Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Diploma5

798 views

Published on

  • Hello! Who wants to chat with me? Nu photos with me here http://bit.ly/helenswee
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • Be the first to like this

Diploma5

  1. 1. UNIVERZA V LJUBLJANI FAKULTETA ZA KEMIJO IN KEMIJSKO TEHNOLOGIJO Univerzitetni študijski program BIOKEMIJA IZBIRA IN OPREDELITEV MONOKLONSKIH PROTITELES PROTI PEPTIDU IZ ZAPOREDJA MIŠJEGA PRIONSKEGA PROTEINA DIPLOMSKO DELO Primož Treven Mentorica: prof. dr. Vladka Čurin Šerbec LJUBLJANA, JUNIJ 2009
  2. 2. Izjava IZJAVA Izjavljam, da sem avtor predloženega diplomskega dela, ki sem ga opravil pod mentorstvom prof. dr. Vladke Čurin Šerbec. Primož Treven i
  3. 3. Zahvala ZAHVALA Pri nastanku tega diplomskega dela, ki sem ga opravil na Zavodu RS za transfuzijsko medicino, mi je na različne načine pomagalo veliko ljudi. Hvala lepa vsem! Posebej pa bi se rad zahvalil mentorici prof. dr. Vladki Čurin Šerbec, ki me je vzela pod svoje okrilje in me s svojim optimizmom vzpodbujala tudi takrat, ko ni šlo vse po načrtih. Posebna zahvala gre tudi delovni mentorici dr. Katrini Pretnar Hartman, ki je opravila predhodne poskuse. Hvala za uvajanje in bedenje nad mojim delom, koristne nasvete, podroben pregled diplomskega dela in nenazadnje tudi za prevoze na delo. Članicama komisije, prof. dr. Metki Renko in prof. dr. Brigiti Lenarčič, se zahvaljujem za pregled diplomskega dela. Za dobro delovno vzdušje in pomoč na vsakem koraku se zahvaljujem vsem na Centru za razvoj in izdelavo diagnostičnih reagentov. Hvala, ker ste me lepo sprejeli medse in ostanite še naprej tako dober kolektiv. Iskreno se zahvaljujem tudi staršema in vsem domačim, ki so me podpirali in verjeli vame. ii
  4. 4. Kazalo KAZALO   Izjava ...........................................................................................................................................i  Zahvala.......................................................................................................................................ii  Kazalo........................................................................................................................................iii  Kazalo slik.................................................................................................................................vi  Kazalo preglednic.....................................................................................................................vii  Okrajšave in simboli................................................................................................................viii  Povzetek ....................................................................................................................................xi  Abstract ....................................................................................................................................xii  1. Uvod....................................................................................................................................... 1  1.1 Prionske bolezni............................................................................................................... 1  1.2 Prioni................................................................................................................................ 2  1.2.1 Celični prionski protein............................................................................................. 3  1.2.2 Patološka oblika prionskega proteina........................................................................ 4  1.2.3 Pomnoževanje PrPSc .................................................................................................. 5  1.2.4 Prionski sevi.............................................................................................................. 6  1.2.5 Imunski odziv proti PrPSc .......................................................................................... 7  1.3 Mišji model v prionskih raziskavah ................................................................................. 7  1.3.1 Uporaba konvencionalnega mišjega modela............................................................. 8  1.3.2 Uporaba transgenskega mišjega modela ................................................................... 8  1.4 Monoklonska protitelesa .................................................................................................. 9  1.4.1 Generiranje imunskega odziva................................................................................ 10  1.4.2 Struktura protiteles.................................................................................................. 12  1.4.2.1 Protitelesa IgG.................................................................................................. 13  1.4.2.2 Protitelesa IgM................................................................................................. 13  1.4.3 Monoklonska protitelesa proti mišjemu prionskemu proteinu................................ 14  1.4.4 Monoklonsko protitelo V5B2.................................................................................. 16  2. Namen dela........................................................................................................................... 17  3. Materiali in metode .............................................................................................................. 18  3.1 Delo s celicami............................................................................................................... 18  3.1.1 Hibridomske celične linije ...................................................................................... 18  3.1.2 Odmrzovanje celic................................................................................................... 18  3.1.3 Gojenje celičnih kultur............................................................................................ 19  iii
  5. 5. Kazalo 3.1.4 Štetje celic ............................................................................................................... 19  3.1.5 Zamrzovanje celic ................................................................................................... 20  3.1.6 Kloniranje celičnih linij........................................................................................... 20  3.1.7 Rastna krivulja in določitev podvojitvenega časa................................................... 21  3.1.8 Priprava izčrpanih supernatantov............................................................................ 21  3.2 Postopek ELISA............................................................................................................. 22  3.2.1 Presejalni test in spremljanje ravni proizvodnje protiteles...................................... 22  3.2.2 Določanje razreda specifičnih protiteles ................................................................. 24  3.2.3 Ocena koncentracije protiteles iz umeritvene krivulje............................................ 25  3.2.4 Specifičnost protiteles ............................................................................................. 25  3.3 Molekularne metode....................................................................................................... 26  3.3.1 Izolacija RNA.......................................................................................................... 26  3.3.2 Izbor začetnih oligonukleotidov.............................................................................. 27  3.3.3 Reverzna transkripcija............................................................................................. 28  3.3.4 Sinteza druge verige cDNA in pomnoževanje z metodo verižne reakcije s polimerazo ............................................................................................................. 29  3.3.5 Agarozna gelska elektroforeza................................................................................ 30  3.3.6 Izolacija DNA iz agaroznega gela........................................................................... 30  3.3.7 Določanje nukleotidnega zaporedja ........................................................................ 31  3.3.8 Računalniška analiza nukleotidnih zaporedij.......................................................... 31  3.4 Analiza western.............................................................................................................. 32  3.4.1 Elektroforeza........................................................................................................... 32  3.4.2 Prenos na nitrocelulozno membrano....................................................................... 33  3.4.3 Imunodetekcija........................................................................................................ 34  3.5 Metoda točkovnega prenosa (dot blot)........................................................................... 34  4. Rezultati ............................................................................................................................... 35  4.1 Gojenje celičnih kultur................................................................................................... 35  4.1.1 Odmrzovanje celičnih linij...................................................................................... 35  4.1.2 Lastnosti celičnih kultur.......................................................................................... 35  4.1.3 Rastna krivulja......................................................................................................... 39  4.1.4 Kloniranje celičnih linij........................................................................................... 41  4.1.5 Primerjava titra protiteles pred in po zamrzovanju................................................. 42  4.1.6 Priprava supernatantov............................................................................................ 42  4.1.7 Koncentracija protiteles v supernatantih monoklonskih celičnih linij.................... 43  iv
  6. 6. Kazalo v 4.2 Opredelitev monoklonskih protiteles ............................................................................. 44  4.2.1 Določanje imunoglobulinskega razreda protiteles.................................................. 44  4.2.2 Opredelitev variabilnih regij monoklonskih protiteles............................................ 44  4.2.2.1 Izolacija RNA................................................................................................... 44  4.2.2.2 Reverzna transkripcija, verižna reakcija s polimerazo in agarozna gelska elektroforeza................................................................................................................. 45  4.2.2.3 Izolacija DNA iz gela....................................................................................... 48  4.2.2.4 Določanje nukleotidnega zaporedja ................................................................. 49  4.2.2.5 Primerjava nukleotidnih zaporedij ................................................................... 49  4.2.3 Opredelitev protiteles z analizo western ................................................................. 51  4.2.4 Specifičnost protiteles ............................................................................................. 53  5. Razprava............................................................................................................................... 55  6. Zaključki............................................................................................................................... 64  7. Literatura .............................................................................................................................. 65 
