Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

RNA (gene expression) analysis of Prostate cancers and non-cancerous tissues t

69 views

Published on

Differential expression of genes in prostate cancer tissues and normal tissues

Published in: Health & Medicine
  • DOWNLOAD THAT BOOKS INTO AVAILABLE FORMAT (2019 Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download Full EPUB Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download Full doc Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download PDF EBOOK here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download EPUB Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download doc Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book that can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer that is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBooks .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story That Helped Ignite a Movement,-- Atomic Habits: An Easy & Proven Way to Build Good Habits & Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money That the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths that Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • DOWNLOAD THAT BOOKS INTO AVAILABLE FORMAT (2019 Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { http://bit.ly/2m77EgH } ......................................................................................................................... Download Full EPUB Ebook here { http://bit.ly/2m77EgH } ......................................................................................................................... Download Full doc Ebook here { http://bit.ly/2m77EgH } ......................................................................................................................... Download PDF EBOOK here { http://bit.ly/2m77EgH } ......................................................................................................................... Download EPUB Ebook here { http://bit.ly/2m77EgH } ......................................................................................................................... Download doc Ebook here { http://bit.ly/2m77EgH } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book that can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer that is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBooks .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story That Helped Ignite a Movement,-- Atomic Habits: An Easy & Proven Way to Build Good Habits & Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money That the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths that Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • DOWNLOAD THAT BOOKS INTO AVAILABLE FORMAT (2019 Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download Full EPUB Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download Full doc Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download PDF EBOOK here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download EPUB Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download doc Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book that can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer that is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBooks .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story That Helped Ignite a Movement,-- Atomic Habits: An Easy & Proven Way to Build Good Habits & Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money That the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths that Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • Be the first to like this

RNA (gene expression) analysis of Prostate cancers and non-cancerous tissues t

  1. 1. Gene expression in prostate cancer Analysis of NGS RNA sequence data of prostate cancerous and normal tissues 10/11/2019 1Tsukuba GeneTechnologies Lab.
  2. 2. RNA sequence data of prostate cancerous and normal tissues found in public domain Supplementary information, Table S1 Patient information No. Age Preoperative PSA Stage Gleason Score Metastasis 10 75 10.93 T2cN0M0 3+4 0 11 57 6.99 T2cN0M0 3+4 0 12 80 22.38 T1cN0M0 4+3 0 Prostate cancerous and normal tissues from 3 respective patients http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3343650/ 10/11/2019 2Tsukuba GeneTechnologies Lab.
  3. 3. Feature of RNA sequence data Supplementary information, Table S2 Sequencing quality control information Sample Library size (bp) Read length (nt) Total reads Total basepairs 10T 209 90 65,986,668 5,938,800,120 10N 203 90 66,444,438 5,979,999,420 11T 192 90 66,777,778 6,010,000,020 11N 189 90 69,005,890 6,210,530,100 12T 193 90 70,388,886 6,334,999,740 12N 194 90 61,689,482 5,552,053,380 http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3343650/ 60~70million RNA reads 10/11/2019 3Tsukuba GeneTechnologies Lab.
  4. 4. RNA sequences (short-reads) rnaseq_workshop_slides.pdf Trinity can perform reconstitution of transcripts from reads without reference genome Trinity GMAP 10/11/2019 4 Analysis of gene expression Transcript cDNA Fragmentation RNA sequencing Tsukuba GeneTechnologies Lab.
  5. 5. Reconstituted transcripts from the short reads using Trinity Mapping of the transcripts on the genome using GMAP 1. Mapping on the genome 2.Identiffcation of splicing 3.Messurement of expression amount exon by exon genome 10/11/2019 5Tsukuba GeneTechnologies Lab.
