Makalah_65 Laporan akhir praktikum mikrobiologi.

5,247 views

Published on

Published in: Education

Makalah_65 Laporan akhir praktikum mikrobiologi.

  1. 1. LAPORAN AKHIR PRAKTIKUM MIKROBIOLOGI DAN BIOTEKNOLOGI PERTANIAN Disusun untuk memenuhi mata kuliah Mikrobiologi dan Bioteknologi Pertanian Semester Ganjil / Tahun 2009 Oleh Raden Bondan E B 1500110080162 Agroteknologi D PROGRAM STUDI AGROTEKNOLOGI FAKULTAS PERTANIAN UNIVERSITAS PADJADJARAN JATINANGOR
  2. 2. 2 Praktikum I Judul Mengamati morfologi bakteri dengan pengecatan tunggal dan gram Tujuan Melihat morfologi bakteri dengan menggunakan satu macam zat warna. Teori Dasar Bakteri bersifat transparan dan berukuran sangat kecil sehingga tidak dapat terlihat dengan mata telanjang. Untuk mengetahui struktur, morfologi, dan sifat kimia bakteri harus dilakukan pengecatan sel bakteri. Zat warna yang digunakan antara lain methylene blue, basic fuchsin, dan kristal violet. Zat warna ini menghasilkan ion warna yang bermuatan positif sehingga bakteri yang bermuatan negatif menarik chromophore kationik. Terdapat dua jenis zat warna yaitu basa(methylene blue) dan asam (eosin). Waktu pengecatan bakteri antara 30 detik – 2 menit tergantung pada afinitas zat warna. Beberapa pengecatan yang kita kenal yaitu pengecatan tunggal dan majemuk. Pengecatan tunggal adalah pengecatan yang menggunakan satu macam zat warna saja, sedangkan pengecatan majemuk merupakan pengecatan yang menggunakan lebih dari satu macam zat warna, contoh pengecatan Gram, Ziel-Nielsen, Burn Gins, dan lain-lain. Bahan dan Alat a. Biakan bakteri Azotobacter chroococcum b. Zat warna carbol fuchsin/methylene blue/safranin/carbol gentian violet. c. Gelas objek, Ose, Lampu spirtus, botol semprot d. Kertas saring e. Minyak imersi f. Mikroskop Cara Kerja Terdiri dari pembuatan film dan pengecatan I. Pembuatan film
  3. 3. 3 a. Bersihkan gelas objek dengan kapas beralkhohol untuk menghilangkan lemak dan mikroba yang menempel, lalu keringkan di udara. b. Buat lingkaran kecil di bagian bawah gelas objek untuk membatasi film dengan pensil gelas. c. Ambil satu ose suspensi bakteri secara aseptik, yaitu dengan cara membakar ose di atas lampu spiritus sampai memijar, kemudian dinginkan sebentar, lalu tempelkan pada bagian dalam dan tabung biakan sebelum mengambil suspensi bakteri. d. Buat film setipis mungkin di atas gelas objek di dalam batas lingkaran e. Lakukan fiksasi dengan cara melalukan film langsung di atas api secara cepat dua sampai tiga kali II. Pengecatan a. Tambahkan salah satu warna di atas film dengan waktu yang sesuai , yaitu untuk carbol fuchsin 15-20 detik, carbol gentian violet 30-45 detik dan methylene blue 3-5 menit. b. Buang zat warna lalu cuci dengan mengalirkan air menggunakan botol semprot untuk menghilangkan zat warna yang tidak terpakai c. Keringkan dengan kertas saring dengan cara ditempelkan perlahan ke atas film yang telah diwarnai d. Tambahkan satu tetes minyak imersi, lalu amati di bawah mikroskop dengan perbesaran kuat lensa objektif 100X e. Catat dan gambar morfologi bakteri. Praktikum Ib Judul Pengecatan Gram Tujuan Membedakan bakterti Gram Positif dan Gram Negatif Teori Dasar Christian Gram (1884) menemukan prosedur pengecatan Gram. Pengecatan merupakan salah satu prosedur yang paling banyak digunakan dalam klasifikasi bakteri. Secara umum bakteri
  4. 4. 4 dapat dipisahkan secara umum menjadi dua yaitu Gram Positif (organisme yang dapat menahan kompleks pewarna primer gentian violet sampai pada akhir prosedur sehingga sel tampak biru gelap atau ungu) dan organisme yang kehilangan kompleks warna ungu kristal pada waktu pembilasan dengan alkhohol sehingga bila diperiksa ternyata kosong namun kemudian terwarnai oleh pewarna tandingan. Contoh bakteri Gram Positif antara lain Basillus subtilis, Streptococcus lactis, dan Staphylococcus aureus, sedangkan bakteri Gram Negatif adalah Corynebacterium diptheri, Salmonella typhosa. Bahan dan alat a. Biakan murni Basillus subtilis b. Zat warna carbol gentian violet, fuchsin/safranin c. Larutan lugol , alkhohol 95%, minyak imersi d. Gelas objek, Ose, Lampu spritus, kertas saring e. Mikroskop Cara Kerja 1. Buat film 2. Tambahkan carbol gentian violet selama 3 menit 3. Cuci dengan air dengan mengalirkan air dari botol semprot 4. Tambahkan larutan lugol selama 1 menit 5. Tambahkan 2-3 tetes alkhohol, biarkan 30 detik sampai tidak ada zat warna larut 6. Cuci dengan air, tambahkan fuchsin/ safranin selama 1-2 menit 7. Cuci dengan air, keringkan dengan kertas saring 8. Amati di bawah mikroskop dengan perbesaran lensa objek 100 X 9. Catat dan gambar morfologi dan warna sel. Bakteri Gram Positif akan berwarna ungu, sedangkan Gram Negatif berwarna merah.