  7. 7. Kazalo slik KAZALO SLIK Slika 1: Shema AK zaporedja MoPrP........................................................................................ 3  Slika 2: Tridimenzionalna struktura MoPrP(123-225)............................................................... 4  Slika 3: Možni razlagi pojava prionskih sevov .......................................................................... 6  Slika 4: Postopek priprave monoklonskih protiteles.................................................................. 9  Slika 5: Kinetika primarnega in sekundarnega protitelesnega imunskaga odziva................... 11  Slika 6: Shematski prikaz zgradbe imunoglobulinov............................................................... 12  Slika 7: Merjenje absorbance pri postopku ELISA.................................................................. 24  Slika 8: Imunodetekcija PrP v različnih vzorcih MH z uporabo štirikrat redčenih supernatantov celičnih linij po gelski elektroforezi in western prenosu ................. 37  Slika 9: Začetno spremljanje ravni proizvodnje protiteles proti mP1...................................... 38  Slika 10: Rastna krivulja celične linije F9B z odstotki živih in mrtvih celic po dnevih.......... 39  Slika 11: Rastna krivulja celične linije F9P z odstotki živih in mrtvih celic po dnevih .......... 40  Slika 12: Koncentracije protiteles v supernatantih (v µg/ml) po dnevih gojenja za celični liniji F9B in F9P ................................................................................................................ 40  Slika 13: Primerjava titrov protiteles v Sni klonov celične linije F9 pred in po zamrzovanju. 42  Slika 14: Določanje razreda MAbs .......................................................................................... 44  Slika 15: Analiza produktov PCR po ločevanju z agarozno gelsko elektroforezo pri uporabi začetnih oligonukleotidov Ig_κ_konst in Ig_κ_FR1 za lahke verige, ter Ig_M in Ig_FR1.2 za težke...................................................................................................... 46  Slika 16: Analiza produktov PCR po ločevanju z agarozno gelsko elektroforezo pri uporabi začetnih oligonukleotidov za λ tip lahkih verig ........................................................ 47  Slika 17: Analiza produktov PCR za vse tri dolžine produktov pomnoževanja lahkih verig 1F7 po ločevanju z agarozno gelsko elektroforezo.......................................................... 48  Slika 18: Imunodetekcija PrP v različnih vzorcih z uporabo štirikrat redčenih supernatantov monoklonskih celičnih linij po gelski elektroforezi in western prenosu................... 52  Slika 19: Specifičnost MAbs 1F7............................................................................................. 53  Slika 20: Specifičnost MAbs 1C11 in 4F3............................................................................... 54  vi
  8. 8. Kazalo preglednic KAZALO PREGLEDNIC Preglednica 1: Pregled prionskih bolezni pri ljudeh in živalih .................................................. 2  Preglednica 2: Ugotavljanje specifičnosti protiteles ................................................................ 25  Preglednica 3: Začetni oligonukleotidi, ki smo jih uporabili pri delu...................................... 28  Preglednica 4: Ugotavljanje specifičnosti protiteles s posrednim postopkom ELISA............. 36  Preglednica 5: Osnovne razlike med linijama F9B in F9P ...................................................... 41  Preglednica 6: Potek kloniranja celičnih linij in izbrani kloni................................................. 41  Preglednica 7: Vsebnosti MAbs v supernatantih kloniranih celičnih linij............................... 43  Preglednica 8: Rezultati izolacije RNA ................................................................................... 45  Preglednica 9: Različne kombinacije začetnih oligonukleotidov pri pomnoževanju lahkih verig 1F7 in 6G8............................................................................................. 47  Preglednica 10: Koncentracije iz gela izolirane DNA ............................................................. 49  Preglednica 11: Primerjava različnih zaporedij težkih in lahkih verig .................................... 50  Preglednica 12: AK zaporedja hipervariabilnih regij lahkih in težkih verig za protitelesa izbranih klonov ............................................................................................. 50  Preglednica 13: Vzorci, uporabljeni pri analizi western .......................................................... 51  vii
  9. 9. Okrajšave in simboli OKRAJŠAVE IN SIMBOLI AK aminokislina/e APS amonijev persulfat Axyz absorbanca pri valovni dolžini xyz nm BALB/c divji tip miši β-ME beta-merkaptoetanol BSE goveja spongiformna encefalopatija (angl. bovine spongiform encephalopathy) cDNA komplementarna DNA (angl. complementary DNA) CDR regije, ki določajo komplementarnost (angl. complementarity determining regions) CFA kompletni Freundov adjuvans (angl. complete Freund's adjuvant) CHX konstantna domena težke verige (X =1, 2, 3, 4) CJB Creutzfeldt-Jakobova bolezen CL konstantna domena lahke verige CRIDR Center za razvoj in izdelavo diagnostičnih reagentov CWD kronično hiranje jelenjadi (angl. cronic wasting disease) DMEM Eaglovo minimalno esencialno gojišče, modificirano po Dulbeccu (angl. Dulbecco's modified Eagle's medium) DMSO dimetilsulfoksid DNA deoksiribonukleinska kislina (angl. deoxyribonucleic acid) dNTP mešanica deoksiribonukleozidtrifosfatov (angl. deoxyribonucleoside triphosphate) dT deoksitimidin ELISA encimsko-imunski test (angl. enzyme linked immunosorbent assay) EtBr etidijev bromid fCJB družinska CJB (angl. familial) FFI usodna družinska nespečnost (angl. fatal familial insomnia) FSE mačja spongiformna encefalopatija (angl. feline spongiform encephalopathy) FSI usodna sporadična nespečnost (fatal sporadic insomnia) GPI glikozilfosfatidilinozitol (angl. glycosylphosphatidylinositol) GSS Gerstmann-Sträussler-Scheinkerjeva bolezen HAT hipoksantin, aminopterin, timidin viii
  10. 10. Okrajšave in simboli H1, H2, H3 α-vijačnice v kristalni stukturi prionskega proteina HuPrPC celična oblika človeškega prionskega proteina HuPrPSc patološka oblika človeškega prionskega proteina iCJB iatrogena CJB Ig_FR1.X degenerirani začetni oligonukleotidi, ki se prilegajo variabilnim regijam κ težkih verig (X = 1,2) Ig_VλX začetni oligonukleotidi, ki se prilegajo variabilni regiji lahke verige λ (X =1,3)  Ig_κ_FR1 degenerirani začetni oligonukleotidi, ki se prilegajo variabilnim regijam κ lahkih verig Ig_κ_konst začetni oligonukleotidi, ki se prilegajo konstantni regiji lahke verige κ Ig_λX začetni oligonukleotidi, ki se prilegajo konstantni regiji lahke verige λ (X =1,3)  IgM_konst začetni oligonukleotidi, ki se prilegajo konstantni regiji težke verige μ IgX imunoglobulin razreda X (X =A, E, G, D, M) IHK imunohistokemija in vitro lat. v laboratorijskih razmerah in vivo lat. v živem organizmu KLH hemocianin iz školjke (angl. keyhole limpet haemocyanine) M molska masa MAbs monoklonska protitelesa (angl. monoclonal antibodies) MH možganski homogenat MHC II poglavitni kompleks II tkivne skladnosti (angl. major histocompatibility complex II) MoPrP mišji prionski protein (angl. mouse prion protein) MoPrPC celična oblika mišjega prionskega proteina MoPrPSc patološka oblika mišjega prionskega proteina mP1 peptid z zaporedjem aminokislin, ki ustreza zaporedju mišjega prionskega proteina med mestoma 213 in 225 mP20C peptid z zaporedjem aminokislin, ki ustreza zaporedju mišjega prionskega proteina med mestoma 213 in 232 mP20N peptid z zaporedjem aminokislin, ki ustreza zaporedju mišjega prionskega proteina med mestoma 206 in 225 mRNA informacijska RNA (angl. messenger RNA) NaDS natrijev dodecilsulfat ix
  11. 11. Okrajšave in simboli x P1 peptid z zaporedjem aminokislin, ki ustreza zaporedju humanega prionskega proteina med mestoma 214 in 226 P1C-S peptid P1 s spremenjenim cisteinom v serin P1scr naključni peptid, sestavljen iz istih AK kot P1 P1YY-AA peptid P1 s spremenjenima tirozinoma v alanin P1YY-FF peptid P1 s spremenjenima tirozinoma v fenilalanin P20C peptid z zaporedjem aminokislin, ki ustreza zaporedju humanega prionskega proteina med mestoma 214 in 233 PCR verižna reakcija s polimerazo (angl. polymerase chain reaction) PRNP gen za človeški prionski protein PrP0/0 sev miši z izbitim genom za prionski protein PrP prionski protein PrPC celična oblika prionskega proteina PrPres na protein kinazo odporna sredica PrPSc PrPSc patološka oblika prionskega proteina recBoPrP rekombinantni goveji PrP (angl. recombinant bovine PrP) recHuPrP rekombinantni humani PrP (angl. recombinant human PrP) recMoPrP rekombinantni mišji PrP (angl. recombinant mouse PrP) RNA ribonukleinska kislina (angl. ribonucleic acid) RT reverzna transkripcija S1, S2 β-trakova v kristalni strukturi prionskega proteina sCJB sporadična CJB Sni izčrpan supernatant Sniz združeni izčrpani supernatanti iste celične linije TAE pufer, ki vsebuje Tris-acetat in EDTA TME prenosljiva encefalopatija pri kunah (angl. transmissible mink encephalopathy) TSE prenosljive spongiformne encefalopatije (angl. transmissible spongiform encephalopathies) UV ultravijolična vCJB različica CJB (angl. variant) VH variabilna domena težke verige VL variabilna domena lahke verige
  12. 12. Povzetek POVZETEK Raziskovanje prionskih bolezni v veliki meri poteka na mišjem modelu. Zato se je pojavila potreba po mišjih monoklonskih protitelesih IgG, ki bi selektivno prepoznavala patološko obliko mišjega prionskega proteina. V ta namen je bila opravljena imunizacija BALB/c miši s peptidom mP1 iz zaporedja mišjega prionskega proteina (aminokisline 213-225). Po fuziji, kloniranju in ustrezni selekciji celičnih linij smo pridobili tri različna monoklonska protitelesa. Najbolj obetavna je bila celična linija F9, ki proizvaja protitelesa, specifična za določeno konformacijo peptida mP1, ne reagirajo z rekombinantnim mišjim prionskim proteinom in ne prepoznavajo celične oblike prionskega proteina pri analizi western. V njihov epitop je vključen tirozinski par na C-koncu peptida, kar naj bi bilo značilno za protitelesa specifična za patološko obliko prionskega proteina. Vsa tri izbrana monoklonska protitelesa so razreda M, kar omejuje njihovo nadaljnjo uporabo v raziskovalne namene. Ključne besede: prionske bolezni, monoklonska protitelesa, mišji prionski protein, imunizacija s peptidom xi
  13. 13. Abstract ABSTRACT Majority of the research on prion diseases is based on the mouse model. That rises up a need for mouse IgG monoclonal antibodies which selectively recognize pathological form of mouse prion protein. To achieve that goal, BALB/c mice were immunized with peptide mP1 from mouse prion protein (and corresponds to amino acid residues 213-225). After fusion, cloning and suitable selection of hybridoma cell lines, we obtained three different monoclonal antibodies. The most prospective was the cell line F9, producing antibodies which did not react with the recombinant mouse prion protein and did not recognize cellular form of prion protein in Western blot analysis and were specific to defined conformation of peptide mP1. Part of the epitope of F9 consists of two tyrosine residues at the C-terminal part of the peptide which is supposed to be a characteristic of PrPSc specific antibodies. All three antibodies are IgM class, which limits their use in further research. Keywords: prion diseases, monoclonal antibodies, mouse prion protein, immunisation with peptide xii
  14. 14. Uvod 1. UVOD Prionske bolezni predstavljajo še eno odprto poglavje v raziskovanju bolezni, saj zanje še ne poznamo ustreznega zdravila, ki bi preprečilo smrt obolelih. V letu 2008 naj bi samo v Veliki Britaniji za različnimi oblikami Creutzfeldt-Jakobove bolezni (CJB) umrlo 95 ljudi (CJD Statistics, 2009). Prav tako še nimamo na voljo diagnostičnih sredstev, ki bi pokazala na okužbo še pred razvojem kliničnih znakov bolezni. Imunološke metode (predvsem uporaba monoklonskih protiteles) so se izkazale za zelo uporabne pri raziskavah in razvoju diagnostičnih metod, kakor tudi pri načrtovanju morebitnih načinov zdravljenja. Večina raziskav je v prvi fazi opravljena na mišjem modelu, zato bi potrebovali monoklonska protitelesa, ki bi bila specifična za mišjo patološko obliko prionskega proteina (MoPrPSc ). 1.1 PRIONSKE BOLEZNI Prionske bolezni so degenerativna obolenja osrednjega živčevja, kjer je na histoloških rezinah možganov umrlih opaziti spužvast izgled zaradi kopičenja amiloidnih plakov in pojavljanje luknjic zaradi odmiranja nevronov. Imenujemo jih tudi prenosljive spongiformne encefalopatije (TSE – angl. Transmissible Spongiform Encephalopathies), ki se lahko pojavljajo sporadično, se dedujejo ali pa prenesejo z okužbo. Poznamo jih tako pri človeku kot pri živalih (Preglednica 1), njihove poglavitne značilnosti pa so: - dolga inkubacijska doba, - počasno napredovanje bolezni, ki se konča s smrtjo, - prizadetost osrednjega živčevja, kar se kaže s pešanjem motoričnih in psihičnih sposobnosti in funkcij, - odmiranje nevronov in tvorba amiloidnih plakov, ki so posledica spremenjene celične oblike prionskega proteina. V preteklosti je bilo v zvezi s povzročiteljem TSE postavljenih veliko hipotez. Najverjetnejšo razlago za razvoj TSE pa je postavil Prusiner s sod., ki je leta 1997 zanjo dobil Nobelovo nagrado za medicino. Njegova t.i. »protein-only« hipoteza namreč trdi, da so povzročitelji prionskih bolezni proteinski kužni delci, ki jih je poimenoval prioni (angl. proteinaceous infectious particles; Prusiner, 1982). Slednji nastanejo iz normalne celične oblike prionskega proteina (PrPC ) zaradi spremembe svoje sekundarne strukture. To je pomenilo nov korak v 1