  6. 6. Up-regulated gene expression based on exon by exon 10/11/2019 6 Down-regulated gene expression based on exon by exon GeneID Gene name ExonID P-value Chromoso me Start End exon length control counts corrected experimen t count corrected log2fold_e1 _c1 n ENSG00000086848 ALG9, alpha-1,2- mannosyltransferase ENSG00000086848.E001 0.008 11 111782195 111786094 3900 2020591000.00 767.2 -21.329 ENSG00000276975 HYDIN2, axonemal central pair apparatus protein (pseudogene) ENSG00000276975.E013 0.003 1 146650299 146650451 153 58319880000000000000.00 330549.8 -47.326 GeneID Gene name Exon ID P-value Chromoso me Start End exon length control counts corrected experiment count corrected log2fold_e1 _c1 n ENSG00000112159 midasin AAA ATPase 1 ENSG00000112159.E006 0 6 89643943 89644193 251 0 270.885 55.974 ENSG00000112159 midasin AAA ATPase 1 ENSG00000112159.E005 0 6 89643512 89644193 682 0.01 1125.303 17.778 ENSG00000112159 midasin AAA ATPase 1 ENSG00000112159.E010 0.003 6 89648256 89648329 74 0.01 696.936 17.101 ENSG00000112159 midasin AAA ATPase 1 ENSG00000112159.E002 0.006 6 89642499 89643942 1444 0.01 1328.991 16.5 ENSG00000276975 HYDIN2, axonemal central pair apparatus protein (pseudogene) ENSG00000276975.E024 0.002 1 146742105 146742238 134 0.01 575.605 15.28 ENSG00000276975 HYDIN2, axonemal central pair apparatus protein (pseudogene) ENSG00000276975.E028 0.001 1 146743882 146744031 150 0.1 1865.799 14.145 ENSG00000012223 actotransferrin ENSG00000012223.E022 0.002 3 46450495 46450673 179 0.12 698.573 12.51 ENSG00000119685 tubulin tyrosine ligase like 5 ENSG00000119685.E001 0 14 75633625 75633696 72 0.06 334.814 12.486 ENSG00000012223 actotransferrin ENSG00000012223.E021 0 3 46449854 46450028 175 0.06 235.047 11.924 2n : fold change, for example, n=4 stands for 16 fold up-regulation Tsukuba GeneTechnologies Lab.
  7. 7. 10/11/2019 Tsukuba GeneTechnologies Lab. 7 10 GS:3+4 11 GS:3+4 12 GS:4+3 10 GS:3+4 11 GS:3+4 12 GS:4+3
  8. 8. 28 samples (14 cancerous and normal tissues) from 14 prostate cancer patients to be examined Supplementa ry information, Table S1 Patient information No. Age Preoperative PSA Stage Gleason Score Metastasis 1 74 9.85 T2cN0M0 3+4 0 2 73 1.36 T1cN0M0 3+3 0 3 71 9.62 T2aN0M0 2+2 0 4 54 7.44 T2cN0M0 3+3 0 5 62 7.76 T4N0M0 3+4 Bladder 6 69 4.04 T1cN0M0 3+4 0 7 52 30.33 T3bN0M0 3+4 0 8 66 10.4 T3aN0M0 3+4 0 9 56 9.78 T2cN0M0 3+4 0 10 75 10.93 T2cN0M0 3+4 0 11 57 6.99 T2cN0M0 3+4 0 12 80 22.38 T1cN0M0 4+3 0 13 75 12.69 T4N0M0 5+3 Bladder 14 73 12.8 T2bN0M0 3+2 0 Using RNA sequence data of 14 patients, we will examine the relationship between RNA expression and phenotypic feature such as Gleason Score, and stage using cluster analysis and principal component analysis. We will also examine the performance of our system. 10/11/2019 8Tsukuba GeneTechnologies Lab.
  9. 9. 10/11/2019 Tsukuba GeneTechnologies Lab. 9
  10. 10. 10/11/2019 Tsukuba GeneTechnologies Lab. 10 Clustering using 100 exons with P-value<0.01 selected from less small values of log2(e1/c1)
  11. 11. Results of 28 samples from 14 patients Supplementary information, Table S1 Patient information No. Age Preoperative PSA Stage Gleason Score Metastasis 1 74 9.85 T2cN0M0 3+4 0 2 73 1.36 T1cN0M0 3+3 0 3 71 9.62 T2aN0M0 2+2 0 4 54 7.44 T2cN0M0 3+3 0 5 62 7.76 T4N0M0 3+4 Bladder 6 69 4.04 T1cN0M0 3+4 0 7 52 30.33 T3bN0M0 3+4 0 8 66 10.4 T3aN0M0 3+4 0 9 56 9.78 T2cN0M0 3+4 0 10 75 10.93 T2cN0M0 3+4 0 11 57 6.99 T2cN0M0 3+4 0 12 80 22.38 T1cN0M0 4+3 0 13 75 12.69 T4N0M0 5+3 Bladder 14 73 12.8 T2bN0M0 3+2 0 10/11/2019 Tsukuba GeneTechnologies Lab. 11 Prostate cancers can be clustered into 3 groups based on the RNA analysis of 28 samples (14 cancerous and 14 normal tissues from 14 patients). These findings suggest that RNA analysis may provide additional information for prognosis of prostate cancers.
