Virology Journal Club

1,201 views

Published on

Journal club
HIV and stem cell transplant

Published in: Health & Medicine
  • Be the first to comment

Virology Journal Club

  1. 3. Virology Journal Club 18 February 2009 Preneshni R Naicker
  2. 5. Introduction <ul><li>HIV-1 enters host cells by binding to a CD4 receptor and then interacting with either CCR5 or CXCR4. </li></ul>
  3. 6. <ul><li>Homozygosity for a 32-bp deletion (delta32/delta32) in the CCR5 allele  inactive CCR5 gene product  high resistance against HIV-1 acquisition </li></ul>
  4. 7. <ul><li>Allogeneic stem-cell transplantation from an HLA-matched donor is a feasible option for pts with hematologic neoplasms. </li></ul><ul><li>It is not established as a therapeutic option for pts also infected with HIV. </li></ul><ul><li>The outcome of allogeneic stem-cell transplantation in a pt with HIV infection and AML </li></ul><ul><li>Using a transplant from an HLA-matched, unrelated donor who was screened for homozygosity for CCR5 delta32 deletion. </li></ul>
  5. 8. Case report <ul><li>40 year old </li></ul><ul><li>Caucasian man </li></ul><ul><li>Presented with newly diagnosed AML (FAB M4 sub-type, with normal cytogenetic features) </li></ul><ul><li>Diagnosed with HIV 10 years ago </li></ul><ul><li>Treated with HAART </li></ul><ul><li>Efavirenz 600mg daily </li></ul><ul><li>Emtricitabine 200mg daily </li></ul><ul><li>Tenofovir 300mg daily </li></ul>
  6. 9. Case report cont.. <ul><li>On HAART for 4 years </li></ul><ul><li>No AIDS-associated illness observed. </li></ul><ul><li>When AML diagnosed </li></ul><ul><li>CD4 = 415 </li></ul><ul><li>VL = undetectable </li></ul><ul><li>Treatment of AML </li></ul><ul><li>2 x induction chemotherapy </li></ul><ul><li>1 x consolidation chemotherapy </li></ul>
  7. 10. Case report cont… <ul><li>During the 1 st induction course, severe hepatic toxicity developed and renal failure occurred. </li></ul><ul><li>HAART discontinued </li></ul><ul><li>Viral rebound VL = 6.9x10 6 copies/ml </li></ul><ul><li>HAART resumed </li></ul><ul><li>3 months later VL = undetectable </li></ul><ul><li>7 months after presentation AML relapse </li></ul>
  8. 11. Case report cont.. <ul><li>Allogeneic stem-cell transplantation </li></ul><ul><li>CD43+ peripheral-blood stem cells from an HLA-identical donor who had been screened for homozygosity for CCR5 delta32 allele. </li></ul><ul><li>Informed consent </li></ul><ul><li>Approved by institutional review board </li></ul>
  9. 12. Case report cont… <ul><li>HLA genotyped identical at the following loci: </li></ul><ul><li>A*0201;B*0702,3501;Cw0401,0702;DRB1*0101.1501 and DQB1*0501,0602 </li></ul><ul><li>Patient received a graft containing 2.3x10 6 CD34+ cells/kg </li></ul>
  10. 13. Case report cont… <ul><li>Other medication </li></ul><ul><li>Rabbit antithymocyte globulin </li></ul><ul><li>Cyclosporine </li></ul><ul><li>Mycophenolate mofetil </li></ul><ul><li>HAART administered until the day before </li></ul><ul><li>Engraftment achieved 13 days later </li></ul><ul><li>Grade I graft-versus-host disease of skin – cyclosporine adjusted </li></ul>
  11. 14. Case report cont… <ul><li>AML relapse 332 days post-transplantation </li></ul><ul><li>Chimerism decreased to 15% </li></ul><ul><li>Reinduction with cytarabine and gemtuzumab </li></ul><ul><li>Single dose of whole body irradiation (200cGy) </li></ul><ul><li>DAY 391  2 nd transplant of 2.1x10 6 CD34+ cells/kg from the same donor </li></ul><ul><li>Complete remission of AML at 20 months </li></ul>
  12. 16. Methods <ul><li> CCR5 genotyping </li></ul><ul><li>DNA extraction: QIAamp Blood Midi Kit (Qiagen) from peripheral-blood monocytes </li></ul><ul><li>Screening donor for CCR5 delta32 allele with PCR. </li></ul><ul><li>Fwd: 5’CTCCCAGGAATCATCTTTACC3’ </li></ul><ul><li>Rev:5’TCATTTCGACACCGAAGCAGC3’ </li></ul><ul><li>200bp CCR5 allele 168bp delta32 deletion </li></ul>
