Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

I Jornada Actualización en Genética Reproductiva y Fertilidad

1,594 views

Published on

RGH ILLUMINA: Connecting the Continuum in Reproductive and Genetic Health, María Martínez-Fresno.

  • Be the first to comment

  • Be the first to like this

I Jornada Actualización en Genética Reproductiva y Fertilidad

  1. 1. © 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cBot, CSPro, CytoChip, DesignStudio, Epicentre, ForenSeq, Genetic Energy, GenomeStudio, GoldenGate, HiScan, HiSeq, HiSeq X, Infinium, iScan, iSelect, MiniSeq, MiSeq, MiSeqDx, MiSeq FGx, NeoPrep, NextBio, Nextera, NextSeq, Powered by Illumina, SureMDA, TruGenome, TruSeq, TruSight, Understand Your Genome, UYG, VeraCode, verifi, VeriSeq, the pumpkin orange color, and the streaming bases design are trademarks of Illumina, Inc. and/or its affiliate(s) in the US and/or other countries. All other names, logos, and other trademarks are the property of their respective owners. Connecting the Continuum in Reproductive and Genetic Health Maria Martinez-Fresno IVF Market Development, RGH 15th Dec 2016
  2. 2. 2 Global Leader in Genomic Technologies The Illumina portfolio MiSeq Focused Power NextSeq 500 Flexible PowerRegulated Power MiSeqDx Production Power HiSeq 2500 Population Power HiSeq X Ten • 95% of the worlds sequencing data • First and only to deliver $1,000 genome with X Ten System
  3. 3. 3 We Serve Many Customers Jay Flatley President and CEO Human Health Genetics Infectious Disease Research Reproductive Health Forensics Consumer Cancer BioPharm Agriculture
  4. 4. 4 We deliver genomics solutions that empower people to have control over their reproductive destiny and healthcare management. To improve pregnancy success rates and birth outcomes. Reproductive and Genetic Health Our mission
  5. 5. 5 Reproductive and Genetic Health Portfolio Addressing the Continuum Solutions that Span the Spectrum of Reproductive and Genetic Health Preconception & Fertility Pregnancy Genetic Conditions
  6. 6. 6 Reproductive and Genetic Health Portfolio Addressing the Continuum Preconception & Fertility Pregnancy Genetic Conditions BlueFuse NextSeq MiSeqDx CFTR TruSight One24sure 24sure+ CLIA Test CytoSNP-850K VeriSeq PGS CytoSNP Karyomapping NextSeq NIPT IVD- in development
  7. 7. 7 VeriSeq PGS • Next-generation PGS on MiSeq • All 24 chromosomes are screened for aneuploidy in a single test • For single cell or few cells from an embryo biopsy (day 3 and day 5) • From genomic DNA to results in 12 hours • <2.5 hours hands-on time • Data visualized in BlueFuse software
  8. 8. 8 Seamless Data Interpretation with BlueFuse
  9. 9. 9 Broader Dynamic Range than Arrays
  10. 10. 10 First PGS Publication on Illumina’s NGS Platform
  11. 11. 11 For Research Use Only. Not for use in diagnostic procedures. PGD Made Simple with Karyomap-12 Screening for Inherited Disorders Prior to Implantation
  12. 12. 12 Linkage-based PGD for Single Gene Disorders Child Affected Father (Carrier) Mother (Carrier) Embryo 1 Unaffected Embryo 2 Carrier Embryo 3 Carrier Embryo 4 Affected
  13. 13. 13 Reproductive and Genetic Health Portfolio Addressing the Continuum Preconception & Fertility Pregnancy Genetic Conditions BlueFuse NextSeq MiSeqDx CFTR TruSight One24sure 24sure+ CLIA Test CytoSNP-850K VeriSeq PGS CytoSNP Karyomapping NextSeq NIPT IVD- in development
  14. 14. 14 For Research Use Only. Not for use in diagnostic procedures. verifi® Evolution
