Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Pasadena, California
ImagescourtesyofShutterstock
What do enzymes do for us?
Enzymes break down proteins and fats—
use in laundry lowers energy costs
Green chemistry
Green chemistry
Green chemistry
Fe
O
S
Cys
+
Fe
C
S
Cys
RR
AATAGCCGTTATTTCCGGATGTGCATAGCTGATTTGACCCATCCGGTACAC
CAATDACAAATCCCGATTTGATCGTGTGCGCGACATGTCTTC...
But the catalysts are not
designed to make what
we want.
And they are complicated!
AATAGCCGTTATTTCCGGATGTGCAT
AGCTGATTTGACCCATCCGGTACAC
CAATDACAAATCCCGATTTGATCGTG
TGCGCGACATGTCTTCCGGCGACAC
ATGTGTCTCTCACTCC...
AATAGCCGTTATTTCCGGATGTGCAT
AGCTGATTTGACCCATCCGGTACAC
CAATDACAAATCCCGATTTGATCGTG
TGCGCGACATGTCTTCCGGCGACAC
ATGTGTCTCTCACTCC...
MTIKEMPQPKTFGELKNL...
KETSPIPQPKTFGPLGNL...
KQASAIPQPKTYGPLKNL...
WRRRGIPGPLGYPLVGSF...
WIRKGVKGPRGLPFLGVI...
FIRKGIKGPRGF...
Humans have altered the biological world
using evolution by artificial selection for
thousands of years.
Natural mechanisms for generating
sequence diversity are limited.
Not so in the test tube.
Protein space:
VASTLY (Very much more than astronomically) large
Mostly empty
sequences20450
20 natural amino acids
EVOLUT...
Directed evolution is a molecular optimization on a fitness
landscape, where fitness is performance, defined by the user.
...
Evolution works because…
?
…the regions that life
has discovered and
explored are rich in
function.
And, at least in some ...
select/screen for
improvements
(cells)
~10
(a few)
random
mutations
4
~10 ~10
715
NO
Parent gene
(= parent protein)
Direct...
select/screen for
improvements
YES
repeat
(cells)
~10
(a few)
random
mutations
4
~10 ~10
715
NO
Parent gene
(= parent prot...
Performance
Generation
0
10
20
30
40
50
60
70
0 1 2 3 4 5 6 7
0 0 Gen1 Gen2 Gen3 Gen4 Gen5
Directed evolution by iterative...
Diabetes affects 422 million people
(5.9%) of the world’s population in 2014.5
Sit
Sitagliptin synthesis
Solvent waste
Multi-step chemical process
is expensive and generates
a lot of waste.
Toxic heavy...
Sit
Relativeproductivity
Directed enzyme evolution
Savile et al. Science, 2010, 329, 5989
Replace all that with a single e...
Sit
Relativeproductivity
Solvent waste
reduced 60%
Increased yield
from starting
materials
Directed enzyme evolution
Repla...
Sit
Replace all that with a single enzyme step!
FDA Approval in 2012
AWARD
Thomas Edison
Patent Award
Toxic heavy metals
e...
We need better cellulases to break
down biomass and generate sugars
for microbial chemicals and fuel
production.
MTIKEMPQPKTFGELKNL...
KETSPIPQPKTFGPLGNL...
KQASAIPQPKTYGPLKNL...
WRRRGIPGPLGYPLVGSF...
WIRKGVKGPRGLPFLGVI...
FIRKGIKGPRGF...
Sexual recombination populates fitness peaks
(conservative of structure and function while making
large jumps in sequence)...
Chimeric progeny
can be better than
their parents.
Sexual recombination populates fitness peaks
(conservative of structure...
We used recombination and random mutations to make
thermostable cellulases that hydrolyze more biomass at
elevated tempera...
Enzymes (and other proteins) are highly ‘evolvable’
Proteins can adapt via simple uphill walks
New functions by changing t...
How can we create whole new enzymes to expand the
chemistry of the biological world?