  15. 15. Uvod razumevanju bioloških znanosti, saj je do tedaj veljalo, da kužne bolezni povzročajo patogeni mikroorganizmi, ki imajo lastnosti zapisane v genomu. Teoretično je samoreplikacijo proteinov sicer predpostavil že matematik Griffith (1967), vendar praktičnih dokazov, ki bi podprli to teorijo, takrat še ni bilo. Preglednica 1: Pregled prionskih bolezni pri ljudeh in živalih. iCJB: iatrogena CJB; vCJB: različica CJB (angl. variant); fCJB: družinska CJB (angl. familial); sCJB: sporadična CJB; GSS, Gerstmann-Sträussler-Scheinkerjeva bolezen; FFI: usodna družinska nespečnost (angl. fatal familial insomnia); FSI: sporadična družinska nespečnost (angl. fatal sporadic insomnia); BSE: goveja spongiformna encefalopatija (angl. bovine spongiform encephalopathy); TME: prenosljiva encefalopatija pri kunah (angl. transmissible mink encephalopathy); CWD: kronično hiranje jelenjadi (angl. cronic wasting disease); FSE: mačja spongiformna encefalopatija (angl. feline spongiform encephalopathy) (Prusiner, 1998). bolezen  gostitelj  mehanizem nastanka bolezni  Kuru  človek (pleme Fore) obredni kanibalizem  iCJB  človek  okužba s prioni okuženega humanega darovanega tkiva,  hormonov ali preko okuženih medicinskih instrumentov vCJB  človek  najverjetneje okužba z govejimi prioni  fCJB  človek  mutacije v genu PRNP  GSS  človek  mutacije v genu PRNP  FFI  človek  mutacije v genu PRNP  sCJB  človek  somatska mutacija v genu PRNP, sporadična sprememba  PrPC  v PrPSc   FSI  človek  somatska mutacija v genu PRNP, spontana sprememba  PrPC  v PrPSc   praskavec  ovca, koza  okužba pri živalih, ki so genetsko nagnjene k bolezni  BSE  govedo  okužba z mesno‐kostno moko  TME  kuna (umetno  rejena)  okužba s prioni ovc ali goveda  CWD  jelenjad  neznan  FSE  mačka  okužba z govejim tkivom ali mesno‐kostno moko  1.2 PRIONI Kot smo že omenili, beseda prion pomeni proteinski kužni delec, ki je najverjetneje v celoti sestavljen iz patološke oblike prionskega proteina (PrPSc ). Ni še znano ali so za kužnost potrebne prehodne oblike PrPC /PrPSc (najverjetneje v obliki oligomera) ali tudi kakšne celične komponente (dejavnik X), ki naj bi skupaj tvorili osnovno kužno enoto, zato velja razlikovati med terminom prion in PrPSc obliko proteina (Aguzzi in sod., 2007). 2
  16. 16. Uvod 1.2.1 Celični prionski protein PrPC najdemo na vseh sesalskih celicah. Primerjava aminokislinskih zaporedij C-konca (ostanki 121-231) PrPC različnih vrst sesalcev je pokazala veliko podobnost (reda 90 %), iz česar sledi, da imajo enak tridimenzionalni vzorec zvitja (Billeter in sod., 1997). Mišji prionski protein (MoPrP) ima molsko maso (M) 25 do 40 kDa in je sestavljen iz 254 aminokislin (Slika 1). Prvih 22 aminokislin (AK) na N-koncu predstavlja signalni peptid in se po prehodu preko endoplazemskega retikuluma odcepi. Prav tako se odcepi zadnjih 23 AK, kar omogoči vezavo glikozil-fosfatidilinozitolnega (GPI – angl. glycosylphosphatidylinositol) sidra na serin 231 (S231), s katerim se prionski protein (PrP) vsidra v membrano na zunanji strani celične površine. V strukturi PrP najdemo štiri oktapeptidne ponovitve, ki lahko vežejo pet molekul bakra (Brown in sod., 1997). Protein je lahko N-glikoziliran na asparaginu 180 (N180) in na asparaginu 196 (N196). Tako so opisani trije možni tipi glikozilacije (ne- , mono- ali di-glikoziliran PrP) (Rudd in sod., 1999). Tridimenzionalna struktura MoPrP je določena le za fragment 123-225 AK, saj je N-del proteina nestrukturiran. Rigidni del strukture je sestavljen iz treh α-vijačnic, označenih s H1 (ostanki 143-153), H2 (174-192) in H3 (199-218), dveh kratkih antiparalelnih β-trakov S1 (127-130) in S2 (160-163) in zanke, ki jo zapira disulfidna vez med cisteinoma 178 in 213 (Slika 2). Slika 1: Shema AK zaporedja MoPrP. S sivim okvirjem sta označena peptida, ki se odcepita postranslacijsko (AK 1-22 in 232-254); z rjavim oktapeptidne ponovitve (AK 58-90); z rumenim antiparalelna β-trakova S1 in S2 (AK 127-130 in 160-163); z rdečim tri α-vijačnice A1, A2 in A3 (AK 143-153, 174-192 in 199-218); z modro dve potencialni mesti N-glikozilacije (N180 in N196); z zeleno disulfidni mostiček (C178 in C213). Z večjim okvirjem je označen peptid mP1, ki je bil uporabljen pri imunizaciji. 3
  17. 17. Uvod Do danes še ni bilo neposredno dokazano, kakšna je osnovna vloga PrP v celici. Znano je, da ima pomembno vlogo v sinapsi (Collinge in sod., 1994), celičnem signaliziranju (Mouillet- Richard s sod., 2000), adheziji, imunskem sistemu (Isaacs in sod., 2006), metabolizmu bakra in železa ter vlogo pri zaščiti pred oksidativnim stresom (Brown in sod., 1997; Singh in sod., 2009; Miele in sod., 2002). Raziskovanje na tem področju otežuje dejstvo, da miši z izbitim genom za PrP (PrP0/0 miši) ne kažejo izrazitih motenj zaradi izgube PrP (Bueler in sod., 1993). Njegovo osnovno vlogo najverjetneje nadomesti kak drug mehanizem, ali pa nima le ene poglavitne vloge temveč sodeluje pri večih procesih. Slika 2: Tridimenzionalna struktura MoPrP(123-225). Sestavljen je iz treh α-vijačnic (rdeča), označenih s H1 (ostanki 143-153), H2 (174-192) in H3 (199-218), dveh kratkih antiparalelnih β-trakov (rumena) S1 (127-130) in S2 (160-163) in zanke, ki jo zapira disulfidna vez med cisteinoma 178 in 213 (zelena). Z modro sta označeni mesti glikozilacije (N 180 in N169), z roza pa predel, ki ustreza peptidu mP1 (Billeter in sod., 1997). 1.2.2 Patološka oblika prionskega proteina Primarna struktura PrPSc je identična primarni strukturi PrPC . Kristalna struktura PrPSc še ni bila določena, ker PrPSc ni topen in je nemogoče določiti njegovo tridimenzionalno zgradbo z rentgensko difrakcijo ali jedrsko magnetno resonanco, ki sta metodi z najvišjo ločljivostjo. Z ostalimi metodami pa je bilo ugotovljeno, da se v PrPSc znatno poveča delež β-ploskev, kar naj bi pogojevalo spremenjene biofizikalne lastnosti proteina (Pan in sod., 1993). Tu je mišljena predvsem težnja po tvorbi agregatov in vlaken, netopnost v detergentih, delna 4
  18. 18. Uvod odpornost na proteinazo K in odpornost na visoko temperaturo. Ker PrP0/0 miši ne kažejo izrazitih motenj zaradi izgube PrP lahko sklepamo, da je izvor toksičnosti spremenjena oblika PrP in ne manjko aktivnega proteina PrPC . Sprva je veljalo, da so naloženi agregati osnovni vir toksičnosti, danes pa raziskovalci na tem področju menijo, da je možnih več načinov toksičnosti PrPSc : sprožitev apoptoze, poškodba celic zaradi nastanka amiloidnih vlaken, tvorba por na membrani ter s tem porušenje ionske homeostaze in nenazadnje indukcija oksidativnega stresa (Soto in Estrada, 2008). Spremenjene biofizikalne lastnosti pa omogočajo PrPSc poleg toksičnih učinkov tudi zmožnost pomnoževanja, ki je poprej pri proteinih nismo poznali. 1.2.3 Pomnoževanje PrPSc Kljub intenzivnim raziskavam na tem področju, natančni molekularni mehanizem pretvorbe PrPC v PrPSc še ni določen. Po do sedaj zbranih podatkih je najverjetnejši t.i. model zasejanja, po katerem naj bi bil ključni dogodek napačno zvitje proteina, ki s tem pridobi težnjo po tvorbi oligomerov in polimerizaciji. Ta proces naj bi tekel zelo počasi do kritičnega trenutka, ko naj bi nastal dovolj velik PrPSc oligomer, ki deluje kot katalizator (seme, matrica) za pretvorbo PrPC v PrPSc . Tvorba takega semena povzroči hitro spreminjanje PrPC v PrPSc , nalaganje na novo nastalih PrPSc na oligomer in tvorbo polimera, ki v nekem trenutku razpade na krajše oligomere in s tem tvori nova jedra polimerizacije (Soto in Estrada, 2008). Po mnenju nekaterih naj bi pri pretvorbi PrP v patološko obliko sodeloval še dejavnik X, ki pa ima do sedaj še neznano strukturo. Nekateri menijo, da je to protein (Prusiner, 1998), medtem ko drugi, da je to lahko kakšna majhna visokostrukturirana RNA (Adler in sod., 2003). Po Prusinerjevem mnenju je to tudi eden od možnih razlogov za pojav t.i. medvrstne prepreke. To je pojav, ko je za okužbo s prioni druge sesalske vrste značilna precej daljša inkubacijska doba kot pri okužbi s prioni iste vrste. Tako pri inokulaciji hrčkovih prionov v miši ni opaziti akumulacije PrPSc in posledičnega pojava bolezni (Race in sod., 2002). Razlogi za ta pojav naj bi tičali tudi v razliki PrP med dajalcem in prejemnikom in v sevu priona. 5
  19. 19. Uvod 1.2.4 Prionski sevi Še en nepojasnjen fenomen v biologiji prionov pa je pojav prionskih sevov. Prionski sevi so definirani kot kužni izolati, ki ob prenosu v identičnega gostitelja povzročijo specifične fenotipske lastnosti prionske bolezni pri obolelem gostitelju. Ločevanje prionskih sevov poteka na podlagi inkubacijskega časa pred nastopom bolezni, elektroforetske mobilnosti sredice PrPSc , ki je odporna na protein-kinazo (PrPres ), tipa vakuolizacije možganov in detekcije glikozilacijskih razlik (Slika 3). Ugotovili so, da se razmerje glikozilacijskih oblik PrPSc , iz katerih je sestavljen določen sev prionov, razlikuje od seva do seva. Prav tako se določen sev prionov preferenčno nalaga v določenem organu. Tako se na primer sev prionov, ki povzroča BSE, preferenčno nalaga v osrednjem živčevju, medtem ko sev, ki povzroča vCJB, najdemo tudi v sekundarnih limfatičnih organih. Zanimivo je tudi dejstvo, da lahko določen sev pretvori prionske proteine z drugačnim aminokislinskim zaporedjem v sev z istimi lastnostmi. Raziskovalci pojav prionskih sevov pojasnjujejo na več načinov. Nekateri menijo, da vsak sev PrP predstavlja določeno konformacijsko obliko (Slika 3: A), ki jo ta protein lahko zavzame in pod določenimi pogoji pospeši pretvorbo PrPC v enako obliko (Caughey in sod., 1999; Weissmann, 2004). Drugi pa menijo, da je sev pogojen z zastopanostjo glikozilacijskih oblik v osnovnem kužnem delcu, iz katerega nastajajo polimeri (Slika 3: B; Aguzzi in sod., 2007). Slika 3: Možni razlagi pojava prionskih sevov. A: Pojav sevov zaradi različnih konformacij PrPSc , kar vodi do izpostavitve različnih cepitvenih mest (označeno s škarjami). B: Različne značilnosti sevov zaradi zastopanosti glikozilacijskih oblik PrPSc (Aguzzi in sod., 2007). 6
  20. 20. Uvod 1.2.5 Imunski odziv proti PrPSc PrPC ni izražen samo na celicah živčnega sistema, ampak tudi na vseh ostalih celicah, vključno s celicami primarnih in sekundarnih limfatičnih organov imunskega sistema. V večjih količinah se namreč nahaja na lipidnih otočkih dendritskih celic na mestih interakcije dendritskih celic s peptid-odvisnimi T-celicami. Tako ne preseneča dejstvo, da je imunski sistem toleranten na PrPC , saj je toleranca do lastnih in lastnim podobnih proteinov ključna za normalno delovanje imunskega sistema. Pri prionskih boleznih imunski sistem najverjetneje ni aktiviran prav zaradi podobnosti med PrPSc in PrPC . Nekatere ugotovitve celo kažejo, da celice imunskega sistema znatno prispevajo k potovanju in akumulaciji prionov v osrednjem živčevju (Isaacs in sod., 2006). Želja po proučevanju imunskega odziva proti obema oblikama PrP je raziskovalce vodila do različnih poskusov imunizacije. Tako so izvedli imunizacijo s PrPSc , fibrilami PrPSc , rekombinantnimi PrP in peptidi iz zaporedja PrP, vezanimi na nosilno molekulo. Že zaradi prej omenjene imunske tolerance do lastnega PrP so imunizacije opravili na različnih živalih divjega tipa, kakor tudi na gensko spremenjenih (kunci, voluharji, hrčki, miši,...). Največ raziskav pa še vedno poteka na mišjem modelu, saj se je z možnostjo izvajanja eksperimentov na transgenskih miših, odprlo veliko novih možnosti. 1.3 MIŠJI MODEL V PRIONSKIH RAZISKAVAH Uporaba živalskih modelov je v današnjih raziskavah postala nekaj običajnega, še posebej takrat, ko gre za in vivo študije neozdravljivih bolezni pri ljudeh in tudi pri nekaterih živalih. Ker do danes še ni na razpolago celičnih linij, ki bi jih z lahkoto okužili s prioni iz izvornega organizma (npr. iz govedi, človeka, ovce,...), se zdi uporaba in vivo študij neizogibna. In vivo študije prionov lahko izvajamo v izvornem organizmu (kar pri prionskih boleznih človeka ali govedi ne pride v poštev), ali pa s prenosom v heterologno vrsto, kot je na primer laboratorijska miš. S sodobnimi metodami genetike imamo danes na voljo še transgenske miši, ki se v nekaterih pogledih že lahko primerjajo z izvornim organizmom. Tako je mišji model nepogrešljiv pri raziskavah prionskih sevov, fiziološke vloge PrPC , kužnosti prionov, mehanizmov patogeneze, učinka medvrstne prepreke, imunskega odziva in pridobivanja specifičnih protiteles (Groschup in Buschmann, 2008). 7