  12. 12. 10/11/2019 Tsukuba GeneTechnologies Lab. 12 Tumor Normal Example of gene showing different expression of their exons
  13. 13. 10/11/2019 Tsukuba GeneTechnologies Lab. 13 GeneID ExonID P-value Chromoso me Start End Width Strand c1 e1 log2fold_e 1_c1 ENSG00000012223 ENSG00000012223.E022 0 3 46450495 46450673 179- 8.30E-02 1341.684 13.98 ENSG00000159069 ENSG00000159069.E002 0 9 1.37E+08 1.37E+08 213- 0.064 42.079 9.36 ENSG00000141447 ENSG00000141447.E022 0 18 24271518 24271611 94- 15.497 2645.002 7.415 ENSG00000166689 ENSG00000166689.E001 0.008 11 16778295 16779020 726- 23061.567 3295639 7.159 ENSG00000179115 ENSG00000179115.E011 0.005 19 12924151 12924265 115- 74.978 7357.215 6.617 ENSG00000132824 ENSG00000132824.E004 0 20 44501073 44501300 228- 0.06 3.194 5.739 ENSG00000086848 ENSG00000086848.E046 0.001 11 1.12E+08 1.12E+08 91- 6.00E-02 3.162 5.708 ENSG00000071794 ENSG00000071794.E001 0 3 1.49E+08 1.49E+08 2246- 0.352 15.063 5.418 ENSG00000169902 ENSG00000169902.E015 0 7 66359895 66360443 549+ 0.059 2.417 5.348 ENSG00000083896 ENSG00000083896.E007 0 4 68318519 68318581 63- 0.06 2.201 5.203 ENSG00000121933 ENSG00000121933.E002 0.001 1 1.11E+08 1.11E+08 219- 0.074 2.684 5.189 ENSG00000110076 ENSG00000110076.E021 0 11 64648219 64648338 120- 0.052 1.907 5.189 ENSG00000010704 ENSG00000010704.E004 0 6 26087392 26087397 6+ 0.087 3.026 5.127 ENSG00000163931 ENSG00000163931.E015 0 3 53225932 53228149 2218- 85951230000000000.0 7291710000000.0 -13.525 ENSG00000144648 ENSG00000144648.E022 0.002 3 42835449 42835773 325+ 1588423.6 39.4 -15.3 ENSG00000099783 ENSG00000099783.E056 0.009 19 8468774 8468834 61+ 126303500.0 205.9 -19.227 ENSG00000086848 ENSG00000086848.E001 0 11 1.12E+08 1.12E+08 3900- 2261090000.0 764.7 -21.496 ENSG00000168038 ENSG00000168038.E005 0 3 41277806 41278151 346- 8526950000.0 2070.9 -21.973 ENSG00000196712 ENSG00000196712.E037 0.007 17 31258344 31258502 159+ 3675624000000000.0 142.7 -44.55 ENSG00000261801 ENSG00000261801.E055 0 15 73925270 73925505 236- 1243230000000000000000.0 65275.1 -54.08 ENSG00000012223 ENSG00000012223.E037 0 3 46484986 46485223 238- 1279571000000000000000000.0 7284.2 -67.251 Up-regulated genes in the prostate cancers Down-regulated genes 2-fold changes
  14. 14. GeneID ExonID P- value Chromoso me Start End Exon size Strand control cancer log2fold_ e1_c1 Exon sequence ENSG00000012223 ENSG00000012223.E022 0 3 4645049 5 4645067 3 179 - 8.30E- 02 1341.68 4 13.98 ATTTACATGAAATAATGCAGAAAGATG AAAATCCATGTTTATTCTTCTTGCATTT GGTGGATGCTAGTTTACACTTCGGTGG AATGGTCAGGTTCTTCCCTCGATGTGC CTTGTGCAGACTGCCCCCTGGGTTGAA GTGGGGTGTTACTACGCAGATGGAAAC AGCGGCAGAGGTATTT ENSG00000012223 ENSG00000012223.E021 0 3 4644985 4 4645002 8 175 - 2.10E- 02 251.392 13.534 ACACTTGTAATGATGCCACAGGGCACC CTCCTCCTGGCTGAGAAAAAGTTTCCC TTGTGCAAAAACACTAGGTACCTTTGC ACAGTCAGAAGGCAATTGAAAAATGTC TCACTGTACAGGCCCACGAAGTACAGT CCAATGAGAATTTTACACATGGGATCG CCCCCAGCATGAG ENSG00000141447 ENSG00000141447.E022 0 18 2427151 8 2427161 1 94 - 15.497 2645.00 2 7.415 gagagaaggagtgcaagcaggggaaatgccagatgctt ataaaaccataagatctcatgagaactcgttatcacaa gaacagaatgggagaaac Determination of RT-primer/PCR-primer, based on the exon sequences Screening of multiple tumor samples using Real time RT-PCR 10/11/2019 14Tsukuba GeneTechnologies Lab.