  13. 17. Methods cont.. <ul><li>Results confirmed by allele-specific PCR and direct sequencing </li></ul><ul><li>(BigDye Terminator v1.1 Cycle Sequencing) </li></ul><ul><li>Sequences analyzed with Vector NTI ContigExpress software (Invitrogen) </li></ul><ul><li>Viral Envelope Genotyping </li></ul><ul><li>Coreceptor use by HIV-1 assessed through V3 aa sequences of env region </li></ul>
  14. 18. Methods cont.. <ul><li>Direct sequencing of bulk PCR products </li></ul><ul><li>RNA- env region sequenced </li></ul><ul><li>An ultradeep PCR analysis with parallel sequencing was performed </li></ul>
  15. 19. Methods cont… <ul><li> Chemokine receptors & surface antigens </li></ul><ul><li>Mucosal cells isolated from 10 rectal biopsy specimens </li></ul><ul><li>CCR5 expression simulated by phytohemagglutinin (Sigma) </li></ul><ul><li>Cells analysed by flow cytometry </li></ul>
  16. 20. Methods cont.. <ul><li> Chimerism </li></ul><ul><li>Based on discrimination bet donor & recipient alleles on short tandem repeats. </li></ul><ul><li>Used PCR and fluorescence-labeled primers </li></ul>
  17. 21. Methods cont… <ul><li> Cellular & humoral immune response </li></ul><ul><li>Secretion of INF- γ by Ag-specific cells was induced. </li></ul><ul><li>T cell mediated immune response was measured for HIV-1 and CMV. </li></ul><ul><li>Antibodies against HIV-1 determined with an enzyme-linked immunoassay and immunoblot assay </li></ul>
  18. 22. Methods cont… <ul><li> Amplification of HIV-1 DNA & RNA </li></ul><ul><li>HIV-1 RNA amplified using Cobas AmpliPrep-TaqMan HIV assay (Roche) </li></ul><ul><li>Total DNA isolated from peripheral blood monocytes and rectal biopsy specimens </li></ul><ul><li>env and LTR regions were amplified </li></ul>
  19. 23. Results <ul><li> Distribution of CCR5 alleles </li></ul><ul><li>Genomic DNA from 62 of 80 potential HLA-identical stem-cell donors was sequenced in the CCR5 region </li></ul><ul><li>Only 1 donor homozygous for CCR5 delta32 deletion </li></ul>
  20. 24. Results cont… <ul><li> HIV-1 coreceptor phenotype </li></ul><ul><li>Sequence analysis revealed glycine at 11 and glutamic acid at 25 of V3 region </li></ul><ul><li>Net charge of aa was +3 </li></ul><ul><li>=> CCR5 coreceptor use by the infecting strain </li></ul><ul><li>This was confirmed by sequencing RNA in env region </li></ul><ul><li>Ultradeep R: 2.9% X4 and dual-tropic variants </li></ul>
  21. 25. Results cont.. <ul><li> Recipient chimerism </li></ul>
  22. 26. Results cont… <ul><li>Cellular and humoral immune response </li></ul>
  23. 27. Results cont…
  24. 28. Results cont… <ul><li> Quantification of viraemia </li></ul><ul><li>HIV-1 RNA remained undetectable </li></ul><ul><li>No proviral DNA </li></ul><ul><li>(except D20 – env , LTR/ D61 – env ) </li></ul><ul><li> Rectal-biopsy specimens </li></ul><ul><li>D159 = macrophages showed expression of CCR5 – not present in mucosal CD4+ T lymphocytes </li></ul>
  25. 29. Discussion <ul><li>Successful transplantation of allogeneic stem cells homologous for CCR5 delta32 allele to a pt with HIV </li></ul><ul><li>Pt had X4 variants before the SCT </li></ul><ul><li>Discontinued HAART >20 months but HIV-1 could not be detected </li></ul><ul><li>The persistence of HIV-1 populations can be observed without viraemia </li></ul><ul><li>CCR5 macrophages still present </li></ul>
  26. 30. Discussion cont… <ul><li>X4 variants may be source for re-emerging viruses </li></ul><ul><li>Ab against env due to long-lived plasma cells resistant to immunosupp therapy </li></ul><ul><li>Does not require HAART if VL undetectable </li></ul><ul><li>Highlights the role of CCR5 receptor </li></ul><ul><li>Further investigations encouraged </li></ul>
  27. 31. Thank you

×