  21. 21. Uvod 1.3.1 Uporaba konvencionalnega mišjega modela Za opredelitev prionskih sevov se uporabljajo konvencionalni laboratorijski sevi miši (RIII, VM, C57BI). Pri raziskavah prionov je potrebno omeniti še sev miši BALB/c, ki se uporablja predvsem v imunologiji za pridobivanje monoklonskih protiteles (MAbs – angl. monoclonal antibodies). Ker pa so MAbs zelo uporabna v raziskavah in diagnostiki prionskih bolezni, se ta sev uporablja za imunizacijo z različnimi prionskimi antigeni bodisi drugih vrst bodisi iste vrste (zaradi imunske tolerance je potrebna uporaba nosilne molekule). Pozitivne lastnosti uporabe konvencionalnih sevov miši so predvsem krajši inkubacijski časi in lažje vzdrževanje. Omejitve pri uporabi teh sevov tičijo v slabi imunogenosti PrPC in PrPSc ter pojavu medvrstne prepreke, ko želimo miši okužiti s prioni druge vrste. Razvoj transgenskih miši je te težave v veliki meri odpravil (Groschup in Buschmann, 2008). 1.3.2 Uporaba transgenskega mišjega modela Prvi koraki v tej smeri so bili narejeni z namenom dokazovanja Prusinerjeve hipoteze, da je za patogenezo prionskih bolezni ključen le protein (PrP). Do danes so bili pridobljeni 4 sevi miši, ki ne izražajo PrP. Za vse velja, da PrPC nima drastičnega vpliva na njihov razvoj in da je ključen pri okužbi s PrPSc in pri razvoju TSE (Wang in Flechsig , 2003). PrP0/0 miši so zelo uporabne za pridobivanje specifičnih protiteles, usmerjenih proti različnim epitopom na PrPC ali PrPSc , saj miši ne razvijejo tolerance na PrP. Prava uporabnost transgenskega mišjega modela pa se je pokazala s transgenskimi sevi miši, ki izražajo PrPC heterolognega organizma. Do danes je na voljo že preko 50 sevov transgenskih miši, ki izražajo različne prionske proteine (mišje, ovčje, humane, kravje,...). Pri okužbi transgenske miši, ki izraža PrPC donorske vrste, ne pride do učinka medvrstne prepreke, kar omogoča natančnejše študije kužnosti določenega prionskega seva in in vivo raziskovanje vseh ostalih lastnosti PrPC in PrPSc določene vrste. Nadaljnji napredek predstavljajo sevi, ki izražajo PrPC z določeno mutacijo ali modifikacijo. Ti sevi miši so pomagali razvozlati mnoga vprašanja, povezana s prioni (Groschup in Buschmann, 2008). Seveda je potrebno opozoriti, da nivo izražanja PrPC v transgenski miši ni popolnoma enak nivoju PrPC v izvornem organizmu, kar še posebno pri študijah kužnosti ni zanemarljiv podatek. Kljub temu predstavlja mišji model dober poligon za raziskave prionskih bolezni in bo tudi v prihodnosti zagotovo pripomogel do pomembnih spoznanj. 8
  22. 22. Uvod 1.4 MONOKLONSKA PROTITELESA Pri uporabi protiteles v diagnostiki in raziskovanju je njihova poliklonskost dolga leta predstavljala težavo, saj se poliklonska protitelesa razlikujejo v epitopu, na katerega se vežejo, in v afiniteti vezave. To težavo sta leta 1975 premostila Köhler in Milstein z novo metodo, ki je še danes osnova za pridobivanje MAbs . Če želimo pridobiti MAbs proti določenemu antigenu, moramo žival imunizirati s tem antigenom. Nato iz vranice izoliramo limfocite B in jih zlijemo z mielomskimi celicami (tumorske hematopoetske celice), ki jih lahko gojimo v kulturi neomejeno dolgo (kar ne velja za limfocite B). Fuzijo običajno opravljamo ob prisotnosti polietilenglikola, ki omogoča zlitje celic. Zaradi neobičajnega števila kromosomov pri pridobljenih hibridomih, lahko pri mitotski delitvi hčerinska celica ne dobi enakega niza kromosomov (lahko pride tudi do izgube kromosoma). To lahko privede do odmrtja hibridoma ali do različnih fenotipskih sprememb, kot je na primer prenehanje proizvodnje protiteles. Da zagotovimo preživetje samo zlitim celicam, uporabimo HAT selekcijsko gojišče (hipoksantin, aminopterin in timidin). Ker običajno uporabljamo mielomske celice, ki jim manjka encim za sintezo nukleotidov po pomožni poti, uporabimo aminopterin, ki blokira normalno sintezo nukleinskih kislin. Ob dodatku hipoksantina in timidina v gojišče tako lahko preživijo le zlite celice, ki imajo funkcionalen zapis za pomožno pot po limfocitni strani fuzijskega partnerja. Ko se zlite celice razrastejo, testiramo pridobljene hibridomske linije na prisotnost željenih protiteles. Najbolj obetavne celične linije nato kloniramo in s tem pridobimo protitelesa, ki so proizvod enega klona (Slika 4). Slika 4: Postopek priprave monoklonskih protiteles (Abbas in Lichtman, 2005). 9
  23. 23. Uvod Zavedati se je potrebno, da se tudi pri zelo učinkovitih fuzijah zlije samo 1% začetnih celic in da samo eno od 100000 zlitij tvori stabilen hibrid (Harlow in Lane, 1988). Zato je za pridobitev visokospecifičnih MAbs ključnega pomena močan primarni in sekundarni imunski odziv imunizirane živali, kar privede do velikega števila za antigen specifičnih limfocitov B, ki jih potrebujemo pri fuziji. 1.4.1 Generiranje imunskega odziva Proizvodnjo protiteles proti določenemu antigenu sproži aktivacija limfocitov B. Vsak limfocit B ima na svoji membrani pritrjene imunoglobuline (razreda M ali D), specifične za določen epitop. Ko se tak limfocit B sreča s svojim antigenom, se veže nanj, kar je prvi pogoj za njegovo aktivacijo. Določeni antigeni spadajo v t.i. timusno neodvisno skupino antigenov (nekatere komponente bakterijske celične stene, nekateri proteini s ponavljajočimi se identičnimi epitopi,...), ki lahko že s samo svojo vezavo aktivirajo limfocite B. Taka aktivacija se odrazi v izdatni mitotski delitvi aktiviranih celic in povečani koncentraciji protiteles, ki pa so predvsem razreda M. Pri timusno odvisnih antigenih (predvsem proteinskih), je za aktivacijo potrebna še vezava limfocita T. Vezava antigena na B celični imunoglobulinski receptor povzroči endocitozo in delno razgradnjo antigena, ki je nato preko poglavitnega kompleksa tkivne skladnosti (MHC II – angl. major histocompatibility complex II) izpostavljen na površino limfocita B. Tako izpostavljen antigen prepozna T celica pomagalka in se preko T celičnega receptorja veže na limfocit B in ga aktivira preko izločenih citokinov in preko kompleksa CD40 (receptor/ligand). Taka aktivacija se sprva odrazi v povečani mitotski delitvi aktiviranih limfocitov in povečani proizvodnji protiteles. Značilen proces pri T celični aktivaciji je preklop izotipa težke verige, kjer začnejo namesto prvotnih protiteles IgM limfociti izločati protitelesa drugih razredov (predvsem IgG). Poveča se tudi specifičnost izločenih protiteles, čemur pravimo afinitetno zorenje (Abbas in Lichtman, 2005). Del namnoženih limfocitov B se diferencira v spominske celice, ki so zaslužne za sekundarni imunski odziv ob ponovni izpostavitvi antigenu. Takrat so takoj aktivirane spominske celice, ki se veliko hitreje namnožijo in začnejo proizvajati večje količine zelo specifičnih protiteles običajno razreda G. Generiranje močnega imunskega odziva je tako v največji meri pogojeno z izbiro ustreznega antigena. V osnovi mora imeti antigen prepoznaven epitop, ki ga bodo prepoznali 10
  24. 24. Uvod membransko vezani imunoglobulini, biti mora razgradljiv (vsaj deloma), vsebovati mora vezavni mesti za MHC II in T celični receptor ter nenazadnje biti mora večji od 3000 Da, saj manjše molekule običajno niso imunogene. Za premostitev teh težav manjše molekule (npr. peptide) običajno kovalentno vežemo na velike imunogene nosilne molekule, kot je na primer hemocianin iz školjke (KLH – angl. keyhole limpet haemocyanine). Ker pa vsi zgoraj našteti pogoji ne zagotavljajo imunskega odziva, pri imunizaciji živali uporabimo nespecifične stimulatorje imunskega odziva – adjuvanse. Njihova naloga je, da zaščitijo antigen pred hitro razgradnjo in da nespecifično vzbudijo imunski odziv. Pogosto uporabljamo kompletni Freundov adjuvans (CFA – angl. complete Freund's adjuvant), ki je mešanica emulzije olja in vode, in vsebuje ubite bakterije M. tuberculosis. Za poživitvene doze običajno uporabljamo adjuvans brez ubitih bakterij, da se izognemo stranskim učinkom adjuvansa. S poživitvenimi dozami vzbujamo sekundarni, od T celic odvisni imunski odziv, saj je zanj značilna proizvodnja visokoafinitetnih protiteles predvsem razreda G (Slika 5), ki imajo širok spekter uporabe v različnih imunoloških metodah (Abbas in Lichtman, 2005). Slika 5: Kinetika primarnega in sekundarnega protitelesnega imunskaga odziva. Ob primarnem imunskem odzivu se izloči velika količina protiteles IgM; tvorijo se spominske celice B, ki se pri sekundarnem imunskem odzivu aktivirajo, namnožijo in izločijo večje količine specifičnih protiteles IgG (Abbas in Licthman, 2005). 11
  25. 25. Uvod 1.4.2 Struktura protiteles Protitelesa so po svoji osnovni sestavi glikoproteini, sestavljeni iz dveh lahkih (molska masa vsake je 25 kDa) in dveh težkih polipeptidnih verig (molska masa vsake je 50 kDa), ki so med sabo povezane z disulfidnimi vezmi (skupna masa okrog 150 kDa). Glede na tip težke verige tako ločimo več razredov protiteles. Protitelesa s težko verigo α so IgA, z verigo γ IgG, δ IgD, ε IgE in μ IgM. Težko verigo sestavlja variabilna domena (VH) na N-koncu, ki vsebuje tudi 3 hipervariabilne regije, in tri konstantne domene (CH1, CH2, CH3). Med CH1 in CH2 je običajno še tečajna regija, ki omogoča fleksibilnost protitelesa pri vezavi antigena in preko disulfidnih vezi povezuje obe težki verigi. Lahka veriga pa je sestavljena iz variabilne domene (VL), ki prav tako vsebuje 3 hipervariabilne regije, in konstantne domene (CL), ki je preko disulfidnega mostička pritrjena na težko verigo. Pri lahkih verigah obstajata samo dva tipa verig, κ in λ (Slika 6). Pri ljudeh je 60% lahkih verig tipa kapa in 40% tipa lambda, medtem ko je pri miših samo 5% lahkih verig tipa lambda. Pri miših lahko lambda tip lahke verige razdelimo še na tri podtipe (λ1, λ2, λ3), ki pa se zelo malo razlikujejo v svojem aminokislinskem zaporedju (Richard in sod., 2003). Konstantne domene so odgovorne za interakcijo z drugimi molekulami in za prenos informacij, variabilne pa za vezavo antigena. Večino variabilne regije sestavljajo ohranjeni aminokislinski ostanki, ki gradijo ogrodje, na katero so postavljena hipervariabilna področja, ki jim pravimo tudi CDR-regije (angl. complementarity determining regions – regije, ki določajo komplementarnost). Skupaj torej 6 CDR-regij (tri na lahki in tri na težki verigi) sestavlja vezno mesto za antigen. Kljub temu, da obstaja več razredov protiteles, je ob imunskem odzivu največ izločenih protiteles IgG in IgM. Slika 6: Shematski prikaz zgradbe imunoglobulinov (Richard in sod., 2003). 12