  5. 5. 5 Hasil Pengamatan Praktikum Ia danIb I. Pengecatan tunggal Genus/Spesies Bakteri : Azotobacter chrococcum (Sumber www.microbiologyprocedure.com) Genus/Spesies Bakteri : Bacillus subtilis( Sumber : http://www.microbelibrary.org) Bila dilihat dari mikroskop dengan perbesaran kuat akan tampak seperti diatas dengan zat pewarna fuchsin. Bentuk batang/basil. II. Pengecatan Gram Negatif dan Positif Genus/Spesies Bakteri : Azotobacter chrococcum (Sumber : http://filebox.vt.edu)
  6. 6. 6 Genus/Spesies Bakteri : Bacillus subtilis (Sumber : http://en.academic.ru/dic.nsf/) Pembahasan Pewarnaan sederhana ini memungkinkan dibedakannya bakteri dengan bermacam-macam tipe morfologi (coccus, vibrio, basillus, dsb) dari bahan-bahan lainnya yang ada basa olesan yang diwarnai (Hadiotomo, 1990). Faktor-faktor yang mempengaruhi pewarnaan bakteri yaitu fiksasi, peluntur warna , substrat, intensifikasi pewarnaan dan penggunaan zat warna penutup. Kesimpulan Bahwa genus bakteri Azotobacter tergolong bakteri bergram positif dan berbentuk kokus serta berwarna merah, sedangkan genus bakteri Basillus tergolong bakteri bergram negative dan berbentuk rantai serta berwarna ungu
  7. 7. 7 Praktikum II Judul Mengamati morfologi bakteri dengan pengecatan spora dan kapsul “Pengecatan spora bakteri (metode Klein dan metode Wirtz)” Tujuan Melihat bentuk spora di dalam sel bakteri Teori Bakteri dapat mengubah dirinya dari bentuk vegetatif menjadi spora apabila dalam keadaan memburuk. Pada bentuk spora kegiatan bakteri akan berhenti, tidak bermetabolisme ataupun bereproduksi (dorman). Dalam bentuk ini bakteri sangat resisten dan bisa tahan hidup dalam waktu lama meskipun dalam keadaan lingkungan yang kurang baik karena panas, kekurangan nutrien, radiasi, ultraviolet, atau adanya zat kimia toksik. Sifat spora (endospora) yang demikian itu menyebabkan dibutuhkannya perlakuan keras untuk mewarnainya. Hanya diberi perlakuan panas yang cukup, pewarna yang sesuai dapat menembus endospora. Tetapi, sekali pewarna tersebut memasuki endospora , sukar dihilangkan. Berdasarkan letak sporanya, dibagi tiga yaitu sentral, subterminal, dan terminal. Bahan dan Alat 1. Biakan murni Bacillus subtilis 2. Zat kimia/warna carbol fuchsin, methylene blue malachite green, safranin 3. Asam sulfat, alkhohol 4. Tabung reaksi, gelas objek, ose 5. Penangas air, termometer 6. Mikroskop Cara Kerja a. Metode Klein I i. Campurkan suspensi bakteri dengan carbol fuchsin dalam tabung reaksi (1:1;v/v)
  8. 8. 8 ii. Panaskan dalam penangas air selama 10 menit pada temperatur 800 C iii. Buat film dari campuran suspensi di atas iv. Celupkan ke dalam asam sulfat selama 1-2 detik v. Cuci dengan air, tambahkan methylene blue selama 3 menit vi. Cuci dengan air, keringkan dengan kertas saring vii. Amati dengan perbesaran kuat viii. Catat dan gambar morfologi dan warna sel. Spora berwarna merah sedangkan bentuk vegetatif berwarna biru. b. Metode Klein II i. Buat film dari suspensi bakteri ii. Tambahkan carbol fuchsin, panaskan sampai keluar uap (800 C selama 10 menit) iii. Langkah – langkah selanjutnya sama dengan metode Klein I c. Metode Wirtz i. Buat film dari suspensi bakteri ii. Tambahkan malachite green, panaskan sampai menguap kurang lebih selama 2 menit. iii. Cuci dengan air, tambahkan safranin selama 30 detik iv. Cuci dengan air, keringkan dengan kertas saring. v. Amati dengan perbesaran kuat. vi. Catat dan gambar morfologi sel. Spora berwarna hijau dan badan vegetatif bakteri berwarna merah muda.