  15. 15. 15 For Research Use Only. Not for use in diagnostic procedures. illumina NIPT, from verifi® to Tech Transfer Test Menu: • Chromosomes 21,18,13 • Optional add-on • Sex chromosomes • Microdeletion panel • Trisomies 9 and 16 HiSeq® 16 Spl Manual (Tech Transfer) Test Menu: • Chromosomes 21,18,13 • Sex chromosomes NextSeq & OnSite Server
  16. 16. 16 Next-Generation Sequencing (NGS) Method of analysis for NIPT (Non-invasive prenatal testing) Sample Preparation & Next-Gen DNA Sequencing 2Isolation & Extraction of cfDNA 1
  17. 17. 17 Massively-Parallel Sequencing (MPS) Alignment of unique cfDNA sequences Data Analysis3 CGATTTAACT …ACCACGATTTAACTGGAGTAAAGACTTCCAGGTACCGATCTAGCCT… 20–30 million “counts” per sample GACTTCCAGG Count: AGGTACCGATCGATTTAACT  Human Genome  NOT TO SCALE
  18. 18. 18 Analysis of MPS Identifies Fetal Aneuploidy Through Counting Fetal cfDNA (20%) Maternal cfDNA Chromosomes: Aneuploidy Calling 4 NOT TO SCALE 1 10% more Chr21 cfDNA in T21 2 3 …… 21 Trisomy 21 VS
  19. 19. 19 For Research Use Only. Not for use in diagnostic procedures. verifi® Test in Average Risk Pregnancies
  20. 20. 20 For Research Use Only. Not for use in diagnostic procedures. Significant Improvement vs. Serum Screening
  21. 21. 21 For Research Use Only. Not for use in diagnostic procedures. VeriSeq NIPT Next Generation In-Lab NIPT 48/96 SAMPLE BATCHES ‘Ready To Go’ cfDNA isolation to Library Prep ~1 Day TAT cfDNA Isolation to Clinical Report ExtractionIsolation Library Prep Sequencing Analysis Clinical Report Paired- End NGS 2x36bp @ 8M PCR- Free Automated on One Hamilton Fetal Fraction 66% Less sequencing CE-IVD
  22. 22. 22 Reproductive and Genetic Health Portfolio Addressing the Continuum Preconception & Fertility Pregnancy Genetic Conditions BlueFuse NextSeq MiSeqDx CFTR TruSight One24sure 24sure+ CLIA Test CytoSNP-850K VeriSeq PGS CytoSNP Karyomapping NextSeq NIPT IVD- in development
  23. 23. 23 CytoSNP-850K Exome Targeted Cytogenetics Array Exon-centric gene-level design Enriched coverage for 3,262 dosage sensitive genes Over 850,000 SNPs at 15x redundancy Detection sensitivity for mosaicism & absence of heterozygosity (AOH) Designed with input from international cytogenomics community, peer- reviewed literature, and databases – Cancer Cytogenetics Microarray Consortium (CCMC) – International Collaboration of Clinical Genomics (ICCG)
  24. 24. 24 TruSight One Comprehensive Clinical Exome Targeted Sequencing
  25. 25. 25 Perform both CFTR variant panel testing and CFTR gene sequencing on the same system MiSeqDx Instrument MiSeqDx Cystic Fibrosis 139-Variant Assay MiSeqDx Cystic Fibrosis Clinical Sequencing Assay 2-run20-run 6-run MiSeqDx Cystic Fibrosis System The First Complete NGS IVD Cystic Fibrosis Testing Solution
  26. 26. 26 Reproductive and Genetic Health Portfolio Addressing the Continuum Preconception & Fertility Pregnancy Genetic Conditions BlueFuse NextSeq MiSeqDx CFTR TruSight One24sure 24sure+ CLIA Test CytoSNP-850K VeriSeq PGS CytoSNP Karyomapping NextSeq NIPT IVD- in development
  27. 27. 27 Introducing the NextSeq 550 Sequencing and Array Scanning on a Single Platform The most successful, trusted sequencing and array technologies, available in one easy-to-use, affordable solution Seamless transition between arrays and sequencing Same flexible sequencing power as NextSeq 500
  28. 28. 28 NextSeq 550 Dual Functionality Enables Assay Expansion Across Genomics Applications Initial Support of Cytogenetic & Karyomapping Applications Same sequencing kits as NextSeq 500 Array adapter enables scanning • Infinium CytoSNP-12 • Infinium CytoSNP-850K • Infinium HumanKaryomap-12
  29. 29. Clinical Focus
  30. 30. Thank You

×