Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

3949875 biologia-ppt-molecular-dna-e-rna


Published on

  • Be the first to comment

3949875 biologia-ppt-molecular-dna-e-rna

  1. 1. Biologia Molecular DNA Alexandre S. Osório
  2. 2. A natureza química dos genes Histórico  Miescher (1871) – Análise química com células de pus, rins, fígado, testículos, leveduras e hemácias de aves (detecção de C, H, N, O e P) = NUCLEÍNA.  Altmann (1889) – Purificação de nucleína (caráter ácido) = Ácidos Nucléicos.  Kossel (1877) – Detecção de guanina, adenina e timina. (1893) – Identificação de timina, citosina e pentose.
  3. 3. A natureza química dos genes Histórico  Levine e Jacobs (1909) – Descoberta dos nucleotídeos e caracterização do DNA e RNA.
  4. 4. A natureza química dos genes Histórico Watson e Crick (1953) – Modelo Helicoidal do DNA.
  5. 5. Identificação do DNA como material genéticoTransformação bacteriana - Griffith (1928)
  6. 6. RNA
  7. 7. Transcrição & ProcessamentoRNA: eficiente & eficaz
  8. 8. Dogma Central da BiologiaMolecular
  9. 9. TRANSCRIÇÃO• Processo pelo qual uma molécula de RNA ésintetizada a partir da informação contida naseqüência de nucleotídeos de uma molécula de DNAfita dupla.• A transcrição representa a diversidade e acomplexidade da expressão dos genes contidos emum determinado genoma.• Enquanto a síntese de DNA deve ser precisa euniforme, a transcrição reflete o estado fisiológico dacélula e, portanto, é extremamente variável paraatender às suas necessidades.
  10. 10. TRANSCRIÇÃOCaracterísticas Gerais:•Complementaridade•Antiparalelismo ( T = U)•Síntese 5 → 3‘•RNA Polimerase (RNAP): • Funções reconhecem e ligam-se desnaturam DNA mantém estável a dupla fita aberta mantém estável DNA:RNA terminam síntese restauram DNA
  11. 11. TRANSCRIÇÃO• Apenas uma das fitas do DNA é utilizada comomolde, portanto, a molécula de RNA sintetizada écomplementar à fita de DNA que lhe deu origem eidêntica à outra fita de DNA, sendo as timinassubstituídas por uracilas• Em 1960, Hurwitz, Stevens e Weiss descobriram,independentemente, uma enzima capaz de sintetizarRNA na presença de DNA fita dupla e dosnucleotídeos A, U, C, G.• Esta enzima foi denominada RNA polimerase.
  12. 12. RNA POLIMERASE• Reconhece e liga-se a seqüências específicas deDNA;• Desnatura o DNA expondo a seqüência denucleotídeos a ser copiada;• Mantém as fitas de DNA separadas na região desíntese;• Renatura o DNA na região imediatamenteposterior à da síntese;• Sozinha, ou com o auxílio de proteínasespecíficas, termina a síntese do RNA.
  13. 13. RNA POLIMERASEEm eucariotos existem vários subtipos de RNApolimerases envolvidas na síntese de RNAsespecíficos:. RNA polimerase I – localizada no nucléolo eresponsável pela síntese do RNA ribossômico. RNA polimerase II – localizada no nucleoplasmae responsável pela síntese do RNA mensageiro. RNA polimerase III – também localizada nonucleoplasma e responsável pela síntese do RNAtransportador
  14. 14. TRANSCRIÇÃO 1.INÍCIOReconhecimento de seqüências específicas no DNA 2. ALONGAMENTO Incorporação dos ribonucleotídeos 3. TERMINAÇÃOSeqüências no DNA são reconhecidas e a síntese é interrompida
  15. 15. INÍCIO DA TRANSCRIÇÃO• O DNA apresenta seqüências específicas,denominadas PROMOTORES, que sinalizamexatamente onde a síntese do RNA deve seriniciada.• Os promotores são, primeiramente,reconhecidos por fatores de transcrição que,ligados ao DNA, interagem com outros fatores,formando um complexo ao qual a RNApolimerase se associa.