(catalyze reactions not known in natu...
How can an inherently conservative process like
this create novelty?
At any given time, nature takes the most probable pat...
(Molecular)
Evolution does it: the internet of living things
Crowd-sourcing problem solving for 3+ billion years: trillions
of organis...
Atrazine
• 1950–1993 non-biodegradable; accumulated in soil
• From 1993 onwards, fast degradation observed
“Novelty” is often already there.
Access to new features relies on some (even very small) functional
overlap that can be d...
Natural ‘oxene’
transfer
Non-natural
Fe-carbene
Non-natural
Fe-nitrene
We evolved heme proteins that catalyze reactions no...
Heme enzyme
Cyclopropane-containing serotonin-norepinephrine
reuptake inhibitor (SNRI) used to treat clinical depression
J...
Second most
abundant element
in the Earth’s crust
Si
14
28.0855
Silicon
...the literature is void of examples of biologica...
N
H
Si
OH
R
R
catalysts / ligands
SiR3
reagents for cross-coupling
Si
18
F-acceptors for
PET imaging
Si(i-Pr)3
Si(i-Pr)3
m...
Rhodothermus marinus cytochrome c
Si
H
MeMe
N2
Me
O
OEt
Me
O
OEt
Si
MeMeRma cyt c
+
Physically possible molecules…
Relevant to biology
Freed from the constraints of biological
function, we can explore the p...
Bacterial enzymes that mimic human drug metabolism so that
we can test the toxicity of new drug candidates
New ‘human’ enzymes to treat cancer
Proteins to monitor brain
chemistry or enable brain
stimulation with light
A palette of fluorescent sensor proteins for imaging
Better agricultural practices: combat
crop pests, effects of climate change…
Fe
O
S
Cys
+
Fe
C
S
Cys
RR
AATAGCCGTTATTTCCGGATGTGCATAGCTGATTTGACCCATCCGGTACAC
CAATDACAAATCCCGATTTGATCGTGTGCGCGACATGTCTTC...
Millennium Technology Prize Winner Frances Arnold 25.5.2016
Millennium Technology Prize Winner Frances Arnold 25.5.2016
Millennium Technology Prize Winner Frances Arnold 25.5.2016
Millennium Technology Prize Winner Frances Arnold 25.5.2016
Millennium Technology Prize Winner Frances Arnold 25.5.2016
Millennium Technology Prize Winner Frances Arnold 25.5.2016
Millennium Technology Prize Winner Frances Arnold 25.5.2016
Millennium Technology Prize Winner Frances Arnold 25.5.2016
Millennium Technology Prize Winner Frances Arnold 25.5.2016
Millennium Technology Prize Winner Frances Arnold 25.5.2016
Upcoming SlideShare
Loading in …5
×

Millennium Technology Prize Winner Frances Arnold 25.5.2016

427 views

Published on

The public lecture of Professor France Arnold, winner of the 2016 Millennium Technology Prize, given at the Aalto University on May 25, 2016.

Published in: Technology
  • Be the first to like this

Millennium Technology Prize Winner Frances Arnold 25.5.2016

  1. 1. Pasadena, California
  2. 2. ImagescourtesyofShutterstock
  3. 3. What do enzymes do for us?
  4. 4. Enzymes break down proteins and fats— use in laundry lowers energy costs
  5. 5. Green chemistry
  6. 6. Green chemistry
  7. 7. Green chemistry
  8. 8. Fe O S Cys + Fe C S Cys RR AATAGCCGTTATTTCCGGATGTGCATAGCTGATTTGACCCATCCGGTACAC CAATDACAAATCCCGATTTGATCGTGTGCGCGACATGTCTTCCGGCGACA CATGTGTCTCTCACTCCGAGAGATCGGTTAGAGTCTCGGTTAACCACACG TCCCGGATATATTTAATTGGCCGGAGAGTCTCCCGCGCGACATAAGGAGT CCTCGTTTCGAGATACGTACGGCATGGTGACACCAGTTGCCCTCTGATTC CCGGAGCCTCTTTGAAAACGTCGGGACAAATCCCGATTTGATCGTGTGCG CGACATGTCTTCCGGCGACACATGTGTCTCTCACTCCGAGAGATCGGTTA Programmable, green chemistry machines
  9. 9. But the catalysts are not designed to make what we want. And they are complicated!