  9. 9. 9 Hasil Pengamatan Bacillus subtillis Metode Klein Metode Wirtz Pembahasan Metode Klein, spora berwarna merah, sedangkan bentuk vegetatif berwarna biru. Metode Wirtz, spora berwarna hijau, sedangkan bentuk vegetatif berwarna merah muda Kesimpulan Spora terbentuk jika kondisi memburuk Letak spora, dikenal tiga macam letak, yaitu : sentral, subterminal, dan terminal Pengecatan spora terbagi menjadi dua, yaitu dengan metode Klein dan Wirtz
  10. 10. 10 Praktikum IIb Judul Pengecatan kapsul bakteri (Metode Burri-Gins dan Metode Maneval) Tujuan Melihat adanya kapsul bakteri Teori Pada bagian luar dari dinding sel beberapa jenis bakteri, terdapat suatu ekspolisakarida seperti endir(gum). Zat tersebut dapat mengelilingi bakteri dan menyerupai kapsul, maka struktur demikian disebut kapsul yang melekat kuat di dinding sel. Struktur kapsul dapat tipis atau tebal tergantung pada jenis bakteri tersebut dan jenis bahan makanan yang terkandung dalam media atau substrat. Kapsul merupakan eksresi dari dinding sel bakteri itu sendiri dan berfungsi melindungi dirinya. Adanya kapsul pada bakteri patogen mempunyai hubungan erat dengan virulensi bakteri itu sendiri. Bakteri dengan kapsul yang tebal mempunyai virulensi lebih tinggi daripada bakteri dengan kapsul yang tipis atau dengan yang tidak berkapsul sama sekali. Pengecatan kapsul bakteri disebut pengecatan negatif, karena di sini yang diwarnai adalah latar belakangnya, sedangkan objeknya sendiri kapsul tidak berwarnai. Pada metode Burri-Gins dipakai tinta cina untuk mewarnai latar belakangnya, sedangkan untuk mewarnai badan bakteri digunakan larutan fuchsin, sehingga badan bakteri berwarna merah dan kapsulnya tidak berwarna pada latar belakang yang hitam. Pada metode Maneval, untuk mewarnai badan bakteri digunakan Congo red, sedangkan untuk latar belakangnya digunakan cat Maneval. Badan bakteri akan berwarna merah sedangkan kapsul tidak berwarna pada latar belakang berwarna hijau. Bahan dan Alat a. Biakan murni Azotobacter chroococum b. Tinta cina, cat Maneval, dan media cair c. Zat kimia/warna larut fuchsin, Congo red d. Gelas objek, ose, kertas saring, minyak imersi
  11. 11. 11 e. Lampu spiritus, Mikroskop Cara Kerja A. Metode Burri-Gins a. Teteskan 3 ose suspensi bakteri di ujung gelas objek b. Teteskan 1 – 2 ose tinta cina di dekantnya, lalu campurkan c. Buat preparat hapus dengan cara mendorong ke depan dengan menggunakan gelas objek lain d. Keringkan di udara e. Tambahkan carbol fuchsin selama 1 – 2 menit f. Keringkan dengan kertas saring g. Amati dengan perbesaran kuat. h. Catat dan amati apa yang anda lihat. Kapsul tidak berwarna sedangkan badan bakteri berwarna merah dengan latar belakang berwarna hitam. B. Metode Maneval a. Teteskan 5 – 6 ose Congo red pada gelas objek b. 3 ose suspensi bakteri dicampurkan dengan congo red tadi. Buat film setipis mungkin c. Keringkan di udara d. Tambahkan cat Maneval 1 menit e. Cuci dengan air, keringkan dengan kertas saring. f. Amati dengan perbesaran kuat. g. Catat dan gambar apa yang anda lihat. Kapsul tidak berwarna sedangkan badan bakteri berwarna merah dengan latar belakang biru.
  12. 12. 12 Hasil Pengamatan Metode Burri-Gins Metode Maneval
  13. 13. 13 Pembahasan a. Metode Burri Gins dilakukan dengan Perbesaran Objektif : 100X Perbesaran Okuler : 10 X Bentuk : bulat, diplococcus Latar belakang : hitam Warna bakteri : Pink b. Metode Maneval dilakukan dengan Perbesaran Objektif : 100X Perbesaran Okuler : 10 X Bentuk : bulat, diplococcus Latar belakang : hijau kebiruan Warna bakteri : merah Kesimpulan  Pengecatan kapsul dengan metode Burri-Gins dan Maneval merupakan pengecatan negatif, karena yang diwarnai adalah latar belakang dari bakteri tersebut.  Kapsul bakteri tidak dapat di cat karena sifatnya yang tidak permanen, sebab kapsul tersebut merupakan ekskresi dari dinding sel bakteri.  Kapsul bakteri berfungsi sebagai pelindung dari pengaruh luar yang merugikan bakteri tersebut.  Pada metode Burri-Gins, latar belakang berwarna biru, badan bakteri berwarna gelap dan kapsulnya tidak berwarna.  Pada metode Maneval, latar belakang berwarna merah, badan bakteri berwarna merah dam kapsulnya tidak berwarna.
  14. 14. 14 Praktikum III Judul Pengenalan struktur mikroskopis jamur. Tujuan Mengamati atau melihat struktur jamur yaitu bentuk hifa dan spora jamur. Teori Jamur adalah mikroorganisme yang sel-selnya berinti sejati atau eukariotik, berbentuk benang, bercabang – cabang, tidak memiliki klorofil, dinding sel mengandung kitin atau selulosa atau keduanya, heterotrof, absortif dan sebagian besar tubuhnya terdiri dari bagian vegetatif berupa hifa dan generatif yaitu spora. Bagian vegetatif jamur adalah hifa – hifa yang terbentuk benang – benang halus memanjang, bersekat dan tidak bersekat. Kumpulan benang – benang hifa disebut miselium. Pada umumnya hifa memiliki tebal 0,5 - 100µm. Hifa jamur dikelompokkan menjadi dua macam, yaitu 1. Hifa seluler : miselium yang mempunyai sekat yang setiap selnya mengandung satu atau dua inti. 2. Hifa senositik : miselium yang mengandung banyak inti dan keseluruhan miselium berupa satu sel multi inti yang berkesinambungan, tubular seperti hifa, bercabang atau tidak bercabang atau miselium dibagi beberapa dinding melintang (septa), setiap segmen menjadi hifa multi inti. Jamur dapat berkembang biak dengan menggunakan dan menghasilkan spora. Spora adalah bagian reproduksi atau pembiakan yang terspesialisasi, terdiri atas satu sel atau beberapa sel. Spora ada yang memiliki flagel yang disebut zoospora, dan yang tidak memiliki flagel atau aplanospora. Bentuk dan warna spora dapat digunakan sebagai salah satu cara untuk mengidentifikasi jamur Bahan dan alat a. Beberapa spesies jamur yang ditumbuhkan dalam media PDA, dan jamur konsumsi antara lain Metharhizium, Sclerotium, Rhizopus, Trichoderma, Rhizoctonia,
  15. 15. 15 Paecillomyces, Fusarium, Jamur Tiram, Capnodium, Jamur Merang, Jamur Kuping, Neurospora, Saccharomyces. b. Jarum preparat c. Objek gelas dan cover glass d. Mikroskop Cara Kerja 1. Ambillah potongan kecil dari biakan murni dan letakkan pada gelas objek yang telah diberi satu tetes lactophenol cotton blue atau lactophenol. 2. Untuk melihat bentuk atau susunan spora maka potongan biakan dapat langsung diamati di bawah stereoscopic microscope. 3. Untuk melihat detail bentuk sporangiofor atau konidiofor dan perlekatan pada sporangium atau konidia, maka biakan harus ditutup dengan gelas penutup. Tekanlah gelas penutup pada potongan biakan yang ada sehingga memudahkan pengamatan. 4. Atur jarak lensa dan gunakan lensa objek dengan perbesaran 10X. Untuk memperjelas detail dari objek maka gunakan lensa dengan perbesaran 40X. 5. Amati secara mikroskopis karakteristik spora atau konidia, ujung konidiofor dan perlekatan antara konidia dengan konidiofor. 6. Berdasarkan karakteristik koloni dan mikroskopis maka tentukan genus jamur tersebut. 7. Jelaskan klasifikasi dari genus tersebut serta peranan yang mungkin dilakukan oleh jamur tersebut di bidang pertanian.