  16. 16. O PROCESSAMENTO DO RNA• Os diferentes RNAs sintetizados no processode transcrição são chamados de transcritosprimários;• Na maioria das vezes, esses transcritos nãorepresentam a molécula madura, ou seja, aquelacuja seqüência e estrutura correspondem àforma final do RNA funcional;• Esses transcritos necessitam sofrermodificações que fazem parte doprocessamento do RNA.
  17. 17. PROCESSAMENTO DO mRNAO transcrito primário da molécula de mRNA é também conhecido como pré-mRNAEste RNA precursor é sintetizado no núcleo e sofre várias alterações transformado-se noque se chama mRNA maduro ou processado. O RNA maduro é, então, transportado ao citoplasma onde será traduzido
  18. 18. RNAm liga-se as Ribonucleoproteínas nucleares pequenas (snRNPs) Splicing mediado porspliciossomo:Utiliza ATP•FUNÇÃO: ajuda a clivar no sítiode splicingremove intronune os éxonsanteriores e posteriores
  19. 19. PROCESSAMENTO DO mRNASplicing:•FUNÇÃO: ajuda a clivar no sítiode splicingremove intronimpede afastamentodos éxonsune os éxons
  21. 21. Estrutura do mRNA
  22. 22. PROCESSAMENTO DO mRNA• Um transcrito primário pode ser processado dediferentes maneiras sendo que o que é intronpara um mRNA pode ser exon para outro mRNAque provém do mesmo RNA precursor• Esta diferença de processamento pode serdevida à diferença no processo de “splicing” dopré-mRNA
  23. 23. MOLÉCULAS DE RNA• RNA mensageiro – carrega a informação copiadado DNA sob a forma de inúmeros “triplets” cada umespecificando um aminoácido• RNA transportador – decifra o código representadopelo mRNA• RNA ribossômico – associa-se com uma série deproteínas para formar os ribossomos
  24. 24. TRADUÇÃO• Processo que se baseia na seqüência do mRNApara determinar e unir os aminoácidosformando, assim, a proteína.• Cada aminoácido é codificado na seqüência deDNA como um códon contendo uma seqüênciade três nucleotídeos.• Moléculas de RNA transportador transferem ainformação contida no genoma à uma seqüênciade aminoácidos nas proteínas.
  25. 25. RNA TRANSPORTADOR• Liga-se quimicamente à um aminoácidoespecífico, através da enzima aminoacil –tRNAsintetase, sendo chamado, desta forma, deaminoacil-tRNA;• Pareia com a seqüência do codon do mRNAadicionando o aminoácido que carrega à umacadeia de peptídeos crescente.
  27. 27. RIBOSSOMOSA eficiência da tradução se deve, principalmente, àligação da molécula de mRNA e dos aminoacil-tRNAs ao maior complexo RNA-proteína da célula– o ribossomo – que direciona o crescimento dacadeia polipeptídicaDurante a síntese protéica, o ribossomo se moveao longo da cadeia de mRNA interagindo comvários fatores protéicos e o tRNA
  28. 28. CÓDIGO GENÉTICOA relação entre a seqüência de bases no DNA e aseqüência correspondente de aminoácidos, na proteína, échamada de código genéticoO código genético encontra-se na forma de triplets – oscódons
  29. 29. TRADUÇÃO• O codon AUG, que codifica o aminoácidometionina, age como o codon de iniciação namaioria das moléculas de mRNA.• O tRNAMet reconhece codons AUG internos, nãocarregando nunca uma metionina formilada.• Quando AUG está colocado no início este é lidocomo uma formil-metionina; quando está dentroda região codificadora, é lido como metionina.
  30. 30. TRADUÇÃODurante a síntese de proteínas, os ribossomosdeslocam-se ao longo do mRNA, possibilitandoum pareamento entre esse e os tRNAs quecarregam os diferentes aminoácidos que irãocompor as proteínas
  31. 31. TRADUÇÃOA terminação da síntese de proteínas ocorrepelo aparecimento de códons de terminaçãona molécula de mRNAO reconhecimento desses códons é realizadopor proteínas e não por moléculas de tRNA,diferentemente do que ocorre nos outroscódons