  10. 10. AATAGCCGTTATTTCCGGATGTGCAT AGCTGATTTGACCCATCCGGTACAC CAATDACAAATCCCGATTTGATCGTG TGCGCGACATGTCTTCCGGCGACAC ATGTGTCTCTCACTCCGAGAGATCG GTTAGAGTCTCGGTTAACCACACGT CCCGGATATATTTAATTGGCCGGAGA GTCTCCCGCGCGACATAAGGAGTCC TCGTTTCGAGATACGTACGGCATGGT GACACCAGTTGCCCTCTGATTCCCG GAGCCTCTTTGAAAACGTCGAGTCG AATCGAAGTTCGAACCCCGGATCGG GTCCACCAACTTAGAGATGTGTGTG CGCTGACTCAGTCATTTTGACCCATC CGGTACACCAATGGGTCGGACAAAT CCCGATTTGATCGTGTGCGCGACAT GTCTTCCGGCGACACATGTGTCTCT CACTCCGAGAGATCGGTTAGAGTCT CGGTTAACCACACGTCCCGGATATAT TTAATTGGCCGGAGAGTCTCCAATAG CCGTTATTTCCGGATGTGCATAGCTG ATTTGACCCATCCGGTACACCAATGG GTCGGACAAATCCCGATTTGATCGT GTGCGCGACATGTCTTCCGGCGACA CATGTGTCTCTCACTCCGAGAGATC
  11. 11. AATAGCCGTTATTTCCGGATGTGCAT AGCTGATTTGACCCATCCGGTACAC CAATDACAAATCCCGATTTGATCGTG TGCGCGACATGTCTTCCGGCGACAC ATGTGTCTCTCACTCCGAGAGATCG GTTAGAGTCTCGGTTAACCACACGT CCCGGATATATTTAATTGGCCGGAGA GTCTCCCGCGCGACATAAGGAGTCC TCGTTTCGAGATACGTACGGCATGGT GACACCAGTTGCCCTCTGATTCCCG GAGCCTCTTTGAAAACGTCGAGTCG AATCGAAGTTCGAACCCCGGATCGG GTCCACCAACTTAGAGATGTGTGTG CGCTGACTCAGTCATTTTGACCCATC CGGTACACCAATGGGTCGGACAAAT CCCGATTTGATCGTGTGCGCGACAT GTCTTCCGGCGACACATGTGTCTCT CACTCCGAGAGATCGGTTAGAGTCT CGGTTAACCACACGTCCCGGATATAT TTAATTGGCCGGAGAGTCTCCAATAG CCGTTATTTCCGGATGTGCATAGCTG ATTTGACCCATCCGGTACACCAATGG GTCGGACAAATCCCGATTTGATCGT GTGCGCGACATGTCTTCCGGCGACA CATGTGTCTCTCACTCCGAGAGATC
  12. 12. MTIKEMPQPKTFGELKNL... KETSPIPQPKTFGPLGNL... KQASAIPQPKTYGPLKNL... WRRRGIPGPLGYPLVGSF... WIRKGVKGPRGLPFLGVI... FIRKGIKGPRGFPGIGML... WIRKGVKGPRGFPFFGVI... WIRKGVKGPRGFPFFGVI... WMRKGIKGPRGLPFFGII... WMRKGVKGPRGRPFVGVL... WRRRGVVGPMGFPVLGVF... REKIGLSGPEPHWFLGNL... REKIGLTGPEPHWFMGNL... RSSIGIPGPPVHWLWGNL... KVSKYPKGPLPLPFIGNI... ... Enzyme families are the products of millions of years of mutation and natural selection. mutation and selection Ancestral enzyme Evolution makes new enzymes extremely well. Each one is well adapted to its biological role.