  16. 16. 16 Hasil pengamatan morfologi jamur. Pembahasan a. Rhizopus oligosporus Klasifikasi Kingdom : Fungi Division : Zygomycota Class : Zygomycetes Order : Mucorales Family : Mucoraceae Genus : Rhizopus Species : R. oligosporus b. Saccharomyces cerevisiae Klasifikasi Kingdom : Fungi Phylum : Ascomycota Subphylum: Saccharomycotina Class : Saccharomycetes Order : Saccharomycetales Family : Saccharomycetaceae Genus : Saccharomyces Species : S. cerevisiae c. Pacecillomyces sp. Klasifikasi Kingdom : Fungi Phylum : Ascomycota Class : Eurotiomycetes Order : Eurotiales Family : Trichocomaceae Genus : Paecilomyces d. Rhizoctonia sp. Klasifikasi Kingdom : Fungi Phylum : Basidiomycota Class : Basidiomycetes Subclass : Agaricomycetidae Order : Polyporales Family : Corticiaceae Genus : Rhizoctonia e. Sclerotium rolfsii Klasifikasi Kingdom : Fungi Division : Basidiomycota Class : Basidiomycetes Order : Agaricales Family : Typhulaceae Genus : Sclerotium Species : S. rolfsii f. Metarhizium sp Klasifikasi Kingdom : Fungi Subkingdom: Dikarya Phylum : Ascomycota Class : Sordariomycetes Order : Hypocreales Family : Clavicipitaceae Genus : Metarhizium g. Trichoderma sp Klasifikasi Kingdom : Fungi Division : Ascomycota Subdivision: Pezizomycotina Class : Sordariomycetes Order : Hypocreales Family : Hypocreaceae Genus : Trichoderma h. Neurospora sitophila Klasifikasi Kingdom : Fungi Phylum : Ascomycota Subphylum: Pezizomycotina Class : Ascomycetes Order : Sordariales Family : Sordariaceae Genus : Neurospora i. Fusarium sp Klasifikasi Kingdom : Fungi Subkingdom: Dikarya Phylum : Ascomycota
  17. 17. 17 Subphylum: Pezizomycotina Class : Sordariomycetes Order : Hypocreales Family : Nectriaceae Genus : Fusarium j. Capnodium sp. Klasifikasi Kingdom : Fungi Phylum : Ascomycota Subphylum: Pezizomycotina Class : Dothideomycetes Subclass : Dothideomycetidae Order : Capnodiales Family : Capnodiaceae Genus : Capnodium k. Jamur merang Klasifikasi Kerajaan : Fungi Divisi : Basidiomycota Kelas : Homobasidiomycetes Ordo : Agaricales Famili : Pluteaceae Genus : Volvariella Spesies : V. volvacea l. Jamur tiram Klasifikasi Kerajaan : Fungi Filum : Basidiomycota Kelas : Homobasidiomycetes Ordo : Agaricales Famili : Tricholomataceae Genus : Pleurotus Spesies : P. ostreatus
  18. 18. 18 Praktikum IV Judul Demonstrasi Rekayasa Genetika Bakteri Tujuan Mengetahui proses perbanyakan vector plasmid, transfer DNA dari plasmid Agrobacterium ke sel tanaman, dan mekanisme kinerja PCR. Alat a. Laptop b. Proyektor c. Focus Hasil pengamatan I. Tahapan memperbanyak vector plasmid yang sekuen DNA-nya telah disisipi gen asing a. Plasmid dipotong dengan enzim restriksi yaitu bagian DNA plasmid, sedangkan sekuen DNA yang dipotong adalah fragmen DNA. b. Plasmid terdiri dari cloning DNA, Ampicillin Resistance, dan Replikasi Origin. c. Sekuen DNA asing disambung dengan enzim ligase d. Bakteri E.coli ditambahkan ke dalam larutan yang berisi plasmid. e. Setelah plasmid masuk dalam bakteri yang mengandung ampicilin, diingkubasi pada suhu 370 C. f. Bakteri yang tidak mengandung plasmid dengan gen ampicilin resisten akan mati, sehingga hanya bakteri yang mengandung plasmid saja yang terus hidup. g. Bakteri memperbanyak diri, termasuk plasmid membentuk koloni. II. Transfer DNA dari Plasmid Agrobacterium ke sel tanaman a. Agrobakterium yang mengandung plasmid yang telah disisipkan gen tertentu tahan herbisida ditransformasikan ke sel daun dengan cara mengerat daun dengan scalpel yang telah dicelupkan ke Agrobakterium yang mengandung