  26. 26. Uvod 1.4.2.1 PROTITELESA IgG Kar 80% serumskih imunoglobulinov je razreda G (njihova molekulska masa znaša 150 kDa), kar pri zdravi miši predstavlja od 7 do 10 mg/ml seruma. Pri miših poznamo 4 podrazrede glede na njihovo težko verigo γ: IgG1, IgG2a, IgG2b in IgG3. Strukturno se ti podrazredi med seboj razlikujejo po velikosti tečajne regije ter po številu in položaju disulfidnih mostičkov, ki povezujejo obe težki verigi. V telesu opravljajo več funkcij: • specifično se vežejo na antigen predvsem ob sekundarnem imunskem odzivu, • vežejo se na Fc receptorje fagocitov in s tem sprožijo opsonizacijo, • sprožijo od protiteles odvisno celično citotoksičnost, • aktivirajo komplement, • prehajajo placento in ščitijo razvijajoči se fetus. Pri proizvodnji specifičnih MAbs navadno želimo, da so naša protitelesa IgG, saj omogočajo sorazmerno preprosto čiščenje z afinitetno kromatografijo na proteinu G ali A, in so uporabna na skorajda vseh področjih. Njihova uporaba je dandanes prisotna v različnih raziskavah, diagnostiki tako in vivo kot in vitro, cepivih, različnih zdravilih, testih nosečnosti,... Kljub vsemu pa se mnogokrat zgodi, da so pridobljena specifična MAbs razreda M. 1.4.2.2 PROTITELESA IgM Protitelesa razreda M so drugi najštevilčnejši v serumu in sicer nekje med 0,3 in 0,5 mg/ml seruma zdrave miši. Monomerna enota IgM (velikosti 180 kDa) se izrazi na limfocitu B kot membransko vezana, preko hidrofobne transmembranske regije. Ob aktivaciji limfocita pa se v plazmo izloči kot pentamerna molekula (velikosti 900 kDa), ki je preko CH3 in CH4 domene z disulfidnimi vezmi povezana v krožno strukturo z variabilnimi domenami navzven. Za povezavo je zaslužna še dodatna polipeptidna veriga J (angl. joining), ki je dodana tik pred izločanjem. Za razliko od IgG težka veriga IgM nima tečajne regije ampak 4 konstantne domene, tako da CH2 služi kot tečajna regija. Biološka funkcija protiteles IgM je: • kot celični receptorji B - vezava antigena pomeni prvi korak pri aktivaciji limfocitov, • so močni aktivatorji komplementa, • J veriga jim omogoča prehod preko epitelija in izločanje v mukus. 13
  27. 27. Uvod Prosti IgM je v primerjavi z ostalimi razredi protiteles zelo velika molekula s kar desetimi veznimi mesti za antigen. To mu omogoča veliko učinkovitost pri vezavi antigena z veliko ponavljajočimi se epitopi, zato je zelo uporaben pri aglutinacijskih testih za določanje krvnih skupin, saj lahko eno protitelo poveže več eritrocitov, ki izražajo enak krvnoskupinski antigen (Richard in sod., 2003). Prav njegova multivalentnost pa je tudi največja ovira pri uporabi v različnih diagnostičnih testih in eksperimentalnih metodah. Multivalentnost namreč lahko močno zmanjša specifičnost protitelesa, saj vezava antigena na prvo vezno mesto močno poveča afiniteto ostalih veznih mest. Takšne spremembe v specifičnosti so še posebej mogoče pri imunohistokemiji (IHK), kar lahko vodi do nespecifičnih reakcij. Signal pri določanju določenega antigena ni premosorazmeren s količino antigena, saj ne vemo, koliko molekul je vezalo eno protitelo. Prav tako se protitelesa IgM redko uporablja v imunoprecipitaciji, saj se ne vežejo na protein A ali G (Ladyman in Ritter, 1995). V splošnem namreč velja, da je molekule IgM veliko težje očistiti kot npr. IgG. Kljub vsem lastnostim, ki niso v prid njihovi uporabi, se MAbs IgM pojavljajo v diagnostiki in kot uporabno orodje pri različnih raziskavah. 1.4.3 Monoklonska protitelesa proti mišjemu prionskemu proteinu Slaba imunogenost prionskih proteinov predstavlja precejšnjo oviro pri pripravi MAbs. Raziskovalci so se zato zatekli k različnim metodam vzbujanja imunskega odziva (imunizacija z rekombinantnim PrP, fibrilami PrPSc , različnimi peptidi iz zaporedja PrP). Tako lahko mišja MAbs, ki se vežejo na MoPrPC in/ali MoPrPSc , ločimo v dve skupini. V prvo skupino spadajo tista, ki so bila pridobljena po imunizaciji z različnimi PrP drugih organizmov, a zaradi ohranjenosti PrP med vrstami vežejo tudi MoPrP. V drugo skupino lahko uvrstimo tista, ki so bila pridobljena po imunizaciji z mišjim PrP (peptidom, proteinom) z namenom pridobitve MAbs proti eni od oblik MoPrP. V prvo skupino spada protitelo 6H4, ki se še danes uporablja kot referenčno protitelo za diagnostiko v veterinarski medicini. Pridobljeno je bilo po imunizaciji PrP0/0 miši z rekombinantnim govejim PrP (recBoPrP; Korth in sod., 1997). 6H4 prepozna tako PrPC kot PrPSc človeka, goveda, ovce, miši in med obema oblikama ne razlikuje. Za določitev PrPSc je zato potrebno s predhodno obdelavo vzorca razgraditi PrPC obliko in s tem preprečiti vezavo protitelesa. 6H4 je razreda G1, njegov epitop pa ustreza AK 143-151 v MoPrP. 14
  28. 28. Uvod Na enak način so pridobili tudi protitelo 15B3 (Korth in sod., 1997), ki specifično prepozna PrPSc obliko človeka, goveda, ovce in miši brez predhodne obdelave vzorca. Zanj je značilno, da je razreda M in da prepoznava konformacijski epitop sestavljen iz AK 141-147, 161-169, 213-225 v zaporedju MoPrP. Ker je 15B3 razreda M, ga zaenkrat ne uporabljajo v imunoloških testih. V raziskovalni skupini Biomedicina, ki deluje v okviru Centra za razvoj in izdelavo diagnostičnih reagentov (CRIDR) so med drugim pridobili tudi monoklonsko protitelo CD2, in sicer po imunizaciji PrP0/0 miši z rekombinantnim humanim PrP (recHuPrP) (Venturini, 2004). To protitelo prepoznava vse tri glikozilacijske oblike PrP človeka, goveda, prašiča, ovce in miši ter diglikozilirano obliko PrP hrčka in podgane. Z imunizacijo PrP0/0 miši z rekombinantnim mišjim PrP (recMoPrP) so raziskovalci pridobili več različnih protiteles, ki so jih razvrstili v tri skupine (Zanusso in sod., 1998). Prvo skupino so predstavljala protitelesa, ki so se vezala na področju C-konca MoPrP (AK 145-220), drugo tista z epitopom na N-koncu (AK 23-90) in tretjo protitelesa, vezana v predelu glikozilacijskega mesta N181. Vsa so prepoznavala tako PrPC kot PrPSc miši in še mnogih drugih živali. Z imunizacijo miši BALB/c s sintetičnim peptidom CYYRRYYRYY konjugiranim s KLH je Paramithiotisu s sod. uspelo pridobiti več MAbs specifičnih za PrPSc različnih živali (miši, goveda, ovc), ki pa so bila vsa razreda M. Po njegovem mnenju so protitelesa, ki nastanejo proti zaporedju tirozin – tirozin – arginin (-YYR), PrPSc specifična, saj naj bi se s spremembo strukture PrPC povečala dostopnost tirozinov na površini molekule (Paramithiotis in sod., 2003). To so potrdili tudi drugi raziskovalci, saj so pri mapiranju epitopov specifičnih protiteles pogosto našli dvojico YY. Mišja MAbs razreda G, ki prepoznavajo MoPrPC in MoPrPSc , je danes mogoče kupiti na trgu. Kljub željam raziskovalcev do danes še ni na voljo mišje monoklonsko protitelo IgG, ki bi bilo specifično samo za MoPrPSc . Podoben problem obstaja pri določanju človeškega PrPSc , saj prav tako ni protitelesa, ki bi ga specifično prepoznavalo. Monoklonsko protitelo V5B2, ki so ga pridobili v CRIDR, je razreda G1 in je specifično za patološko obliko humanega prionskega proteina (HuPrPSc ). 15
  29. 29. Uvod 16 1.4.4 Monoklonsko protitelo V5B2 Mnogo raziskovalcev je že poskušalo pridobiti MAbs, ki bi specifično prepoznavala samo HuPrPSc . V ta namen so v raziskovalni skupini CRIDR imunizirali miši BALB/c s tremi skrbno izbranimi peptidi iz zaporedja humanega PrP konjugiranih s KLH: P1 (AK 214-226), P2 (167-179) in P3 (139-150). Najboljše rezultate celične fuzije so dobili s peptidom P1 (CITQYERESQAYY), saj so trije kloni proizvajali IgG protitelesa, ki so razlikovala med PrPC in PrPSc (Čurin Šerbec in sod., 2004). Še eno protitelo, ki je bilo prav tako specifično za PrPSc , so pridobili po drugi fuziji po imunizaciji na isti način (Vranac in sod., 2006). Z različnimi imunološkimi testi so zaradi najboljših lastnosti izbrali protitelo V5B2. V5B2 namreč selektivno prepoznava različne tipe odlaganja PrPSc v različnih CJB pozitvnih vzorcih, ne prepoznava pa niti recHuPrP (nativnega ali denaturiranega), niti HuPrPC . Za detekcijo PrPSc tako ni potrebna predhodna obdelava vzorca, kot je to potrebno pri 3F4 (referenčno protitelo za diagnostiko prionskih bolezni v humani medicini; Kascsak in sod., 1987). Protitelo V5B2 ima velik potencial pri uporabi v diagnostične in raziskovalne namene, saj je uporabno z IHK metodami, v postopku sendvič ELISA (angl. Enzyme Linked Immunosorbent Assay) ter v modificiranem western postopku, in je razreda G (Pretnar Hartman, 2005). Čeprav V5B2 prepozna mišjo različico peptida P1 (mP1), ne prepoznava nobene od oblik mišjega PrP (recMoPrP, MoPrPC , MoPrPSc ). Za raziskave na mišjem modelu bi potrebovali mišje monoklonsko protitelo, ki bi prepoznavalo samo MoPrPSc . Več dosedanjih raziskav je potrdilo, da peptid s C-konca PrP lahko sproži močan imunski odziv (Harmeyer in sod., 1998; Yokoyama in sod., 1995) in v nekaterih primerih povzroči nastanek PrPSc specifičnih protiteles (Čurin Šerbec in sod., 2004). Znano je, da so peptidi, ki izvirajo iz imunizirane živali, lahko enako imunogeni, kakor peptidi iz drugega organizma (Ghielmetti in sod., 2009). Zato se je zdelo smiselno, da za pridobitev MAbs, specifičnih za MoPrPSc , s peptidom mP1 imuniziramo tako BALB/c, kakor tudi PrP0/0 miši.
  30. 30. Namen dela 2. NAMEN DELA Osnovni namen našega dela je bil izolirati MAbs, ki bi bila specifična za MoPrPSc . K temu nas je vzpodbudila želja znanstvenikov po protitelesu, podobnem V5B2, le da bi bilo specifično za MoPrPSc . S tem bi pridobili uporabno orodje pri raziskovanju prionskih bolezni na mišjem modelu. Pričakovali smo: - imunizacija miši z mP1-KLH bi morala povzročiti protitelesni imunski odziv proti mP1, - hibridomi, pripravljeni po imunizaciji, naj bi proizvajali protitelesa proti različnim konformacijam peptida mP1, - s presejalnimi testi naj bi izolirali klone, ki proizvajajo protitelesa proti mP1, - pridobljena protitelesa bi opredelili z nadljnjimi testi. 17
  31. 31. Materiali in metode 3. MATERIALI IN METODE 3.1 DELO S CELICAMI 3.1.1 Hibridomske celične linije Vse hibridomske celične linije, ki smo jih uporabljali, so bile pripravljene po protokolu iz prejšnjih raziskav (opisane v standardnih postopkih v laboratoriju) in sicer z imunizacijo miši divjega tipa BALB/c s peptidom mP1 iz zaporedja MoPrP, kovalentno vezanim na nosilno molekulo KLH (sintezo in konjugacijo so opravili v podjetju Bachem v Švici). Iz miši z ustreznim protitelesnim imunskim odzivom so izolirali limfocite B in zlili z mielomskimi celicami NS1 (P3/NS1/1-Ag4-1). Po gojenju v selektivnem HAT mediju in presejalnih testih s posrednim postopkom ELISA, so nadalje gojili samo celične linije, za katere so v supernatantih določili dovolj velik titer protiteles proti mP1. Titer protiteles predstavlja obratno vrednost redčitve protiteles, za katero izmerimo še pozitivno vrednost (trikratno vrednost negativne kontrole) absorbance pri postopku ELISA. Titer ponazarja relativno koncentracijo protiteles v supernatantu. Pripravljene hibridomske celične linije so zamrznili v tekočem dušiku (-196 o C), kjer lahko hibridomske celične linije dolgotrajno shranjujemo. 3.1.2 Odmrzovanje celic Celice, ki so bile shranjene v tekočem dušiku, smo v transportni kaseti prenesli v laboratorij. Suspenzijo celic v zamrzovalnih ampulah smo odmrznili tako, da smo ampulo segreli v topli vodi (do faze, ko je v ampulah še vedno del celic zamrznjen), nato pa smo jih iz ampule sterilno prenesli v 20 ml nekompletnega Eaglovega minimalnega esencialnega gojišča modificiranega po Dulbeccu (DMEM – angl. Dulbecco's modified Eagle's medium; ICN, ZDA), da bi čimprej po odmrzovanju razredčili dimetilsulfoksid (DMSO), ki je za celice toksičen. Suspenzijo celic v nekompletnem gojišču smo nato centrifugirali 5 minut na 490 x g pri sobni temperaturi. Po centrifugiranju smo nekompletno gojišče oddekantirali in zavrgli, celice pa ponovno suspendirali v 7 ml kompletnega gojišča segretega na +37 o C in jih prenesli v stekleničko (s površino 25 cm2 ) za gojenje celičnih kultur. Stanje celic (gostoto celic v steklenički, število živih celic, morfologijo celic) smo ocenili pod svetlobnim mikroskopom takoj po odmrzovanju in nato še po dveh urah. 18
  32. 32. Materiali in metode 3.1.3 Gojenje celičnih kultur Za gojenje sesalskih celičnih kultur smo uporabljali DMEM (ICN, ZDA), ki smo ga pripravili po navodilih proizvajalca. Medij vsebuje 4,5 g/l glukoze, potrebne soli, aminokisline in fenol rdeče kot indikator pH medija, ki mora biti uravnan na 7,2. Medij smo sterilizirali s filtracijo preko sterilnega apirogenega membranskega filtra s porami velikosti 22 µm (Corning Costar, ZDA). Tako pripravljeno gojišče smo uporabljali pri odmrzovanju celičnih kultur in kot osnovo za druga gojišča, saj ga lahko hranimo daljši čas pri 4 °C, za gojenje celic pa smo ga dopolnili v kompletni DMEM, ki je vseboval še 13 % govejega seruma (HyClone, ZDA), penicilin v končni koncentraciji 100 U/ml (Pliva, Hrvaška), streptomicin v končni koncentraciji 100 μg/ml (Sigma, ZDA) in L-glutamin v končni koncentraciji 200 mM (Sigma, ZDA). L-glutamin je alternativni vir ogljika in prekurzor nukleotidov, ki pri višjih temperaturah razpada, zato ga je v medij potrebno dodajati približno vsakih 14 dni. Antibiotike dodajamo v gojišče, da preprečimo možne bakterijske okužbe, saj je kompletni DMEM dobro gojišče tudi za mikroorganizme. S celicami smo delali aseptično v brezprašni komori (Heto-Holten, Danska) s plastičnimi pipetami za enkratno uporabo različnih velikosti (Corning Costar, ZDA). Celične kulture smo gojili v plastičnih mikrotitrskih ploščicah s 96-, 24- ali 12-imi vdolbinicami z ravnim dnom (Corning Costar, ZDA) in stekleničkah s površino dna 25 cm2 ali 75 cm2 (Costar Corning, ZDA). Celice smo vzdrževali primerno goste s presajevanjem v novo stekleničko/vdolbinico s svežim kompletnim DMEM (pasaža), po potrebi pa smo jih tudi dohranili. Celice smo inkubirali v inkubatorjih pri +37 °C, v atmosferi s 5 % CO2 in nasičeno z vodno paro. 3.1.4 Štetje celic Celice smo šteli na hemocitometru. Iz suspenzije celic v steklenički smo odvzeli alikvot, ki smo ga redčili (običajno 1:2 ali 1:3) in hkrati barvali z Nigrosinom (0,2 % raztopina barvila; Sigma, ZDA). Žive celice ostanejo po barvanju nespremenjene, v mrtve pa barvilo prodre in jih obarva temno modro. Na osmih poljih mreže hemocitometra smo prešteli žive in mrtve celice. Z upoštevanjem redčitve in volumskega indeksa (104 ) smo izračunali število celic/ml v suspenziji, iz katere smo odvzeli alikvot. Za čim realnejše meritve smo štetje večkrat ponovili ter s pogostim mešanjem vzorca (suspenzije celic) na vibracijskem mešalniku (Vibromix, Tehtnica) zagotovili njegovo homogenost. 19
