      ...
Identification of the TCF4 responding element in SMC2                             promoter              • Luciferase repor...
SMC2 role in tumorogenesis• siRNA mediated Knockdown of SMC2            Time (h):        24        48     72              ...
SMC2 role in tumorogenesis• siRNA mediated Knockdown of SMC2            Time (h):        24        48     72              ...
SMC2 role in tumorogenesis        • Tumor Xenografts                                                              siRNA   ...
SMC2 role in tumorogenesis        • Tumor Xenografts                                                              siRNA   ...
SMC2 role in tumorogenesis        • Tumor Xenografts                                                              siRNA   ...
Summary1. Condensin complex is up-regulated in colon cancer2. SMC2 is under direct regulation of β-catenin/TCF4 complex3. ...
AcknowledgmentsDRUG DELIVERY AND TARGETING GROUP        Verónica Dávalos        Julio Castaño        Anthea Messent       ...
Upcoming SlideShare
Loading in …5
×

hSMC2, novel transcriptional target of Wnt signaling pathway

1,343 views

Published on

Lucía Suárez' predoctoral presentation at the 6th VHIR Scientific Session. Watch the video of the presentation after the last slide.

  • Be the first to comment

  • Be the first to like this

hSMC2, novel transcriptional target of Wnt signaling pathway

  1. 1. hSMC2, novel transcriptionaltarget of Wnt signaling pathway Lucía Suárez-López Drug delivery and targeting unit CIBBIM-Nanomedicine VHIR meeting 2012
  2. 2. Colon cancer progression model Adapted from Davies, R. J., et al. 2005.
  3. 3. Colon cancer progression model Pathway members altered in 90% of CRC Adapted from Davies, R. J., et al. 2005.
  4. 4. Wnt pathway along the colon crypt WNT OFF WNT ON Wnt ligands
  5. 5. Wnt pathway along the colon crypt WNT OFF WNT ON Aberrant crypt foci Tumorogenesis initiation Wnt ligands
  6. 6. Wnt pathwayOFF
  7. 7. Wnt pathwayOFF ON C-MYC, Cyclin D
  8. 8. SMC family: Structural Maintenance of Chromosomes ATPases highly conserved along evolution Arqueobacteria  Mammals Responsible for Higher-order chromosome organization and dynamics SMC2 & SMC4 = Condensin Complex SMC2 SMC4 SMC core members Non-SMC regulatory subunits • Condensin I • Condensin II Tatsuya Hirano, 2010
  9. 9. SMC family: Structural Maintenance of Chromosomes ATPases highly conserved along evolution Arqueobacteria  Mammals Responsible for Higher-order chromosome organization and dynamics SMC2 & SMC4 = Condensin Complex SMC2 SMC4 SMC core members Non-SMC regulatory subunits • Condensin I • Condensin II Introduces positive supercoilings into DNA DNA Tatsuya Hirano, 2010
  10. 10. Condensin complex is upregulated in CRC • QPCR on CRC samples SMC2 CAP-G CAP-G2 CAP-H *** *** *** ***
  11. 11. Condensin complex is upregulated in CRC • QPCR on CRC samples SMC2 CAP-G CAP-G2 CAP-H *** *** *** ***
  12. 12. SMC2 is upregulated in CRC• Western Blot on CRC paired samples Case 31 35 36 38 85 86 N T N T N T N T N T N T SMC2 150 kDa ACTIN 37 kDa
  13. 13. SMC2 is upregulated in CRC• Western Blot on CRC paired samples Case 31 35 36 38 85 86 N T N T N T N T N T N T SMC2 150 kDa ACTIN 37 kDa SMC2 is up-regulated in 20 out 29 tumor samples: 69%
  14. 14. SMC2 is upregulated in CRC• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts.
  15. 15. SMC2 is upregulated in CRC• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts. Colon adenocarcinoma
  16. 16. SMC2 is upregulated in CRC• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts. Normal mucosa Wnt-target genes expression pattern Colon adenocarcinoma
  17. 17. SMC2 expression is linked to β-catenin Wnt signaling activation Nuclear accumulation of β-catenin β-catenin SMC2Membrane β-catenin Nuclearβ-catenin
  18. 18. SMC2 expression is linked to β-catenin Wnt signaling activation Nuclear accumulation of β-catenin β-catenin SMC2Membrane β-catenin Nuclearβ-catenin Fisher exact test p=0,04, N=43 SMC2 is up-regulated in tumors where β-catenin is nuclear
  19. 19. Is SMC2 a target of Wnt/β-catenin pathway?