  15. 15. 10/11/2019 Tsukuba GeneTechnologies Lab. 15 Fusion gene transcripts History The first fusion gene[1] was described in cancer cells in the early 1980s. The finding was based on the discovery in 1960 by Peter Nowell and David Hungerford in Philadelphia of a small abnormal marker chromosome in patients with chronic myeloid leukemia - the first consistent chromosome abnormality detected in a human malignancy, later designated the Philadelphia chromosome.[2] In 1973, Janet Rowley in Chicago showed that the Philadelphia chromosome had originated through a translocation between chromosomes 9 and 22, and not through a simple deletion of chromosome 22 as was previously thought. Several investigators in the early 1980s showed that the Philadelphia chromosome translocation led to the formation of a new BCR/ABL1 fusion gene, composed of the 3'part of the ABL1 gene in the breakpoint on chromosome 9 and the 5' part of a gene called BCR in the breakpoint in chromosome 22. In 1985 it was clearly established that the fusion gene on chromosome 22 produced an abnormal chimeric BCR/ABL1 protein with the capacity to induce chronic myeloid leukemia. At present, scientists have identified 358 gene fusions involving 337 different genes. These genes have been found in practically all main subtypes of human neoplasia.[3] The identification of these fusion genes play a prominent role in being a diagnostic and prognostic marker.[4] Oncogenes It has been known for 30 years that the corresponding gene fusion plays an important role in tumorigenesis.[5] Fusion genes can contribute to tumor formation because fusion genes can produce much more active abnormal protein than non-fusion genes. Often, fusion genes are oncogenes that cause cancer; these include BCR-ABL,[6] TEL-AML1 (ALL with t(12 ; 21)), AML1-ETO (M2 AML with t(8 ; 21)), and TMPRSS2-ERG with an interstitial deletion on chromosome 21, often occurring in prostate cancer.[7] In the case of TMPRSS2-ERG, by disrupting androgen receptor (AR) signaling and inhibiting AR expression by oncogenic ETS transcription factor, the fusion product regulate the prostate cancer.[8] Most fusion genes are found from hematological cancers, sarcomas, and prostate cancer.[9][10] BCAM- AKT2 is a fusion gene that is specific and unique to high-grade serous ovarian cancer.[11] Oncogenic fusion genes may lead to a gene product with a new or different function from the two fusion partners. Alternatively, a proto- oncogene is fused to a strong promoter, and thereby the oncogenic function is set to function by an upregulation caused by the strong promoter of the upstream fusion partner. The latter is common in lymphomas, where oncogenes are juxtaposed to the promoters of the immunoglobulin genes.[12] Oncogenic fusion transcriptsmay also be caused by trans-splicing or read-through events.[13] Since chromosomal translocations play such a significant role in neoplasia, a specialized database of chromosomal aberrations and gene fusions in cancer has been created. This database is called Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer[14] https://en.wikipedia.org/wiki/Fusion_gene