  19. 19. 19 plasmid rekombinan. Penggunaan teknologi kultur jaringan menjadikan daun yang ditumbuhkan pada media yang mengandung zat pengatur tumbuh untuk merangsang tunas menjadi tanaman baru. Jika disemprot herbisida tanaman yang baru tumbuh serta mengandung sekuen DNA rekombinan akan hidup sedangkan yang tidak mengandung DNA rekombinan akan mati. Hal ini dikarenakan tanaman tersebut telah direkayasa genetika dengan dimasukkan sel calus melalui T-plasmid dan T-DNA transfer. Dalam hal ini, gen yang disisipi adalah ketahanan herbisida. III. PCR (Polymerase Chain Reaction) ZmES4 adalah gen yang diisolasi dari sel telur jagung dan bertanggung jawab dalam pembuahan atau fertilisasi tanaman jagung. a. Jika sekuen DNA tersebut berpasangan terdapat 623 pasang basa. b. Jika praimer yang dirancang untuk amplifikasi dari 5’ ke 3’ adalah 5’ GATATAGTTCCACCACATTA3’, annealing temperature adalah 600 C/72 0 C c. Rancangan praimer yang harus dibuat jika DNA tersebut akan diperbanyak dengan mesin PCR, sebutkan: i. Susunan nukleotida praimer ii. Annealing temperature adalah 50 – 600 C iii. Pasangan basa hasil amplifikasi DNA
  20. 20. 20 d. Pasangan basa ukuran plasmid setelah disisipkan gen ZmES4 adalah 1.073.741.766 pasangan. Pratikum V Judul Isolasi dan penentuan populasi bakteri dan jamur dari Rhizosfer, Filosfer, dan Spermosfer Tujuan Memisahkan bakteri dari jamur yang berasal dari alam seperti udara, air, tanah, rizosfer, filosfer, atau spermosfer, ataupun dari suatu suspensi yang mengandung beberapa jenis mikroba. Mengisolasi isolat bakteri dan jamur, serta mendapatkan biakan murni yaitu kultur murni yang hanya terdiri atas satu jenis isolat bakteri dan jamur. Teori Tanaman dan bagian tanaman tertentu merupakan habitat bagi mikroorganisme. Bagian tanaman yang berasosiasi spesifik dengan mikroorganisme adalah filosfer, rizosfer, dan spermosfir. Rhizosfer adalah zona kontak antara akar dan tanah yang langsung mempengaruhi metabolisme akar. Filosfer merupakan daerah permukaan tanaman yang berhubungan langsung dengan udara atmosfer, yang meliputi daun, pucuk daun, helai daun, dan kuntum bunga. Spermosfer adalah daerah yang melingkupi permukaan biji benih yang sedang bergeminasi. Terdapat tiga metode isolasi antara lain A. Metode gores Satu ose suspensi sumber isolat digoreskan ke atas permukaan plat agar, penggoresan dilakukan beberapa kali dalam satu plat agar dengan tujuan mendapatkan koloni terpisah. Plat kemudian diinkubasikan satu sampai dua hari untuk memberikan kesempatan pada mikroba membentuk koloni. Setiap koloni dianggap berasal dari satu sel mikroba. Selama masa inkubasi satu atau dua hari, plat agar akan ditumbuhi berbagai jenis koloni dengan pola pertumbuhan koloni sesuai dengan alur goresan kultur. Metode ini tidak dapat menghitung populasi mikroba dalam suatu substrat. B. Metode tuang
  21. 21. 21 Media agar steril yang belum membeku (kurang lebih 450 C) kedalam cawan petril steril yang mengandung suspensi mikroba pada volume dan pengenceran tertentu. Cawan petri yang berisi suspensi mikroba dan media agar digerakan ke kiri, ke kanan dan diputarkan beberapa kali agar suspensi bakteri tersebar merata dalam media biarkan membeku, inkubasikan selama 1 – 2 hari dengan petridish diletakkan terbalik. C. Metode replika bahan tanaman Kita menempelkan bahan makanan seperti daun, batang, atau benih ke atas plat agar selama 5 menit. Mikroba yang menempel di atas plat akan tumbuh setelah masa inkubasi 1-3 hari. I. Isolasi dan Penentuan Populasi Bakteri serta Jamur Rhizosfer Dengan Metode Tuang Tujuan Mengisolasi dan menentukan bakteri dan jamur dari rhizosfer beberapa tanaman Teori Metode perhitungan ini adalah metode tidak langsung yang banyak digunakan untuk menentukan populasi mikroba di dalam tanah. Langkahnya diawali dengan pengenceran suspensi tanah, lalu menumbuhkan mikroba yang ada dalam suspensi tanah dalam media agar. Jumlah koloni yang tumbuh menggambarkan jumlah mikroba yang terdapat di dalam suspensi sehingga satuan dalam penghitungan adalah CFU (Colony Forming Unit). Dalam metode ini diasumsikan bahwa satu koloni berasal dari satu sel mikroba. Jumlah mikroba dalam satu gram tanah (CFU/gr) dihitung dengan membagi jumlah koloni yang tumbuh dengan faktor pengenceran. Metode ini hanya menghitung bakteri hidup, dan tidak selamanya satu koloni berasal dari satu sel bakteri. Selain itu, tidak semua mikroba tanah dapat tumbuh pada media yang dipakai. Bahan dan Alat 1. Tanah rhizosfer tanaman 2. Aquades steril 3. Pipet steril ukuran 1.0 dan 10 ml, tabung reaksi steril 18 ml, cawan steril, kuas.
