Effect of scd gene on milk production

528 views

Published on

  • Be the first to comment

  • Be the first to like this

Effect of scd gene on milk production

  1. 1. University of Debrecen Centre for Agricultural and Applied Economics Science Faculty of Agricultural and Food Sciences and Environmental Management Effect of Stearoyl-COA desaturase genepolymorphism on milk production traits of Hungarian Holstein Friesian cows By : Tegegn Gudeta, Jaleta (MSc thesis) Debrecen , Hungary, May 2012
  2. 2. IntroductionMarker Assisted selection in modern dairyNumber of studies conducted in large scale on candidate genes in dairy breedingSCD is hypothesiszed candidate gene  It catalyze Cis∆-9 desaturation  Mapped to chromosome 26 in bovine  SCD 1 and SCD5  Associated with milk fatty acid compositionStudies of SCD gene not conducted in HHF
  3. 3. Objectives of the studyTo estimating allele and genotype frequencies of SCD gene polymorphism(878 C/T)To determining the effect of SCD gene polymorphism on cows milk production traits
  4. 4. Materials and Methods1) Animals and Milk data Hair root samples (8-10) were collected from 277 HHF in Tedej Dairy Farm located 15 km north of Debrecen One lactation milk record data were collected for 277 HHF cows-305 day average milk yield (kg), fat yield (kg), fat percentage(%), protein yield (kg), protein percentage (%) and SCC (10,000 cell/ml)
  5. 5. 2) Study Methods Molecular Laboratory of UD DNA isolation from Hair root  3-5 hair root+ 100 µL Lysis buffer+1.5 ProteinK  Water bath for 60 min at 60 0c , for 20 min at 95 oc water bath, stored at -20 oc Spectrophotometrical Analysis-Nanodrop Spectrophotometer RT-PCR 7300
  6. 6. 3) DNA Amplification and Sequencing 7300 RT-PCR machine (Applied Biosystem) Reaction mix(10µL): 1µl DNA, 5µl 1xTaqMan MasterMix (PN 4371355, USA), 0.25µl 1xSNP probe and 3.75µl dH2O. TaqMan probe sequence: The fluorescent probe VIC: ACTTACCCACAGCTCC The fluorescent probe FAM: TTACCCGCAGCTCC SCD Primers (625µl 40x mix, Warington, UK, WA37PB): Forward Primer: CCCCGAGAGAATATTCTGGTTTCC Reverse primer : CCACTAGACGTGGTCTTGCT
  7. 7.  Amplification and Sequencing protocol  Initial steps: Activation at 950C for 10 minutes (AmpliTaq Gold DNA polymerase), Melting for 15 sec at 920C, Annealing/Extension at 600C for 1 minute (40 cycles). The SNP 878 C/T was used in this study and the nucleotide substitution was identified according to Tanguichi et al., (2004).
  8. 8. 4.) Data Analysisa)Descriptive Statistics using R software (Version: R- 2.14.2)b)Hardy-Weinberg Equationc) Analysis of Variance (ANOVA) using R software (Version: R-2.14.2)
  9. 9. Results and Discussion1. Genotypes and Allele Frequencies of SCD gene Polymorphisms  Amplification curve for CC(left) and CT(right) genotypes
  10. 10. Result of amplification curve for TT genotype (Green line)
  11. 11. Allelic discrimination of SCD genotypes (Blue-CC, Green-CT, and Red-TT)
  12. 12. Genotype and allele frequencyy of the SCD gene in the investigated Hungarian Holsteins cow population No of Animals (Genotype SCD P value X2 Frequencies in %) Allele % CC CT TT 0.04695 3.947Observed 94(34) 148(53) 35(13) C(0.61)Expected 102(37) 132(48) 43(15) T(0.39)
  13. 13. 2. Effects of SCD Genotypes on Recorded Milk Production Traits Parameter Genotype CC CT TT P value Fat (%) 3.76±0.41 3.8±0.43 3.7±0.38 0.2272 Protein (%) 3.22±0.178 3.22±0.178 3.23±0.14 0.998 SCC(X103 cell/ml) 136±106.4 116±70.2 119±72.7 0.2264 305 MY (kg) 8277.5±1301 8468.5±1542 8463.4±1294 0.5805 305 FY (kg) 310.6±52.4 321.9±55.2 313±50.6 0.2505 305 PY (kg) 266.1±38.5 272.1±45.8 272.3±36.2 0.5315Mean and standard deviation of milk production traits and its association withSCD genotypes.
  14. 14. Conclussions Higher C allele(0.61) frequency and lower T allele (0.39) frequency was reported in this study The SCD genotypes frequency in HHF herds under this study were not in Hardy-Weinberg equilibrium, the possible reason for this result may be small numbers of animals included in this study and indicating the herds were not in a random mating system SCD-878 C/T locus cannot be considered as candidate gene in milk production traits Further studies will be necessary on large number of animals to confirm the current result

×