  33. 33. Materiali in metode 3.1.5 Zamrzovanje celic Celice, ki smo jih želeli zamrzniti, so morale biti v logaritemski fazi rasti in ustrezne gostote (106 – 107 celic/ml zamrzovalnega medija). Najprej smo označili zamrzovalne ampule ter jih postavili v zamrzovalnik na -20 o C. Pripravili smo potrebno količino zamrzovalnega medija, ki je bil zaradi občutljivosti celic sestavljen iz 90 % govejega seruma in 10 % DMSO. Celice in zamrzovalni medij smo pol ure inkubirali v ledeni kopeli pri -20 o C. Nato smo celice centrifugirali 5 min na 490 x g pri +4 o C, odlili supernatant, posedle celice pazljivo ponovno suspendirali v zamrzovalnem mediju ter alikvotirali po 1 ml v ohlajene zamrzovalne ampule. Slednje smo takoj odnesli v zamrzovalnik na -80 o C, po 24 urah pa v tekoči dušik (-196 o C). Cel postopek je moral potekati čim hitreje, saj je DMSO, ki celice ščiti pred poškodbami, ki jih lahko povzročijo kristali vode, za celice najbolj toksičen pri 0 o C. Uspešnost zamrzovanja smo preizkusili tako, da smo eno ampulo po 24 urah v tekočem dušiku odmrznili in celice gojili vsaj dve pasaži. 3.1.6 Kloniranje celičnih linij Cilj kloniranja je, da iz celične linije, ki proizvaja specifična protitelesa, osamimo eno celico in iz nje vzgojimo monoklonsko celično linijo. Zato je pomembno, da so pri kloniranju celice v logaritemski fazi rasti, ko so v najboljši fizični kondiciji. Hibridomske celične linije smo klonirali z metodo omejenega redčenja. Ko smo celice odmrznili, smo jih gojili toliko časa, da so dosegle logaritemsko fazo. Najprej smo določili gostoto celic v suspenziji in izračunali ustrezno redčitev v kompletnem DMEM. Redčili smo jih do 0,5 oziroma 1 celice/vdolbinico. Nato smo na ploščico s 96 vdolbinicami odpipetirali po 100 µl suspenzije/vdolbinico. Ploščice smo inkubirali pri +37 o C. Po nekaj dneh smo ploščico pregledali pod mikroskopom in označili tiste vdolbinice, v katerih so zrasli kloni ene same celice. Po približno enem tednu smo s posrednim postopkom ELISA testirali vse ploščice in določili, katere monoklonske celične linije so primerne za nadaljnjo gojenje (proizvajajo zadostno količino specifičnih protiteles proti mP1). Izbrane celične linije smo prenesli na ploščice s 24 vdolbinicami in kasneje v male stekleničke. Nato smo pridobljene celične linije zamrznili in shranili v tekočem dušiku. Tako smo iz začetne množice hibirdomskih celic ene linije izločili posamezne klone, ki so proizvajali specifična MAbs. 20
  34. 34. Materiali in metode 3.1.7 Rastna krivulja in določitev podvojitvenega časa Poskušali smo ugotoviti, kakšen je podvojitveni čas celične linije in v katerem obdobju rasti nastane največ protiteles. Celice, ki so bile v logaritemski fazi rasti, smo prešteli in pripravili 25 ml suspenzije celic s koncentracijo 104 celic/ml. Nato smo po 1 ml suspenzije razpipetirali v ploščico s 24 vdolbinicami. Vsak dan smo iz dveh luknjic odvzeli po 100 µl vzorca ter celice iz vsakega vzorca prešteli. Ko so se celice namnožile, smo jih redčili z 0,2 % Nigrosinom. Tako smo določili povprečne vrednosti koncentracij živih in mrtvih celic po posameznih dnevih in narisali rastno krivuljo. Vsak dan smo ostanek suspenzije iz vdolbinice odpipetirali v epico, centrifugirali 15 min na 870 x g, supernatant prelili v novo epico in shranili pri +4 o C. Po odvzemu zadnjega vzorca smo pridobljene supernatante testirali s sendvič testom ELISA in tako s pomočjo umeritvene krivulje po dnevih spremljali proizvodnjo protiteles. Podvojitveni čas celic smo izračunali po enačbi T2 = t · (ln2 / ln (Nt / N0)), pri čemer je T2 podvojitveni čas v urah, Nt število celic ob času t, N0 število celic ob času 0. Ker slednja enačba velja samo za logaritemsko fazo rasti in ne upošteva odmiranja celic, smo za izračun uporabili podatke prvih 72 ur gojenja, ko je bilo število odmrlih celic minimalno. 3.1.8 Priprava izčrpanih supernatantov Klonom posameznih linij smo z ustreznim redčenjem in presajanjem zagotovili logaritemsko rast in nasičenje kulture ter pustili, da so celice propadle. Suspenzijo propadlih celic smo prenesli v centrifugirke ter 15 min na 870 x g centrifugirali pri sobni temperaturi. Izčrpan supernatant (Sni) smo prelili v novo centrifugirko ter ga shranili pri +4 o C. 21
  35. 35. Materiali in metode 3.2 POSTOPEK ELISA Pri našem delu smo kot presejalni test uporabljali posredni postopek ELISA. Prav tako smo ga uporabljali za spremljanje ravni proizvodnje, za določanje razreda imunoglobulinov in za test specifičnosti. Postopek ELISA je raziskovalna ter diagnostična metoda, s katero določamo prisotnost molekul v vzorcu na podlagi specifične vezave protitelesa in antigena. Določamo lahko molekule antigena, pri čemer gre za postopek sendvič ELISA, ali pa določamo protitelesa z neposrednim ali posrednim postopkom ELISA. Slednja se ločita po tem, da v neposrednem postopku uporabljamo konjugirana primarna protitelesa, ki se neposredno vežejo na antigen; pri posrednem postopku se na antigen vežejo specifična primarna protitelesa, označena sekundarna (konjugirana) protitelesa pa se vežejo na konstanten del primarnih. Pri vseh različicah te metode potrebujemo protitelo, na katerega je kovalentno vezan encim (konjugat), ki veže substrat, ob tem pa se spremeni neka merljiva fizikalna količina. Najpogosteje pri taki encimski reakciji nastane obarvan produkt, ki ga nato merimo spektrofotometrično. 3.2.1 Presejalni test in spremljanje ravni proizvodnje protiteles Namen presejalnih testov je bil izbrati klone, ki imajo največjo raven proizvodnje protiteles specifičnih za mP1. Po kloniranju hibridomskih celičnih linij smo počakali, da so se kloni dobro razrasli in jih dohranili. Iz vdolbinic smo nato odvzeli po 100 µl supernatanta in jih testirali s posrednim postopkom ELISA. Kot antigen smo nanesli peptid mP1 v koncentraciji 5µg/ml, s katerim smo prekrili dna vdolbinic na mikrotitrski ploščici. Nato smo dodali testirane supernatante in počakali, da so se protitelesa vezala na nanešen antigen. Po potrebi smo supernatante tudi redčili. Sledila je posredna detekcija primarnih protiteles s 5000-krat redčenimi kozjimi anti-mišjimi IgG + IgM protitelesi, konjugiranimi s hrenovo peroksidazo. Ta ob prisotnosti H2O2 katalizira pretvorbo kromogenega substrata ABTS (zeleno obarvanje), pri čemer stopnjo pretvorbe merimo spektrofotometrično. Slabost tega postopka je, da absolutne rezultate lahko primerjamo le med vzorci na isti ploščici, saj časi inkubacij v posameznih stopnjah pomembno vplivajo na končni rezultat. 22
  36. 36. Materiali in metode Postopke ELISA smo izvajali na ustaljen način na mikrotitrski ploščici s 96 vdolbinicami (Nunc, ZDA). Za test smo si pripravili naslednje pufre: Pufer A – karbonatno-bikarbonatni pufer za prekrivanje ploščice: Na2CO3 15 mM NaHCO3 35 mM NaN3 3 mM pH = 9,6 Pufer B – fosfatni pufer za spiranje ploščice: NaCl 150 mM Na2HPO4 · 2H2O 7,5 mM NaH2PO4 · 2H2O 2,5 mM Tween20 0,05 % pH = 7,2 Pufer C – goveji serumski albumin (BSA) v pufru B za blokiranje prostih mest: BSA 1 % raztopina v pufru B Pufer D – citratno-fosfatni pufer za pripravo substrata: citronska kislina 100 mM Na2HPO4 · 2H2O 100 mM pH = 4,5 Substrat: 2,2'-azino-bis(3-etilbenztiazolin) 6-sulfonska kislina (ABTS); 0,1 % raztopina v pufru D Na dno mikrotitrske ploščice smo nanesli raztopino peptida mP1 v pufru A (100 μl, koncentracija 5 μg/ml) in ploščico inkubirali preko noči pri +4 °C. Naslednji dan smo vdolbinice trikrat sprali s pufrom B na spiralcu ploščic (Tecan washer) in nato nezasedena mesta blokirali s pufrom C (150 μl/vdolbinico). Ploščice smo inkubirali vsaj 30 minut pri +37 °C, jih ponovno trikrat sprali s pufrom B, nato pa smo v vdolbinice nanesli po 100 µl supernatanta s protitelesi, ki smo jih testirali. Po potrebi smo supernatante redčili, ali pa 23
  37. 37. Materiali in metode pripravili kar serijo redčitev. Ploščice smo inkubirali 90 minut pri +37 °C in jih nato ponovno trikrat sprali s pufrom B. Za vezavo na primarna protitelesa v supernatantih smo uporabili 5000-krat redčena kozja anti-mišja sekundarna protitelesa, konjugirana s hrenovo peroksidazo (Jackson ImmunoResearch Laboratories, ZDA), ki se vežejo na konstantne regije mišjih imunoglobulinskih verig γ, μ in κ. Ploščice smo zopet inkubirali 90 minut pri +37 °C in jih nato pred nanosom substrata ponovno trikrat sprali s pufrom B. Kot substrat smo uporabili ABTS v pufru D. V 10 ml raztopine smo tik pred nanosom na ploščico dodali 4 μl 30 % vodikovega peroksida in v vsako vdolbinico nanesli po 100 μl tako pripravljenega substrata. Ploščico smo inkubirali nadaljnjih 20 minut pri +37 °C, nato pa smo spektrofotometrično izmerili intenzivnost barvne reakcije (Slika 7) pri valovni dolžini vpadne svetlobe 405 nm in referenčnem filtru 620 nm (Tecan, Švica). Slika 7: Merjenje absorbance pri postopku ELISA s čitalcem Tecan. Ploščico smo pložili na mizico, čitalec je izmeril absorbanco v vsaki vdolbinici. 3.2.2 Določanje razreda specifičnih protiteles Razred protiteles smo določili po enakem postopku (3.2.1), le da smo kot sekundarna protitelesa uporabili konjugirana kozja anti-mišja protitelesa, ki reagirajo samo z mišjimi IgG1 ali IgM. 24
  38. 38. Materiali in metode 3.2.3 Ocena koncentracije protiteles iz umeritvene krivulje Koncentracije protiteles v naših supernatantih smo ocenili iz dobljene umeritvene krivulje. Dna vdolbinic mikrotitrske ploščice smo prekrili s 1000-krat redčenimi kozjimi anti-mišjimi IgG + IgM protitelesi (1,7 mg/ml; Jackson ImmunoResearch Laboratories, ZDA). Za umeritveno krivuljo smo si pripravili primerne redčitve standarda mišjih protiteles IgM z znano koncentracijo (Sigma, ZDA). Na ploščico smo poleg redčitev standarda nanesli preiskovane supernatante. Po inkubacij smo nanesli še detekcijska protitelesa, ki so bila 5000- krat redčena kozja anti-mišja sekundarna protitelesa, konjugirana s hrenovo peroksidazo (Jackson ImmunoResearch Laboratories, ZDA). Iz znanih koncentracij protiteles IgM in dobljenih vrednosti absorbanc smo izrisali umeritveno krivuljo, kjer smo za linearni del s pomočjo programa Excel izračunali enačbo premice. Iz enačbe smo nato iz podatkov za absorbanco (A405) izračunali koncentracije protiteles v naših supernatantih. 3.2.4 Specifičnost protiteles Ugotavljali smo tudi ali naša protitelesa vežejo različne petide, ki vsebujejo enako ali podobno zaporedje kot ga ima mP1. Na 3 mikrotitrske ploščice smo nanesli enake molarne koncentracije različnih peptidov (Preglednica 2) in v vsako ploščico dodali drug supernatant. Nadeljavli smo na enak način (3.2.1 – drugi odstavek). Preglednica 2: Ugotavljanje specifičnosti protiteles. Preglednica vsebuje seznam uporabljenih peptidov s pripadajočimi AK zaporedji, molskimi masami in končnimi masnimi koncentracijami pri molski koncentraciji 0,31 µM (z izjemo mP1-KLH in rekombinantnih proteinov). ? – natančna molekulska masa KLH je težko določljiva. stolpec   peptid  AK zaporedje  M [μg/μmol]  Ck [μg/mL]  1  mP1  CVTQYQKESQAYY  1610,7  0,50  2  mP1‐KLH  /  ?  10,00  3  P1scr  RQYIEYCSTEQYA  1653,8  0,51  4  P1  CITQYERESQAYY  1653,8  0,51  5  P1C‐S  SITQYERESQAYY  1637,7  0,51  6  P1YY‐AA  CITQYERESQAAA  1469,6  0,46  7  P1YY‐FF  CITQYERESQAFF  1621,8  0,50  8  mP20C  CVTQYQKESQAYYDGRRSSS  2356,5  0,73  9  mP20N  ERVVEQMCVTQYQKESQAYY  2482,7  0,77  10  recMoPrP  /  27977,5  2,00  11  recHuPrP  /  27629,3  6,00  12  recBoPrP  /  28614,3  2,00  25