  16. 16. 10/11/2019 Tsukuba GeneTechnologies Lab. 16 Currently, 39 programs are available for detection of fusion gene transcripts 1. Barnacle: http://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-14-550 2. Bellerophontes: http://bioinformatics.oxfordjournals.org/content/28/16/2114.long 3. BreakDancer: http://www.nature.com/nmeth/journal/v6/n9/abs/nmeth.1363.html 4. BreakFusion: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3389765/ 5. BreakPointer: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3561864/ 6. ChimeraScan: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3187648/ 7. Comrad: http://bioinformatics.oxfordjournals.org/content/27/11/1481.long 8. CRAC: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4053775/ 9. deFuse: http://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1001138 10. Dissect: http://bioinformatics.oxfordjournals.org/content/28/12/i179.abstract 11. EBARDenovo: http://bioinformatics.oxfordjournals.org/content/early/2013/03/01/bioinformatics.btt092 12. EricScript: http://bioinformatics.oxfordjournals.org/content/28/24/3232 13. FusionAnalyser: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3439881/ 14. FusionCatcher: http://biorxiv.org/content/early/2014/11/19/011650.full-text.pdf+html 15. FusionFinder: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3384600/ 16. FusionHunter: http://bioinformatics.oxfordjournals.org/content/27/12/1708.long 17. FusionMap: http://bioinformatics.oxfordjournals.org/content/27/14/1922 18. FusionQ: http://www.biomedcentral.com/1471-2105/14/193 19. FusionSeq: http://www.genomebiology.com/2010/11/10/R104 20. IDP-fusion: http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv562.full ・・ ・・ 39. ViralFusionSeq: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3582262/
  17. 17. 10/11/2019 Tsukuba GeneTechnologies Lab. 17 Which program(s) are good for detection of fusion gene transcripts Fusion gene検出方法の性能評価 日本人類遺伝学会第57回大会(2012年10月) ポスター http://www.rikengenesis.jp/ori/50279/pdf/poster_1.pdfより
  18. 18. 10/11/2019 Tsukuba GeneTechnologies Lab. 18 Practical detection of Fusion gene transcripts Analysis with Defuse Fused gene Assembly of short reads to make reconstituted transcripts using Trinity Fusion gene transcript Screening of fusion gene transcripts from the assembled transcript based on Trinity. Furthermore, screening of fusion gene transcripts coding amino-acid sequence (protein). Design of RT-primer Design of PCR-primer
  19. 19. 10/11/2019 Tsukuba GeneTechnologies Lab. 19 Examination of protein production for Fusion gene transcripts and its application Amino-acid coding region Amino-acid sequence Synthesized peptide Confirmation of fusion gene product by Immuno-staining in tumor tissues Vaccination of synthesized peptide Eradication of cancer