  22. 22. 22 4. Media agar nutrisi (3 g beef extract, 5 g pepton, 15 g agar, 1 L akuades) 5. Media Potato dextrose agar (PDA) ( 200 g kentang, 10 g dekstrosa, 15 agar-agar, 0,2 gr CaCO3, 0,2 gr MgSO47H2O, 1 L akuades) Cara Kerja a. Koleksi tanah rizosfer dengan cara mengambil tanah yang menempel di perakaran dengan bantuan kuas. Tanah non rhizofer diambil dari tanah di luar perakaran. b. Suspensikan 1 gram tanah ke dalam 9 ml akuades sehingga didapat suspensi tanah dengan pengenceran 10-1 . Kocok selama 5 menit dan biarkan selama 15 detik. c. Dengan pipet steril, ambil 1 ml suspensi tanah 10-1 dan pindahkan ke tabung berisi 9 ml akuades steril (10-2 ). Kocok sampai merata. d. Dengan cara yang sama, lakukan pengenceran sampai 10-7 . e. Dari pengenceran 10-6 , 10-7 ambil masing – masing 0,5 ml suspensi masukkan ke dalam dua cawan petri steril. Tuangkan 15 ml media agar nutrisi untuk penghitungan bakteri. Goyangkan cawan Petri supaya suspensi dan media tercampur homogen. f. Dari pengenceran 10-3 , 10-4 ambil masing – masing 0,5 ml suspensi masukkan ke dalam dua cawan Petri steril. Tuangkan 15 ml media PDA untuk penghitungan jamur. Goyangkan cawan Petri supaya suspensi dan media tercampur homogen. g. Inkubasikan selama 24 jam di dalam inkubator pada suhu 300 C h. Tentukan isolat bakteri atau jamur yang tumbuh berdasarkan karakteristik koloni i. Hitung koloni bakteri atau jamur. Jumlah koloni yang memenuhi syarat adalah 30 – 300 CFU/plat agar. j. Jumlah bakteri atau jamur per gram tanah adalah rata2 koloni/pengenceran. Hasil pengamatan populasi bakteri dan Jamur
  23. 23. 23 Hasil pengamatan karakteristik isolate bakteri dan jamur. Mikroba CFU / g tanah pada pengenceran Populasi Total (CFU/g) 10 -3 10 -4 10 -6 10 -7 Bakteri - - - Jamur 30 - 30 x 10 3 Keterangan Sebagian besar cawan petri telah ditumbuhi spora sehingga jumlah koloni jamur untuk pengenceran 10 -4 , tidak dapat ditentukan. Selain itu jumlah bakteri pada pengenceran 10-6 dan 10-7 tidak dapat ditentukan dikarenakan dinding cawan petri bakteri telah ditumbuhi spora. Kesimpulan PDA pada Jamur (Metode tuang) NA pada Bakteri (Metode tuang)
  24. 24. 24 Karakteristik jamur yang terbentuk : 1. Tepian : siliat Elevasi : Timbul Bentuk : TAk beraturan menyebar. 2. Tepian : wol Elevasi Tomabol Bentuk : Berbenang-benang 3. Tepian : Bercabang Elevasi: Tetesan Bentuk ; Bundar 4. Tepian : tak beraturan Elevasi: seperti kawah Bentuk : Bundar denga tepia menyebar 5. Tepian : Tak beraturan Elevasi: Berbukit-bukit Bentuk : filiform 6. Tepian : Seperti ikal rambut Elevasi: cembung Bentuk : bundar dengan lapisan timbul Isolat bakteri berdasarkan karakteristik koloni : a. Isolat yang terbentuk 1 jenis seperti tetesan air, berwarna krem, yang letaknya menyebar II. Isolasi bakteri dan jamur dari suspensi campuran dengan metode gores Tujuan Mengisolasi dan memperoleh biakan murni bakteri dan jamur dari rizosfer beberapa jenis tanaman. Bahan dan alat 1. Suspensi tanah dengan pengenceran 10-2 2. Media Nutrisi Agar dan Potato dextrose agar (PDA) steril. 3. Ose, Petridish steril, Lampu spiritus 4. Media agar miring NA dan PDA Cara kerja 1. Tuangkan 10 ml Media Nutrisi agar (NA) steril yang masih panas /mencair ke dalam petridish steril secara aseptik. Biarkan membeku. 2. Lakukan prosedur yang sama dengan media PDA. 3. Ambil satu ose suspensi tanah, lalu buatlah goresan – goresan pada permukaan plat agar NA dengan cara simple streak. 4. Lakukan prosedur pada point 3 ke permukaan plat agar PDA.