  39. 39. Materiali in metode 3.3 MOLEKULARNE METODE Pri delu smo za popolnejšo opredelitev naših protiteles s pridom izkoristili dobro vpeljane metode molekularne genetike. Želeli smo določiti nukleotidna in AK zaporedja, ki kodirajo variabilne dele naših MAbs, ki jih nato lahko primerjamo z variabilnimi regijami drugih protiteles, ki so specifična za peptid P1 iz zaporedja PrP človeka, goveda, itd. Prav tako lahko raziskujemo interakcije antigen – protitelo. Celoten postopek se je začel z izolacijo celotne RNA iz monoklonske celične kulture hibridomov. Z metodo reverzne transkripcije smo mRNA zapis za variabilne regije težkih in lahkih verig prevedli v cDNA. Z verižno reakcijo s polimerazo (PCR – angl polymerase chain reaction) smo najprej sintetizirali še drugo verigo cDNA, nato pa željen odsek pomnožili v veliko število kopij. Sledila je ločitev produktov PCR z gelsko elektroforezo in izolacija pomnožene DNA iz gela. Pridobljeni DNA smo nato določili nukleodtidno zaporedje in te podatke uporabili pri analizi. 3.3.1 Izolacija RNA V razvoju limfocitov B, ki proizvajajo protitelesa, pride do preurejanja genskih segmentov, zato ima vsak B-celični klon specifičen genom, ki je drugačen od genoma katerekoli druge celice v telesu. Poleg tega lahko pride pri sintezi protiteles iste specifičnosti do razlik v izrezovanju primarne mRNA v zrelo mRNA (preklop izotipa), ki nato služi kot matrica za sintezo protitelesa. Zaradi teh razlogov smo morali pri naših poskusih izhajati iz RNA in ne iz DNA. RNA je precej bolj občutljiva na hidrolizo kot DNA. Poleg tega so RNaze (encimi, ki razgrajujejo RNA) zelo stabilni encimi, zato moramo biti pri delu z RNA zelo pazljivi, da ne pride do neželene cepitve. Za izolacijo RNA smo uporabljali Rneasy Plus Mini Kit (Qiagen, Nemčija) ter sledili navodilom proizvajalca. Uporabili smo 4 x 105 – 1 x 106 celic v logaritemski fazi rasti. Celice smo najprej s centrifugiranjem ločili od gojišča, ki smo ga zavrgli, nato pa celično usedlino sprali z 20 ml fosfatnega pufra PBS (angl. phosphate buffered saline), da bi preprečili neželene učinke, ki bi jih v nadaljnjih korakih izolacije lahko povzročil preostanek gojišča. Celice smo lizirali s pufrom, ki je vseboval detergente, gvanidinijev tiocianat in beta- merkaptoetanol (ß-ME). Detergenti lizirajo celice in s tem omogočijo prehod RNA v 26
  40. 40. Materiali in metode raztopino, hkrati pa gvanidinijev tiocianat in ß-ME razbijeta proteinske komplekse, ki jih želimo odstraniti. Vzorec smo homogenizirali, tako da smo ga tri do petkrat potegnili skozi injekcijsko iglo, hkrati pa smo s tem zaradi velikih strižnih sil natrgali genomsko DNA. Ta zaradi svoje velike viskoznosti otežuje delo in moti nadaljnje reakcije. Vzorce smo nato nanesli na kolono za vezavo DNA, filtrat pa obdelali s 70 % etanolom. RNA se je vezala na ustrezni koloni, ki smo jo nato v več zaporednih korakih očistili, ne da bi s tem izgubili vezano RNA. To smo iz kolone eluirali s 100 μl vode brez nukleaz. Po eluciji smo iz vzorcev vzeli alikvot, ki smo ga uporabili za spektrofotometrično določitev koncentracije in oceno čistosti izolirane RNA, preostanek vzorca pa smo takoj zamrznili na -70 °C. 3.3.2 Izbor začetnih oligonukleotidov Za pomnoževanje variabilnih domen mišjih imunoglobulinov obstajajo različni pristopi. Težko je najti take začetne oligonukleotide, ki se dovolj specifično vežejo na matrično zaporedje, hkrati pa ne določajo napačnega zaporedja na mestih, kjer prihaja do razlik med matrico in začetnimi oligonukleotidi. Sprva smo uporabili degenerirane oligonukleotide, ki so jih opisali Wang in sod. (2000). Začetna oligonukleotida Ig_κ_FR1 (za lahko verigo) in Ig_FR1.2 (za težko verigo) sta se prilegala prvi regiji ogrodja variabilne domene na 5' koncu, oligonukleotida Ig_κ_konst (za lahko verigo) in IgM_konst (za težko verigo) pa sta se prilegala prvi konstantni domeni na 3' koncu. Znano je, da je 95% lahkih verig mišjih imunoglobulinov tipa κ (Richard in sod., 2003), zato smo sprva uporabili samo začetne oligonukleotide tega tipa. Zaradi neuspešnega pomnoževanja lahkih verig dveh klonov iste linije smo na podlagi zaporedij iz baze podatkov imunoglobulinskih zaporedij (Lefranc in sod. in Ritter, 2004; Krebber in sod., 1997) skonstruirali niz začetnih oligonukleotidov za λ tip lahke verige (izdelava: Invitrogen, ZDA). Na 5' variabilni domeni sta se prilegala Ig_Vλ1 in Ig_Vλ3, na 3' konstantni domeni pa Ig_ λ1 in Ig_λ3, ki pa sta se razlikovala samo v dveh nukleotidih (Preglednica 3). Čeprav se zavedamo, da se lahko dejanski zapis v območju, kjer so se prilegali začetni oligonukleotidi, loči od tega, ki smo ga določili, smo lahko pomnožili vse zapise variabilnih in konstantnih domen protiteles, ki smo jih preiskovali. 27
  41. 41. Materiali in metode Preglednica 3: Začetni oligonukleotidi, ki smo jih uporabili pri delu (krepko so označena degenerirana mesta, ki so lahko: S = G ali C; R = G ali A; M = A ali C; W = A ali T; Y = C ali T; N = poljuben nukleotid). oznaka  mesto prileganja  zaporedje (5' → 3')  Ig_κ_FR1  5' variabilna domena κ lahke verige  GGGAGCTCGAYATTGTGMTSACMCARWCTMCA  Ig_FR1.2  5' variabilna domena težke verige  CTTCCGGAATTCSARGTNMAGCTGSAGSAGTCWGG Ig_κ_konst  3' konstantna domena κ lahke verige GGTGCATGCGGATACAGTTGGTGCAGCATC  IgM_konst  3' konstantna domena težke verige  GGAAGATCTGACATTTGGGAAGGACTGACTCTC  Ig_Vλ1  5' variabilna domena λ lahke verige  CAGGCTGTTGTGACTCAGGAATCT  Ig_Vλ3  CCCAACTTGTGCTCACTCAGTCAT  Ig_λ1  3' konstantna domena λ lahke verige GAGCTCTTCAGAGGAAGGTGGAAA  Ig_λ3  GAGCTCCTCAGGGGAAGGTGGAAA  3.3.3 Reverzna transkripcija Prt reverzni transkripciji (RT) smo z encimom reverzna transkriptaza in specifičnimi začetnimi oligonukleotidi iz celokupne RNA prevedli v cDNA (angl. complementary DNA – komplementarna DNA) samo tisti del, ki je kodiral zapis za variabilne domene lahkih in težkih verig. Za sintezo prve verige cDNA smo uporabili 2 μg izolirane RNA. Najprej smo v epico odpipetirali preračunan volumen izolirane RNA, po potrebi redčene z vodo brez nukleaz, in 2 µl začetnega oligonukleotida (konc. 0,5 µg/ml), ki se je prilegal na 3' koncu konstantne domene. Nato smo RNA 10 minut denaturirali pri +70 o C. Medtem smo pripravili reakcijsko mešanico iz 5 µl reakcijskega pufra, 5 μl dNTP (angl. deoxyribonucleoside triphosphate – deoksiribonukleozidtrifosfati) v končni koncentraciji 0,5 mM, 0,625 μl ribonukleaznega inhibitorja RNasin (25 enot; Promega, ZDA) in 1 μl reverzne transkriptaze M-MLV (200 enot; Promega, ZDA). Po končani denaturaciji RNA smo v epico dodali 7,875 µl reakcijske mešanice in jo inkubirali 1 uro pri +42 o C, da je potekla reverzna transkripcija. Da bi se izognili razpadanju RNA, smo ves čas priprave delali na zdrobljenem ledu. Po končani reakciji smo vzorec shranili v zamrzovalniku pri -20 o C. 28
  42. 42. Materiali in metode 3.3.4 Sinteza druge verige cDNA in pomnoževanje z metodo verižne reakcije s polimerazo V prejšnjem koraku sintetizirano cDNA smo uporabili kot matrico za sintezo druge verige in pomnoževanje specifične regije znotraj te cDNA v veliko število kopij z metodo PCR. PCR (angl. polymerase chain reaction – verižna reakcija s polimerazo) je metoda za hitro pomnoževanje DNA in vitro. Osnova te metode je termostabilna polimeraza, ki pomnožuje DNA tako, da se veže na začetni oligonukleotid in sintetizira komplementarno verigo v smeri 5'→3'. S temperaturnim programom, ki ga nastavimo na napravi za PCR, krožimo med tremi temperaturnimi stopnjami: denaturacijo dvojne verige DNA v prvem koraku (običajno pri +94 °C, 1 min), prileganjem začetnih oligonukleotidov v drugem koraku (temperatura prileganja je odvisna od značilnosti začetnih oligonukleotidov, 1 min) in podaljševanjem verige v zadnjem koraku (temperaturni optimum termostabilne polimeraze je +72°C, če delamo z najpogosteje uporabljeno polimerazo Taq, 1-2 min). Tak cikel ponovimo običajno 30-krat, da dobimo veliko število kopij dvovijačne DNA. Pripravili smo reakcijsko mešanico, sestavljeno iz 1 μl reakcijske zmesi iz prejšnjega poskusa (RT), 10 μl reakcijskega pufra z že dodanimi barvili za agarozno gelsko elektroforezo (Promega, ZDA), 4 μl dNTP v končni koncentraciji 0,2 mM (Promega, ZDA), 3 μl MgCl2 v končni konc. 1,5 mM, 0,25 μl (oziroma 1,25 enote) polimeraze GoTaq (Promega, ZDA), 1 μl 5'-začetnih oligonukleotidov (končna konc. 0,2 μM), 1 μl 3'-začetnih oligonukleotidov (končna konc. 0,2 μM) in vodo brez nukleaz do končnega volumna 50 μl. Pomnoževali smo z Mastercycler Gradient (Eppendorf, Nemčija) po programu: • za težke verige: +94 °C: 5 min; +94 °C: 1 min, +45 °C: 1 min: +72 °C: 1 min, 30 ciklov; • za lahke verige: +94 °C: 5 min; +94 °C: 1 min, +45 °C: 1 min, +72 °C: 1 min, 10 ciklov; +94 °C: 1 min, +47 °C: 1 min, +72 °C: 1 min, 10 ciklov; +94 °C: 1 min, +50 °C: 1 min, +72 °C: 1 min, 10 ciklov. Po končani reakciji smo produkte PCR ločili na agaroznem gelu z agarozno gelsko elektroforezo. 29
  43. 43. Materiali in metode 3.3.5 Agarozna gelska elektroforeza Agarozna gelska elektroforeza je standardna metoda za prepoznavo, ločevanje in čiščenje DNA fragmentov po velikosti. Agaroza, ki jo pridobivamo iz rdečih alg, pri temperaturi nad +55 o C polimerizira. Ko se ohladi oblikuje zamrežen gel, ki deluje kot sito pri ločevanju produktov DNA v električnem polju. Ločeno DNA lahko detektiramo na več načinov. Pri našem delu smo uporabljali sistem etidijev bromid (EtBr)/ultravijolična (UV) luč, pri katerem se EtBr vrine med bazne pare dvovijačne DNA in pri obsevanju z UV lučjo fluorescira intenzivno oranžno. Za ločevanje produktov PCR reakcije smo si pripravili 2 % agarozni gel. V mikrovalovni pečici smo raztopili 1,6 g agaroze v 80 ml TAE pufra (40 mM Tris-acetat, 1 mM EDTA; Millipore, ZDA), še vroči agarozi dodali 4 µl EtBr, vlili v kalup in počakali, da se je agaroza strdila. V gelu smo z glavničkom naredili žepke. Glavničke smo v gel vstavili preden se je strdil. Vsak vzorec pomnožene DNA smo nanesli v dva žepka na gelu, po 25 µl v vsakega. Za primerjavo velikosti produktov smo 1 µl lestvice DNA (konc. 0,5 µg/µl; GeneRuler DNA Ladder, Low Range; Fermentas, Kanada), 1 µl šestkratnega nanašalnega barvila (ksilen cianol in bromfenol modro; Fermentas, Kanada) in 4 µl vode nanesli v zadnji žepek. Elektroforeza je tekla v TAE pufru pri konstantni napetosti 100 V, 40 minut. 3.3.6 Izolacija DNA iz agaroznega gela Lise na gelu, ki so se pokazale pod UV lučjo in so vsebovale željene produkte, smo s spatulo izrezali iz gela in prenesli v epice. Za izolacijo DNA iz gela smo uporabili komplet reagentov DNA Gel Extraction Kit (Fermentas; Kanada) in sledili navodilom proizvajalca. Izrezan košček gela smo najprej raztopili v 300 µl 6 M raztopine natrijevega jodida in inkubirali 5 min pri +55 o C. Nato smo DNA vezali na silicijeve delce tako, da smo dodali 5 µl suspenzije silicijevega prahu in zopet inkubirali 5 min pri +55 o C. Vsake dve minuti smo epico premešali na vibracijskem mešalniku. Po inkubaciji smo jo centifugirali 20 s na 10000 x g in odlili supernatant. Vsedlino smo resuspendirali v 500 µl spiralnega pufra (Tris, NaCl in EDTA) in zopet centrifugirali 20 s na 10000 x g. Da bi odstranili vse nezaželene snovi, smo spiranje ponovili trikrat. Po zadnjem centrifugiranju smo supernatant previdno odpipetirali in vsedlino posušili na zraku. DNA smo iz silicijevih delcev eluirali tako, da smo posušeno vsedlino ponovno suspendirali v destilirani vodi (50 ali 100 µl) in inkubirali 5 min pri +55 o C. 30