  20. 20. SMC2 is down-regulated upon Wnt inhibition Ls174T/dnTCF4 Ls174T/pTER-bCAT Dominant negative form of TCF4 siRNA against β-cateninTime 24h 48h 72h 96h Time 24h 48h 72h 96hDox - + - + - + - + Dox - + - + - + - +TCF-4 β-cateninC-MYC C-MYCSMC2 SMC2ACTIN ACTIN
  21. 21. SMC2 is down-regulated upon Wnt inhibition Ls174T/dnTCF4 Ls174T/pTER-bCAT Dominant negative form of TCF4 siRNA against β-cateninTime 24h 48h 72h 96h Time 24h 48h 72h 96hDox - + - + - + - + Dox - + - + - + - +TCF-4 β-cateninC-MYC C-MYCSMC2 SMC2ACTIN ACTIN
  22. 22. SMC2 is down-regulated upon Wnt inhibition Ls174T/dnTCF4 Ls174T/pTER-bCAT Dominant negative form of TCF4 siRNA against β-cateninTime 24h 48h 72h 96h Time 24h 48h 72h 96hDox - + - + - + - + Dox - + - + - + - +TCF-4 β-cateninC-MYC C-MYCSMC2 SMC2ACTIN ACTIN SMC2 is under β-catenin/TCF4 regulation, but is it direct or indirect?
  23. 23. TCF4 is bound to SMC2 promoter in vivo TATA Sp1 Sp1 TATA TSS Sp1 -595 -561 -301 -12 +1 +219
  24. 24. TCF4 is bound to SMC2 promoter in vivo TATA Sp1 Sp1 TATA TSS Sp1 -595 -561 -301 -12 +1 +219 TBE 2 TBE 3Hs 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Pt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||Mmt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGG---TGA 71 .|.|.||...|||||||||||||||||||||||||||||||||||| |||.|||||||||.|||.|||||Rn 1 CAGACGCGTCGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAG----AAACAGTTCCGGCACGGTTGTTG- 69 .|.|.||...||||.|||||||||||||||||||||||||||||||| ||.|||||||||.|||.|||||Mms 1 CAGACGCCTCGGAGTTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGG----AACAGTTCCGGCACGGTTGTTG- 69
  25. 25. TCF4 is bound to SMC2 promoter in vivo TATA Sp1 Sp1 TATA TSS Sp1 -595 -561 -301 -12 +1 +219 TBE 2 TBE 3Hs 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Pt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||Mmt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGG---TGA 71 .|.|.||...|||||||||||||||||||||||||||||||||||| |||.|||||||||.|||.|||||Rn 1 CAGACGCGTCGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAG----AAACAGTTCCGGCACGGTTGTTG- 69 .|.|.||...||||.|||||||||||||||||||||||||||||||| ||.|||||||||.|||.|||||Mms 1 CAGACGCCTCGGAGTTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGG----AACAGTTCCGGCACGGTTGTTG- 69
  26. 26. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ 3Mut 1 2 3 4 5 Luc+ 1/2/4/5 Mut 1 2 3 4 5 Luc+
  27. 27. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ 3Mut 1 2 3 4 5 Luc+ 1/2/4/5 Mut 1 2 3 4 5 Luc+ DLD-1 cells HCT116 cells pgl3b WT 2Mut 3MUT 1/2/4/5Mut pgl3b WT 2Mut 3MUT 1/2/4/5Mut
  28. 28. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ 3Mut 1 2 3 4 5 Luc+ 1/2/4/5 Mut 1 2 3 4 5 Luc+ DLD-1 cells HCT116 cells pgl3b WT 3MUT 1/2/4/5Mut pgl3b WT 3MUT 1/2/4/5Mut
  29. 29. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ TBE3 is responsible for β-catenin/TCF4 3Mut 1 2 3 4 5 Luc+ transactivation of SMC2 promoter1/2/4/5 Mut 1 2 3 4 5 Luc+ DLD-1 cells HCT116 cells pgl3b WT 3MUT 1/2/4/5Mut pgl3b WT 3MUT 1/2/4/5Mut
  30. 30. SMC2 role in tumorogenesis• siRNA mediated Knockdown of SMC2 Time (h): 24 48 72 siRNA: sc SMC2 sc SMC2 sc SMC2 SMC2 SMC4 NCAPH GAPDH
  31. 31. SMC2 role in tumorogenesis• siRNA mediated Knockdown of SMC2 Time (h): 24 48 72 siRNA: sc SMC2 sc SMC2 sc SMC2 SMC2 SMC4 NCAPH GAPDH
  32. 32. SMC2 role in tumorogenesis • Tumor Xenografts siRNA siRNA 1st 2nd scrambled SMC2 transfection transfectionDLD1 cells Mice injection 48h 24h
  33. 33. SMC2 role in tumorogenesis • Tumor Xenografts siRNA siRNA 1st 2nd scrambled SMC2 transfection transfectionDLD1 cells Mice injection 48h 24h
  34. 34. SMC2 role in tumorogenesis • Tumor Xenografts siRNA siRNA 1st 2nd scrambled SMC2 transfection transfectionDLD1 cells Mice injection 48h 24h SMC2 is a new potential therapeutic target
  35. 35. Summary1. Condensin complex is up-regulated in colon cancer2. SMC2 is under direct regulation of β-catenin/TCF4 complex3. SMC2 is proposed as new potential therapeutic target for CRC treatment
  36. 36. AcknowledgmentsDRUG DELIVERY AND TARGETING GROUP Verónica Dávalos Julio Castaño Anthea Messent Simó Schwartz Navarro FUNCTIONAL VALIDATION AND PRE- CLINICAL RESEARCH Yolanda Fernández Ibane Abásolo

×