  13. 13. Humans have altered the biological world using evolution by artificial selection for thousands of years.
  14. 14. Natural mechanisms for generating sequence diversity are limited.
  15. 15. Not so in the test tube.
  16. 16. Protein space: VASTLY (Very much more than astronomically) large Mostly empty sequences20450 20 natural amino acids EVOLUTION IS HARD! ~ 450 amino acids long
  17. 17. Directed evolution is a molecular optimization on a fitness landscape, where fitness is performance, defined by the user. Fitness
  18. 18. Evolution works because… ? …the regions that life has discovered and explored are rich in function. And, at least in some of its many dimensions, the fitness landscape is smooth. This allows adaptation, one step (one mutation) at a time.
  19. 19. select/screen for improvements (cells) ~10 (a few) random mutations 4 ~10 ~10 715 NO Parent gene (= parent protein) Directed evolution exploits smooth paths in the fitness landscape.
  20. 20. select/screen for improvements YES repeat (cells) ~10 (a few) random mutations 4 ~10 ~10 715 NO Parent gene (= parent protein) Evolved gene (= evolved protein) Directed evolution exploits smooth paths in the fitness landscape.
  21. 21. Performance Generation 0 10 20 30 40 50 60 70 0 1 2 3 4 5 6 7 0 0 Gen1 Gen2 Gen3 Gen4 Gen5 Directed evolution by iterative mutagenesis and screening can re-optimize the enzyme Evolved enzyme doing a new job Native enzyme doing its native job Native enzyme doing a new job
  22. 22. Diabetes affects 422 million people (5.9%) of the world’s population in 2014.5
  23. 23. Sit Sitagliptin synthesis Solvent waste Multi-step chemical process is expensive and generates a lot of waste. Toxic heavy metals
  24. 24. Sit Relativeproductivity Directed enzyme evolution Savile et al. Science, 2010, 329, 5989 Replace all that with a single enzyme step! Round of Evolution 1 10 100 1000 10000 100000 1 2 3 4 5 6 7 8 9 10 11 12 100000 10000 1000 100 10 1 Improved 70,000 fold Started here
  25. 25. Sit Relativeproductivity Solvent waste reduced 60% Increased yield from starting materials Directed enzyme evolution Replace all that with a single enzyme step! Round of Evolution 1 10 100 1000 10000 100000 1 2 3 4 5 6 7 8 9 10 11 12 100000 10000 1000 100 10 1 Improved 70,000 fold Toxic heavy metals eliminated Savile et al. Science, 2010, 329, 5989
  26. 26. Sit Replace all that with a single enzyme step! FDA Approval in 2012 AWARD Thomas Edison Patent Award Toxic heavy metals eliminated Solvent waste reduced 60% Increased yield from starting materials Savile et al. Science, 2010, 329, 5989 PRESIDENTIAL
  27. 27. We need better cellulases to break down biomass and generate sugars for microbial chemicals and fuel production.
  28. 28. MTIKEMPQPKTFGELKNL... KETSPIPQPKTFGPLGNL... KQASAIPQPKTYGPLKNL... WRRRGIPGPLGYPLVGSF... WIRKGVKGPRGLPFLGVI... FIRKGIKGPRGFPGIGML... WIRKGVKGPRGFPFFGVI... WIRKGVKGPRGFPFFGVI... WMRKGIKGPRGLPFFGII... WMRKGVKGPRGRPFVGVL... WRRRGVVGPMGFPVLGVF... REKIGLSGPEPHWFLGNL... REKIGLTGPEPHWFMGNL... RSSIGIPGPPVHWLWGNL... KVSKYPKGPLPLPFIGNI... ... We can also use products of natural evolution to breed new enzymes by recombination (molecular sex)
  29. 29. Sexual recombination populates fitness peaks (conservative of structure and function while making large jumps in sequence) Parent proteins, found in nature
  30. 30. Chimeric progeny can be better than their parents. Sexual recombination populates fitness peaks (conservative of structure and function while making large jumps in sequence)
  31. 31. We used recombination and random mutations to make thermostable cellulases that hydrolyze more biomass at elevated temperatures 0,0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 1,0 35 45 55 65 75 85 95 Cellobiose(mM) Temperature (ºC) 3C6P HJPlus HICel6 HJCel6
  32. 32. Enzymes (and other proteins) are highly ‘evolvable’ Proteins can adapt via simple uphill walks New functions by changing tiny fractions of (<2 %) of the sequence Scary fact: Many beneficial mutations are far from the active site. Directed evolution can optimize enzyme function in real time, circumventing our profound ignorance of how sequence encodes function.