  44. 44. Materiali in metode Suspenzijo smo centrifugirali 20 s na 1000 x g in previdno odpipetirali supernatant v novo epico. Postopek elucije smo ponovili z enako količino vode. Ker bi potencialni silicijevi delci v raztopini lahko motili nadaljnjo analizo, smo epico, v kateri je bila naša izolirana DNA, ponovno centrifugirali 1 min na 10000 x g in odpipetirali 90 % supernatanta ter ves supernatant shranili pri -20 o C. Ko smo izolirali vse vzorce DNA, smo na podlagi gelske elektroforeze in uporabe programa ImageJ (dostopno na svetovnem spletu: http://rsbweb.nih.gov/ij/download.html) ocenili koncentracijo pridobljene DNA. 3.3.7 Določanje nukleotidnega zaporedja Nukleotidno zaporedje smo določali po dideoksi metodi. Postopek poteka kot PCR, le da so v reakcijsko zmes dodani dideoksinukleotidi. Ti se ločijo od dNTP po tem, da na 3'-koncu nimajo hidroksilne skupine in zato prekinejo reakcijo podaljševanja verige. Z uporabo dideoksinukleotidov dosežemo, da se naključno vgradijo na vsa mesta v zaporedju in verigo tam končajo. Tako dobimo zmes različno dolgih verig, ki jih nato ločimo s kapilarno elektroforezo. Ker običajno uporabljamo dideoksinukleotide, ki so označeni s fluorogenimi skupinami, lahko iz signala, ki nam ga izpiše avtomatska naprava – sekvenator, določimo nukleotidno zaporedje. Nukleotidno zaporedje variabilnih regij težkih in lahkih verig so nam po dideoksi metodi določili v podjetju Macrogen (Koreja). Za vsak izbran klon smo poslali po 30 µl DNA za lahko in težko verigo ter ustrezne začetne oligonukleotide (5 pmol/µl). 3.3.8 Računalniška analiza nukleotidnih zaporedij Za analizo dobljenih zaporedji smo uporabljali programski paket BioEdit, ki je prosto dostopen na spletu (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Za karakterizacijo in analizo genskih segmentov smo uporabljali bazo podatkov IMGT (Lefranc in sod. in Ritter, 2004), svoja zaporedja pa smo primerjali med sabo s programom CLUSTAL W (http://align.genome.jp/). Podobna zaporedja, deponirana v bazi podatkov, smo iskali s programom BLAST (http://www.ncbi.nlm.nih.gov/BLAST/). Koncentracijo izolirane DNA iz gela smo ocenili s pomočjo programa ImageJ (dostopen na: http://rsbweb.nih.gov/ij/). 31
  45. 45. Materiali in metode 3.4 ANALIZA WESTERN Specifičnost MAbs smo hoteli preizkusiti še z analizo western, kjer smo kot vzorce uporabili različne možganske homogenate (MH) in različne rekombinantne prionske proteine. Denaturirane proteine v vzorcih smo najprej ločili na podlagi relativne molekulske mase in jih prenesli na nitrocelulozno membrano. Sledila je imunodetekcija z našimi MAbs kot specifičnimi primarnimi protitelesi. 3.4.1 Elektroforeza Poliakrilamidna gelska elektroforeza v prisotnosti natrijevega dodecil sulfata (NaDS) omogoča ločitev proteinov v poliakrilamidnih gelih na osnovi relativne molekulske mase proteina. Vzorec proteinov kemijsko obdelamo z NaDS, ki je močno negativno nabit denaturant. Nespecifično se veže na protein in povzroči popolno razvitje proteinske verige. Ker je vezava NaDS nespecifična (v povprečju 1 g proteina veže 1,4 g NaDS), je razmerje med dolžino polipeptidne verige in nabojem, ki ga povzroči vezan NaDS, konstanten. Posledica je serija diskretnih lis na poliakrilamidnem gelu, ločenih po velikosti proteinov. Tako ločene proteine lahko označimo z barvilom Coomassie Brilliant Blue ali pa jih prenesemo na nitrocelulozno membrano z western prenosom in označimo s protitelesi. Za elektroforezo smo uporabljali celico Mini Protean (Bio-Rad; ZDA). Pripravili smo gele velikosti 10 x 8 cm in debeline 0,8 mm. Za 12 % ločitveni gel smo uporabili: 8,7 ml destilirane vode 5,0 ml pufer Tris pH 8,8 6,0 ml 40 % w/v raztopine poliakrilamida 200 µl 10 % NaDS 100 µl 10 % APS 100 µl TEMED-a Raztopino smo dobro premešali, vlili v okvir za gel ter na vrh dodali 100 µl izopropanola, da je bila površina gela pokrita. Gel smo pustili 30 min pri sobni temperaturi, da se je strdil. Izopropanol smo odlili iz gela ter zgornji rob gela sprali z vodo. 32
  46. 46. Materiali in metode Za 4 % koncentracijski gel smo uporabili: 6,44 ml destilirane vode 3 ml pufer Tris pH 6,6 1 ml 40 % w/v raztopine poliakrilamida 100 µl 10 % NaDS 50 µl 10 % APS 50 µl TEMED-a Dobro premešano raztopino smo nalili na že polimeriziran ločitveni gel in v okvir vstavili glavniček. Gel smo zopet pustili 30 min pri sobni temperaturi, da je potekla polimerizacija. Nato smo glavniček previdno izvlekli in okvir z gelom postavili v elektroforezno celico (Bio- Rad; ZDA). Dolili smo pufer za elektroforezo (25 mM Tris, 0,32 mM glicin, 0,16 % NaDS (w/v), pH 8,3). Vzorce smo redčili v TBS pufru (20 mM Tris, 137 mM NaCl, pH 7,6) in dodali še vzorčni pufer, ki vsebuje bromfenol modro (Novex; ZDA). Ustrezno redčene vzorce ter molekulski standard (Precision plus protein dual color 10-250 kDa, Bio-Rad; ZDA) smo pred nanosom inkubirali še 5 min pri+ 95 o C, s čimer smo toplotno denaturirali proteine v vzorcih. Na gel smo nanesli po 15 µl redčenega vzorca na žepek. Elektroforeza je potekala 80 min pri konstantni napetosti 110 V. Po končani elektroforezi smo ločene proteine prenesli z gela na membrano. 3.4.2 Prenos na nitrocelulozno membrano Po končani elektroforezi smo gel in nitrocelulozno membrano (0,22 µm, Trans-Blot, Bio-Rad; ZDA) namočili v pufer za prenos (0,025 M Tris, 0,192 M glicin, 20% (v/v) metanol, pH 8,3). Nato smo po navodilih proizvajalca sestavili sendvič za prenos. Vsi sestavni deli tega sendviča so bili predhodno namočeni v prenašalnem pufru. Sendvič smo vstavili v celico za prenos in jo zalili s prenašalnim pufrom. Prenos je potekal 70 min pri konstantnem toku 200 mA. Proces smo hladili z ledom. Po končanem prenosu smo membrano čez noč inkubirali pri +4 o C v 5% (w/v) nemastnem mleku redčenem v TTBS pufru (20 mM Tris, 137 mM NaCl, 0,1% (v/v) Tween 20, pH 7,6). S tem smo blokirali nezasedena mesta na membrani. 33
  47. 47. Materiali in metode 34 3.4.3 Imunodetekcija Imunodetekcija je potekala po sledečem protokolu: • spiranje membrane v TTBS pufru na stresalniku (1 x 15 min, 3 x 5 min), • inkubiranje membrane (90 min na stresalniku) v raztopini primarnih protiteles (štirikrat redčena raztopina supernatantov v 1% (w/v) mleku redčenem v TTBS pufru), • spiranje membrane v TTBS pufru na stresalniku (1 x 15 min, 3 x 5 min), • inkubiranje membrane (90 min na stresalniku) v raztopini sekundarnih protiteles (5000-krat redčena v 1% (w/v) mleku, redčenem v TTBS pufru) kozja anti-mišja IgG + IgM protitelesa, konjugirana s hrenovo peroksidazo (Jackson ImmunoResearch Laboratories, ZDA)), • spiranje membrane v TTBS pufru na stresalniku (1 x 15 min, 3 x 5 min), • nanos ECL detekcijskega substrata (Amersham Biosciences; ZDA), ki temelji na kemoluminescenci luminola (hrenova peroksidaza ob prisotnosti H2O2 vzbudi luminol, ki ob prehodu iz vzbujenega stanja emitira svetlobo, ki jo detektiramo na fotografskem filmu), • ekspozicija fotografskega filma v temnici (membrano in film položimo v fotografsko kaseto (Kodak; Nemčija) (čas ekspozicije smo prilagodili jakosti sevanja), • razvijanje filma v razvijalcu do ustrezne slike, • fiksiranje filma v fiksirju (dvakrat dlje kot razvijanje). 3.5 METODA TOČKOVNEGA PRENOSA (DOT BLOT) Na aparaturo za dot blot (Bio-Rad; ZDA) smo položili predhodno v TBS pufru namočeno nitrocelulozno membrano (s porami 0,22 µm) in aparaturo sestavili po navodilih proizvajalca. V vsako luknjico smo odpipetirali po 250 µl TBS in z vakuumsko črpalko posesali pufer. Pazili smo, da membrane nismo izsušil. Nato smo nanesli po 50 µl redčenega vzorca (v TBS pufru) na luknjico. Vzorce smo odsesali s pomočjo gravitacije tako, da smo ventil aparature namestili nižje od luknjic in pustili 1 uro. Nato smo membrano spirali s 100 µl TBS na luknjico in po istem postopku nanašali vzorce. Po spiranju smo aparaturo razdrli in membrano čez noč inkubirali pri +4 o C v 5% (w/v) nemastnem mleku redčenem v TTBS pufru. Naslednji dan je sledila imunodetekcija kot je opisano v poglavju 3.4.3 Imunodetekcija.
  48. 48. Rezultati 4. REZULTATI 4.1 GOJENJE CELIČNIH KULTUR 4.1.1 Odmrzovanje celičnih linij Odmrzovanje celične linije F9 nam je povzročalo precejšnje preglavice, saj je bilo preživelih celic zelo malo. Zato smo odmrznili še eno ampulo iste celične linije. Čeprav po pregledu celic pod mikroskopom nismo našli nobene žive celice, smo vsak drugi dan skrbno zamenjali 3 ml medija. Celice so prišle v logaritemsko fazo rasti po dobrih štirinajstih dneh. Kljub temu, da je bila to ena celična linija, so se morfološke značilnosti in število celic ene in druge odmrznitve razlikovale že po pregledu pod mikroskopom, zato smo ju obravnavali kot dve različni celični liniji označeni z F9P in F9B. Celice linije F9B so bile manjše in hitreje rastoče ter so dosegale večjo gostoto kot F9P. Tudi pri odmrzovanju celične linije E1 smo naleteli na podobne težave. Viabilnost celičnih linij C11, C8 in D3 po odmrzovanju pa je bila sorazmerno velika, zato so že po nekaj dneh dosegle logaritemsko fazo rasti in smo jih lahko uspešno presajali v nove gojitvene stekleničke. 4.1.2 Lastnosti celičnih kultur V CRIDR so miši BALB/c imunizirali z mP1-KLH in iz vranice izolirane limfocite zlili z mielomskimi celicami NS1 (miši PrP0/0 na imunizacjo z mP1-KLH niso odgovorile s specifičnim imunskim odzivom). Po opravljenih presejalnih testih na mP1, mP1-KLH in na sam KLH, so izbrali 5 najbolj obetavnih celičnih linij, jih nagojili v malih stekleničkah (površine 25 cm2 ), ter zamrznili v tekočem dušiku. S posrednim postopkom ELISA so ugotavljali tudi specifičnost protiteles za različne peptide. Najbolj obetavna so bila protitelesa celičnih linij F9 in E1, saj so pokazala minimalen signal pri peptidu P1scr (peptid z naključnim zaporedjem AK, ki sestavljajo peptid P1), obenem pa visoko afiniteto na mP1(Preglednica 4). 35
  49. 49. Rezultati Preglednica 4: Ugotavljanje specifičnosti protiteles s posrednim postopkom ELISA. Koncentracija nanešenih peptidov je znašala 5 μg/ml (po 50 μl/vdolbinico). Največji signal je bil ocenjen s ++++ (zelo pozitivno), najmanjši pa – (zelo negativno) (vir: dr. Katrina Pretnar Hartman). peptid  Sni F9  Sni C11  Sni C8  Sni E1  Sni D3  mP1  ++++  ++++  ++  +++  ++++  P1scr  +  +++  +  ‐  +++  P1  ++++  ++++  +  ++  ++++  P20C  +  +++  +  ‐  +  P1YY‐AA  ‐  ++  +  ‐  ‐  P1YY‐FF  ++++  ++++  ++  ++  ++++  P1C‐S  ++  +++  +  ‐  ++  Protitelesom iz supernatantov so določili imunoglobulinski razred in ugotovili, da so razreda M. Z analizo western so poizkusili detektirati PrP v različnih 10 % MH (Slika 8). Pri imunodetekciji z vsemi petimi supernatanti ni bilo opaziti lis v območju molekulskih mas od 23 – 33 kDa (značilno za 3 glikozilacijske tipe PrP), ki bi jih pričakovali, če bi se protitelesa izbranih linij vezala na celično obliko PrP. Pri vseh je opaziti le različne lise, ki jih lahko pripišemo nespecifični vezavi sekundarnih protiteles na protitelesa in njihove razgradne produkte, prisotne v MH. Ko smo pridobili prve izčrpane supernatante vsake odmrznjene linije, smo s posrednim postopkom ELISA preverili relativno vsebnost protiteles specifičnih za mP1 (Slika 9 na strani 38). Pri celičnih linijah F9B in F9P je bil titer protiteles najvišji in se je med sabo malenkostno razlikoval. Slabši titer sta dosegli liniji C11 in C8. Pri linijah E1 (obe odmrznitvi) in D3 je pri odmrzovanju prišlo do spremembe lastnosti celične linije, saj je bil titer na mP1 pri obeh zanemarljiv. Najverjetneje so bile celice, ki so proizvajale specifična protitelesa proti mP1, preobčutljive na zamrzovanje in pri odmrzovanju niso preživele. Tako smo naprej gojili 4 celične linije. Sproti smo po pasažah spremljali raven proizvodnje protiteles, ki pa se ni spreminjala. 36
  50. 50. Rezultati A B C D E F Slika 8: Imunodetekcija PrP v različnih vzorcih MH z uporabo štirikrat redčenih supernatantov celičnih linij po gelski elektroforezi in western prenosu. A: Sni F9, B: Sni C11, C: Sni C8, D: Sni E1, E: Sni D3, F: kontrolno protitelo CD2 (končna konc. 5 µg/ml). Nanos vzorcev: Hu – humani, Bo – goveji, Ha – hrčkov, Sh – ovčji, Pig – prašičji, Rab – zajčji, Rat – podganji, BALB/c – seva miši divjega tipa, PrP0/0 – seva miši z izbitim genom za PrP. Nanašali so po 15 µl redčenega vzorca na žepek (2 µl ustreznega MH + 10 µl TBS pufra + 3 µl vzorčnega pufra). Kot sekundarna protitelesa so bila uporabljena 5000-krat redčena kozja anti-mišja IgG + IgM – HRP protitelesa (vir: Maja Černilec in dr. Katrina Pretnar Hartman). 37
  51. 51. Rezultati A 0,0 0,5 1,0 1,5 2,0 2,5 A405 redčitev C11 F9B F9P B 0,0 0,5 1,0 1,5 2,0 2,5 A405 redčitev C8 D3 E1 (1. odmr.) E1 (2. odmr.) Slika 9: Začetno spremljanje ravni proizvodnje protiteles proti mP1. Absorbance (405 nm) predstavljajo relativne vsebnosti protiteles v redčitvah supernatantov na logaritemski skali. A: Sni F9B, Sni F9P in Sni C11. B: Sni D3, Sni C8 in Sni E1 (prvo in drugo odmrzovanje). Vsi pridobljeni podatki niso izključevali možnosti, da katera od pridobljenih celičnih linij proizvaja protitelesa, ki specifično prepoznavajo MoPrPSc . Zato smo pridobljene celične linije klonirali in podrobneje opredelili pridobljena protitelesa. 38

×