  32. 32. Dogma Central da biologia Molecular
  33. 33. Núcleo RNA polimerase Gene Transcrição hnRNA Processamento mRNA TraduçãoCitoplasma proteína
  34. 34. Transcrição: RNA polimeraseGene ativo 5’ CG TA C 3’ A 3’ ACGTA A TGCAT AC GU A T TG 3’ C A T G 5’ 5’ A AC GU Molécula de RNA nascente
  35. 35. Tradução: aa livre Gly Ribossomo Phe His GluProteína Asp Met Ala Cys tRNA 5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA Molécula de mRNA codon Direção do avanço do ribossomo
  36. 36. Gly Phe His Glu Asp Met Ala Cys5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  37. 37. Gly Phe His Glu Met Ala Cys Asp5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  38. 38. His Gly Met Phe Ala Cys Asp Glu5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  39. 39. Ile Met His Ala Gly Cys Asp Glu Phe5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  40. 40. Lys Met Ala Ile Cys His Asp Glu Phe Gly5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  41. 41. Met Ala Lys Cys Asp Ile Glu Phe Gly His5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  42. 42. Met Ala Cys Lys Asp Glu Phe Gly His Ile5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  43. 43. Met Ala Cys Asp Leu Glu Phe Gly His Ile Lys5’ 3’ GCAUGCGACGAAUUCGGACACAUAAAA
  44. 44. Met Ala Cys Asp Met Glu Phe Gly His Ile Lys Leu5’ 3’ UGCGACGAAUUCGGACACAUAAAAUUA
  45. 45. Met Ala Cys Asp Glu Asn Phe Gly His Ile Lys Leu Met5’ 3’ GACGAAUUCGGACACAUAAAAUUAAUG
  46. 46. Met Ala Cys Asp Glu Phe Pro Gly His Ile Lys Leu Met Asn5’ 3’ GAAUUCGGACACAUAAAAUUAAUGAAC
  47. 47. Met Ala Cys Asp Glu Phe Gly Gln His Ile Lys Leu Met Asn Pro5’ 3’ UUCGGACACAUAAAAUUAAUGAACCCA
  48. 48. Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln5’ 3’ GGACACAUAAAAUUAAUGAACCCACAA
  49. 49. Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln5’ STOP 3’ CACAUAAAAUUAAUGAACCCACAAUAA
  50. 50. Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln5’ STOP 3’ AUAAAAUUAAUGAACCCACAAUAAAAA
  51. 51. Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln5’ STOP 3’ AUAAAAUUAAUGAACCCACAAUAATAC
  52. 52. Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met5’ 3’ AUAAAAUUAAUGAACCCACAAUAATAC
  53. 53. VARIAÇÃO GENÉTICA Ala Cys Asp Glu Phe =POLIMORFISMO Met Gly His Ile Gln Lys Pro Leu Asn Met 5’ 3’ AUAAAAUUAAUGAACCCACAAUAATAC Ala Cys Asp Glu Phe Met Gly His Ile Muda a Gln Lys forma e Pro Leu função Asn CYS 5’ 3’ A U A A A A U U A A U G A A C AA A C A A U A A T A C
  54. 54. REPRESENTAÇÃO LINEAR A MOLÉCULA DO DNA 5’ATTCGGCGCTATGCATGCTATGCG3’ aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa8 PROTEÍNA - Queratina- cabelo - Albumina- sangue - Hemoglobina-sangue - Estrutura do cabelo - Proteína da cor do cabelo (Melanina)
  55. 55. VARIAÇÕES GENÉTICAS Acontecem no nosso DNA Células germinativas Células somáticas Passa para os filhos Não passa para os filhos Ex. cor dos olhos Ex. câncer
  56. 56. Lembrar...RNApolimerase• É essencial na transcrição... (1ª etapa da expressão gênica)• Sem a RNA polimerase não há vida!!!• Sem RNA polimerase não há enzimas!!!!• A inibição da RNA polimerase leva à morte do organismo...
  57. 57. Correlação Clínica• Antibióticos e Toxinas que têm como alvo a RNA Polimerase: – Toxina do cogumelo Amanita phalloides ou “chapéu da morte”, altamente tóxico. – A toxina mais letal, - amanitina, inibe a subunidade maior da RNA polimerase II, inibindo assim a síntese de mRNA. • Gastrointerites, insuficiência hepática (RNA essenciais são degradados e não são substituídos). – Ação do antibiótico Rifampicina, para TB