  33. 33. How can we create whole new enzymes to expand the chemistry of the biological world? (catalyze reactions not known in nature)
  34. 34. How can an inherently conservative process like this create novelty? At any given time, nature takes the most probable paths (the fewest mutational ‘steps’).
  35. 35. (Molecular)
  36. 36. Evolution does it: the internet of living things Crowd-sourcing problem solving for 3+ billion years: trillions of organisms at work 24/7
  37. 37. Atrazine • 1950–1993 non-biodegradable; accumulated in soil • From 1993 onwards, fast degradation observed
  38. 38. “Novelty” is often already there. Access to new features relies on some (even very small) functional overlap that can be drawn out and optimized during evolution. Native reaction New reaction
  39. 39. Natural ‘oxene’ transfer Non-natural Fe-carbene Non-natural Fe-nitrene We evolved heme proteins that catalyze reactions not known in nature Ser Ser O O
  40. 40. Heme enzyme Cyclopropane-containing serotonin-norepinephrine reuptake inhibitor (SNRI) used to treat clinical depression Jane Wang, Hans Renata et al., ACIE (2014)
  41. 41. Second most abundant element in the Earth’s crust Si 14 28.0855 Silicon ...the literature is void of examples of biologically synthesized, either in vivo or in vitro, silicon-carbon bonds. Silicon 2009, 1, 147.
  42. 42. N H Si OH R R catalysts / ligands SiR3 reagents for cross-coupling Si 18 F-acceptors for PET imaging Si(i-Pr)3 Si(i-Pr)3 materials for organic LED biological probes and drug leads O N H H2N Me3Si O OH 18F RR 3
  43. 43. Rhodothermus marinus cytochrome c Si H MeMe N2 Me O OEt Me O OEt Si MeMeRma cyt c +
  44. 44. Physically possible molecules… Relevant to biology Freed from the constraints of biological function, we can explore the physically possible proteins to find new capabilities.
  45. 45. Bacterial enzymes that mimic human drug metabolism so that we can test the toxicity of new drug candidates
  46. 46. New ‘human’ enzymes to treat cancer
  47. 47. Proteins to monitor brain chemistry or enable brain stimulation with light
  48. 48. A palette of fluorescent sensor proteins for imaging
  49. 49. Better agricultural practices: combat crop pests, effects of climate change…
  50. 50. Fe O S Cys + Fe C S Cys RR AATAGCCGTTATTTCCGGATGTGCATAGCTGATTTGACCCATCCGGTACAC CAATDACAAATCCCGATTTGATCGTGTGCGCGACATGTCTTCCGGCGACA CATGTGTCTCTCACTCCGAGAGATCGGTTAGAGTCTCGGTTAACCACACG TCCCGGATATATTTAATTGGCCGGAGAGTCTCCCGCGCGACATAAGGAGT CCTCGTTTCGAGATACGTACGGCATGGTGACACCAGTTGCCCTCTGATTC CCGGAGCCTCTTTGAAAACGTCGGGACAAATCCCGATTTGATCGTGTGCG CGACATGTCTTCCGGCGACACATGTGTCTCTCACTCCGAGAGATCGGTTA The future of production (the bioeconomy)

×