  25. 25. 25 5. Inkubasikan selama 24 – 48 jam sampai koloni bakteri dan jamur tumbuh. Amati koloni yang tumbuh. Setiap koloni yang terpisah adalah satu isolat. 6. Ambil satu isolat dengan menggunakan ose, tanamkan pada agar miring NA untuk bakteri dan pada agar miring PDA untuk jamur. Penanaman dilakukan dengan membuat goresan sebanyak mungkin di permukaan agar miring. 7. Inkubasikan paling sedikit 24 jam, hasilnya adalah biakan murni bakteri dan jamur. Hasil Pengamatan Kesimpulan Penanaman dengan penggoresan dilakukan untuk mengasingkan kuman agar didapatkan biakan murni. Krekteristik jamur yang teridentifikasi : Bentuk : bundar dengan lapisan timbul Tepian : Seperti wol Elevasi : Timbul Keterangan Karakteristik isolasi bakteri yang terbentuk :  Tidak dapat ditentukan dikarenakan telah tumbuh spora pada dinding cawan petri III. Isolasi bakteri dan jamur dari filosfer dan spermosfer metode replika a. Tujuan Membuat dan memperoleh biakan murni bakteri dan jamur dari filosfer dan spermosfer beberapa jenis tanaman b. Bahan dan alat
  26. 26. 26 1. Daun dan biji tanaman yang segar 2. Media Nutrisi Agar (NA) dan PDA steril 3. Pinset steril, cawan Petri steril, Ose steril, lampu spiritus. c. Cara kerja 1. Tuangkan 10 ml media Nutrisi agar steril yang masih panas atau cair ke dalam cawan Petri steril secara aseptik dan biarkan membeku. 2. Ambil satu lembar daun atau satu potongan daun dan satu biji benih, dan letakkan berdampingan di permukaan agar. 3. Tekan permukaan daun dan biji, tutup kembali cawan Petri dan biarkan selama 5 menit. 4. Angkat daun dan biji dan tutup kembali cawan Petri. 5. Kultur diinkubasikan selama 1 – 2 hari dengan posisi tutup cawan di bagian bawah. 6. Amati pertumbuhan bakteri di permukaan agar, isolat bakteri diisolasi dari koloni yang terpisah. 7. Lakukan langkah 1 – 5 dengan menggunakan media PDA untuk isolasi jamur. d. Pengamatan  Gambarkan penyebaran koloni bakteri dan jamur dari filosfer dan spermosfer di atas media agar.  Tentukan jenis koloni yang ada berdasarkan karakteristik koloni.  Hitung jumlah koloni jika memungkinkan. Hasil pengamatan
  27. 27. 27 Metode Replika Keterangan Jumlah koloni Filosphere 14 Telah ditumbuhi hifa Spermosphere 30 Telah ditumbuhi hifa Kesimpulan Karakteistik koloni jamur yang terbentuk : 1. Pada biji Bentuk: Bundar Tepian : Bercabang Elevasi: Cembung 2. Pada Daun Bentuk; Kompleks Tepian : siliat Elevasi: Tumbuh kedalam medium
  28. 28. 28 Praktikum VI Judul Uji metabolisme bakteri fotosintetik pada kondisi gelap dan terang Tujuan Membandingkan populasi sianobakteri (bakteri fotosintesis) yang ditumbuhkan pada kondisi tanpa dan dengan sinar matahari, serta membandingkan morfologi mikroskopis sianobakteri yang tumbuh pada kondisi gelap dan terang. Teori Tipe metabolisme fotoautotropik terdapat pada sianobakteri yang memiliki pigmen klorofil untuk menangkap energi cahaya dalam bentuk foton. Prosesnya, bakteri menfiksasi CO2 menjadi C6H12O6 melalui proses fotosintesis dan hanya berlangsung dalam satu tahap fotosistem. Metode untuk menentukan kemampuan proliferasi bakteri hijau adalah metode Most Probable Number. Pada metode ini suspensi tanah diencerkan dan ditumbuhkan pada media cair yang selektif sehingga hanya alga yang bersifat fotosintetik yang dapat tumbuh selama inkubasi di tempat yang mendapat cahaya. Bahan dan alat a. Tanah sawah segar dari lapisan aerob(0-3 cm dari permukaan tanah) b. Akuades steril c. Pipet steri 1 ml dan 10 ml, 30 tabung reaksi 100 ml , gelas objek dan gelas penutup d. Medium Bristol dengan N untuk menghitung sianobakteri total. Cara kerja a. Buat pengenceran tanah sampai 10-6 dengan metode yang dijelaskan sebelumnya b. Pindahkan dari pengenceran 10-1 ,10-2 dan 10-3 masing – masing 0,5 ml ke dalam lima buah tabung reaksi berisi 5 ml medium Bristol. c. Susun ke 15 tabung di tak sesuai dengan pengenceran d. Buat dua seri kultur. Inkubasikan satu seri di tempat gelap dan lainnya di tempat terang selama 14 hari.
  29. 29. 29 e. Amati pertumbuhan sianobakteri setiap minggu dengan mengidentifikasikan warna hijau di dalam larutan ataupun di dasar dan permukaan larutan. f. Catat jumlah tabung pertumbuhan positif dari setiap deret pengenceran 10-1 , 10-2 , 10-3 g. Pendugaan populasi alga ditentukan dengan metode MPN di bawah ini. h. Ambil beberapa tetes larutan dari tabung yang menunjukkan pertumbuhan, pindahkan ke gelas objek dan amati morfologi sianobakteri. Metode MPN 1. Hitung dan catat jumlah tabung pada setiap pengenceran yang menunjukkan terjadinya pertumbuhan alga. 2. Bandingkan dengan tabel probabilitas. Catat bahwa daftar kolom sebagai kode yang terdiri atas tiga buah angka yang menunjukkan jumlah nilai positif pada setiap pengenceran tiga kali berturut – turut. 3. Kode berhubungan dengan nilai 40 pada tabel probabilitas yang merupakan most probable number untuk mikroba pada pengenceran kedua yang ditentukan menurut teori probabilitas menurut teori probabilitas tertentu. 4. Berdasarkan tabel tersebut maka MPN untuk alga dalam 1 ml pengenceran 10-2 adalah 40 sehingga MPN sianobakteri / g tanah adalah 100 x 40 = 4000 MPN/g. Pengamatan. Tabung pengenceran 10 -2 Sianobakteri pada kondisi terang Tabung pengenceran 10 -3 Sianobakteri pada kondisi terang
  30. 30. 30 Cahaya Tabung positif pada pengenceran 10 -1 10 -2 10 -3 Terang 5 5 5 Gelap 0 0 0 Keterangan MPN sianobakteri ditempat terang > 1600, sedangkan MPN sianobakteri ditempat gelap < 1,8. Tabung pengenceran 10 -3 Sianobakteri pada kondisi gelap Tabung pengenceran 10 -1 Sianobakteri pada kondisi terang Tabung pengenceran 10 -2 Sianobakteri pada kondisi gelap
  31. 31. 31 Morfologi Sianobakteri ditempat terang dan gelap Kesimpulan Pada seri yang ditempatkan di tempat terang (yang mendapatkan sinar matahari cukup), semua tabung reaksi berwarna hijau. Ini berarti pada semua tabung terdapat sianobakteria yang merupakan produsen makanan dan bakteri yang dapat memfiksasi N, karena media yang digunakan pun selektif untuk bakteri yang dapat memfiksasi N.