  20. 20. 2019/10/11 つくば遺伝子研究所 20 Detection rate of Fusion genes in prostate cancer samples of 14 patients In the prostate oncogenesis, chromosomal rearrangements occur, resulting generation of fusion genes. The fusion genes’ products would be pharmaceutical targets to control cancers. In addition, fusion genes would be markers to identify origin of metastasized tumors. gene1 gene1type gene1name gene2 gene2type gene2name hit ERR03102 8 ERR031030 ERR031032 ERR299297 ERR29929 8 ERR03103 8 ERR031040 ERR031042 ERR031044 ERR031018 ERR299295 ERR031022 ERR031024 ERR031026 ENSG00000100949 utr5p RABGGTA ENSG00000157379 intron DHRS1 14 1 1 1 1 1 1 1 1 1 1 1 1 1 1 ENSG00000117472 coding TSPAN1 ENSG00000085998 intron POMGNT1 14 1 1 1 1 1 1 1 1 1 1 1 1 1 1 ENSG00000125257 coding ABCC4 ENSG00000223298 intron RNY3P8 12 1 1 1 1 1 1 1 0 1 0 1 1 1 1 ENSG00000211689 coding TRGC1 ENSG00000211691 coding TRGJP 12 0 1 1 1 1 1 1 1 1 0 1 1 1 1 ENSG00000255051 intron BCAS2P1 ENSG00000165494 upstream PCF11 12 1 1 1 1 1 1 1 0 1 1 0 1 1 1 ENSG00000127863 intron TNFRSF19 ENSG00000027001 downstream MIPEP 11 0 1 1 0 1 1 1 1 0 1 1 1 1 1 ENSG00000140006 upstream WDR89 ENSG00000200693 intron U3 11 0 1 1 0 1 1 1 1 1 0 1 1 1 1 ENSG00000201966 downstream RNA5-8SP4 ENSG00000153823 intron PID1 11 1 1 1 0 1 1 1 1 1 0 1 0 1 1 ENSG00000183878 coding UTY ENSG00000223915 downstream DPPA2P1 10 0 1 0 1 1 1 1 0 1 1 1 1 1 0 ENSG00000198131 coding ZNF544 ENSG00000083842 upstream ZNF8 10 0 1 0 1 1 1 1 0 1 0 1 1 1 1 ENSG00000136936 coding XPA ENSG00000136937 intron NCBP1 9 0 0 1 0 1 1 1 1 1 0 1 1 1 0 ENSG00000156194 intron PPEF2 ENSG00000162669 intron HFM1 7 1 0 0 0 1 1 0 0 0 1 0 1 1 1 ENSG00000204385 intron SLC44A4 ENSG00000204371 coding EHMT2 7 0 0 1 0 1 1 0 0 0 0 1 1 1 1 ENSG00000237796 downstream LINC00361 ENSG00000223298 intron RNY3P8 7 0 1 0 1 1 1 1 0 0 0 1 1 0 0 ENSG00000102125 downstream TAZ ENSG00000197180 downstream BX936347.1 6 0 1 1 1 1 0 0 0 0 1 0 0 1 0 ENSG00000172175 intron MALT1 ENSG00000267501 upstream RP11-108P20.2 6 0 0 1 0 0 1 0 1 0 0 1 1 0 1 ENSG00000107018 coding RLN1 ENSG00000214195 upstream HMGN2P31 5 0 0 1 0 0 0 0 0 0 1 1 1 0 1 ENSG00000137161 coding CNPY3 ENSG00000231113 intron RP3-475N16.1 4 0 0 1 0 0 1 1 0 0 0 0 1 0 0 ENSG00000160862 coding AZGP1 ENSG00000176402 coding GJC3 4 0 0 1 1 0 0 1 0 0 0 1 0 0 0 ENSG00000160862 coding AZGP1 ENSG00000176402 intron GJC3 4 0 0 0 0 0 0 0 1 1 0 0 1 0 1 ENSG00000162669 intron HFM1 ENSG00000233654 intron AC093388.3 4 1 0 0 0 0 0 0 0 1 1 0 0 0 1 ENSG00000171988 coding JMJD1C ENSG00000165476 intron REEP3 4 0 1 0 1 0 1 0 0 0 0 0 0 1 0 ENSG00000198466 coding ZNF587 ENSG00000178935 downstream ZNF552 4 0 0 0 0 1 1 1 0 0 0 1 0 0 0 ENSG00000198952 utr3p SMG5 ENSG00000160781 utr5p PAQR6 4 0 0 1 0 0 0 1 0 0 1 1 0 0 0 ENSG00000204514 coding ZNF814 ENSG00000198466 intron ZNF587 4 0 0 0 1 1 1 0 1 0 0 0 0 0 0 ENSG00000248994 intron RP11-259O2.1 ENSG00000249731 downstream RP11-259O2.3 4 1 1 0 0 0 0 1 0 0 0 0 0 1 0 ENSG00000251321 intron GDEP ENSG00000163297 intron ANTXR2 4 0 0 0 0 0 1 1 0 0 0 1 1 0 0 ENSG00000263766 intron RP11-580I16.2 ENSG00000263766 intron RP11-580I16.2 4 0 0 1 1 1 0 0 0 0 0 0 0 1 0
  21. 21. 2019/10/11 つくば遺伝子研究所 21 Summary of the fusion genes in 14 prostate cancer samples (from 14 patients) gene1type gene1name gene2 gene2type gene2name hit utr5p RABGGTA ENSG00000157379 intron DHRS1 14/14 coding TSPAN1 ENSG00000085998 intron POMGNT1 14/14 The fusion genes above are detected 14 prostate cancer samples examined, so that the genes are possibly involved in prostate tumorigenesis. Furthermore, the product of the genes would be pharmaceutical molecular targets to control the cancerous states.

×