  32. 32. 32 Praktikum VII Judul Perbanyakkan bakteri dan jamur Tujuan Untuk memproduksi inokulan bakteri dan jamur. Teori Pada prinsipnya bahwa perbanyakan bakteri dan jamur adalah menumbuhkan mikroba tersebut di dalama media cair selektif. Untuk memperbanyak bakteri heterotrof umumnya digunakan media nutrisi Azotobacter chroococcum digunakan media Ashby bebas N karena bakteri ini dapat mengikat N dari udara. Kualitas inokulan selain ditentukan oleh metabolit sekunder di dalamnya, dipengaruhi juga oleh populasi bakteri/jamurnya. Populasi bakteri diukur berdasarkan jumlah colony forming unit (CFU) per ml inokulan sedangkan populasi jamur diukur berdasarkan jumlah spora per ml inokulan. A. Perbanyakan Bakteri a. Tujuan Memproduksi inokulan bakteri pada fermentor dan menentukan populasi bakteri di dalam inokulan. b. Bahan dan Alat i. Biakan murni Bacillus subtilis / Pseudomonas sp berumur 72 jam ii. Media cair Nutrisi steril sebanyak 500 ml iii. Alkhohol 70 % iv. Ose, lampu spiritus, tabung reaksi untuk pengenceran v. Fermentor 2,5 L dilengkapi dengan pengaduk pada suhu kamar c. Cara kerja i. Masing – masing sebanyak 10 ml akuades steril ditambahkan ke dalam 2 agar miring biakan murni Bakteri, lalu keruk dengan ose permukaan koloni dan kocok dengan vortex sehingga didapatkan suspensi jamur. ii. Sterilkan fermentor dengan alkhohol 70%.
  33. 33. 33 iii. Masukkan 500 ml media nutrisi cair steril ke dalam tabung fermentor yang telah disterilkan , tambahkan suspensi bakteri sehingga didapatkan konsentrasi inokulan sebesar 4%. Pasang tutup fermentor dengan pengaduk dan set kecepatan pengaduk. iv. Inkubasikan selama 72 jam pada suhu kamar. v. Ambil sampel dari pipa di dasar tabung fermentor. vi. Lakukan pengenceran dari 1ml sampai 10-8 vii. Tuangkan 1 ml sampel dengan pengenceran 10-8 ke dalam cawan Petri steril dan tambahkan 15 ml media nutrisi agar (NA) pada suhu 450 C. Lakukan dua kali dan inkubasikan kultur di inkubator pada suhu 300 C selama 1 – 2 hari sampai terbentuk koloni bakteri. viii. Hitung jumlah koloni di setiap plot agar. d. Pengamatan Hasil Tabung Fermentor yang telah terisi inokulan bakteri Basillus subtillis
  34. 34. 34 Genus/spesies bakteri : Bacillus subtilis Gambar Plat 1 Gambar Plat 2 Jumlah koloni Populasi bakteri di dalam inokulan (CFU/g)Plat agar 1 Plat agar 2 200 100 Plat I : 200/ 10-8 = 200x108 Plat II : 100/ 10-8 = 100x108 B. Perbanyakkan Jamur a. Tujuan Memproduksi inokulan jamur pada fermentor dan menentukan populasi jamur pada inokulan b. Bahan dan alat i. Biakan murni Trichoderma berumur 72 jam ii. Media Cair PDA iii. Alkhohol 70% iv. Ose, Lampu spiritus, tabung reaksi untuk pengenceran v. Fermentor 2,5 L dilengkapi dengan pengaduk c. Cara kerja i. Masing – masing sebanyak 10 ml akuades steril ditambahkan ke dalam agar miring biakan murni jamur. Keruk dengan ose permukaan koloni dan kocok dengan vorteks sehingga didapatkan suspensi jamur.
  35. 35. 35 ii. Masukkan masing – masing 500 ml media Ashby cair ke dalam dua tabung fermentor yang telah disterilkan dengan alkhohol 70% iii. Ke dalam fermentor tersebut ditambahkan 20 ml suspensi jamur sehingga didapatkan konsentrasi inokulan sebesar 4%. Pasang tutup dengan pengaduk. iv. Inkubasikan selama 72 jam pada suhu kamar v. Ambil sampel dari pipa di dasar tabung fermentor vi. Lakukan pengenceran dari 1 ml sampel sampai 10-6 vii. Hitung populasi jamur di dalam suspensi pengenceran 10-6 dengan metode pengenceran plat pada media PDA. viii. Lakukan dua kali , inkubasikan kultur di inkubator pada suhu 300 C selama 1 – 2 hari sampai terbentuk koloni jamur. ix. Hitung jumlah koloni di setiap plat agar. d. Pengamatan C. Hasil Genus/ spesies jamur : Trichoderma sp. D. E. F. G. H. Plat 1 Plat 2 Jumlah koloni Populasi jamur di dalam inokulanPlat agar 1 Plat agar 2 4 5
  36. 36. 36 DAFTAR PUSTAKA Alexopoulos,C.J.,C.W.Mims, and M. Blackwell.1996. Introductory Mycology.John Wiley adn Sons. New York Schinner,F.,R. Ohlinger,E. Kandeler,R. Margesin.1995. Methods in Soil Biology. Springer. Berlin Davet, P. and F. Rouxel. 2000. Detection and Isolation of Soil Fungi. Science Publisher, Inc. Einfield Schinner, F., R. Ohlinger, E. Kandeler, R. Margesin. 1995. Methods in Soil Biology. Springer. Berlin. Warner, D. 1992. Sybiosis of Plants and Microbes. Chapman & Hall. London.

×