SlideShare a Scribd company logo
1 of 52
Download to read offline
Plant Molecular Cytogenetics Trude Schwarzacher [email_address] www.molcyt.com Including talk slides! www.molecularcytogenetics.com UserID/PW ‘visitor’  Nimes ECA Course 27 February 2012
[object Object]
‘ Golden Yellow’ triploid 2n=3x=14 C. flavus  2n=2x=8 (8 yellow)  C. angustifolius  2n=2x=12 (6 green) Orgaard, Jacobsen & HH ‘ Stellaris’ hybrid diploid 2n=2x=10 C. flavus  2n=2x=8 (4 green) C. angustifolius  2n=2x=12 (6 blue)
Metaphase I in triploid Golden Yellow Crocus ,[object Object],[object Object]
Plant genome sizes vary  over a 2350-fold range
 
Plant Molecular Cytogenetics ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Part I: Part II:
Somatic metaphase  chromosomes Arabidopsis   Human  Pine Centromere Telomere
Darwin: The final paragraph of “The Origin” ,[object Object]
OBJECTIVES Fundamental  and Practical  ,[object Object],[object Object],[object Object],[object Object]
OBJECTIVES   Fundamental and  Practical  ,[object Object],[object Object],[object Object],[object Object],[object Object]
The Genome and Chromosomes ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Genes!
Repetitive DNA-Sequences form the largest part of the genome Arabidopsis thaliana > 25% 145 Mbp Sugar beet  Beta vulgaris 63% 758 Mbp Broad bean  Vicia faba 85%   12000 Mbp Rye  Secale cereale 92%   8800 Mbp Onion  Allium cepa 95%   15100 Mbp These species are all diploid – 2x Species     Repetitive DNA   Genome size Human  Homo sapiens   35%   3000 Mbp
Arabidopsis thaliana  2n=10
 
 
Arabidopis suecica Hybrid  A. arenosa  (pAa214 green) X   A. thaliana  (180bp red) Kamm, HH et al.
ancestral A B C D High-copy number High-copy number High-copy number High-copy number E F Low-copy number Low-copy number New species-specific variants High copy spp: homogenized old (ABC) or new (D) variants Low copy spp: most old variants in low copy number (EF) See Kuhn, HH et al. 2009. Heredity & 2008. Chr. Res.
Organelle sequences from chloroplasts or mitochondria Sequences from viruses, Agrobacterium or other vectors Transgenes introduced with molecular biology methods Genes, regulatory and non-coding single copy sequences Dispersed repeats: Transposable Elements Repetitive DNA sequences Plant Nuclear  Genome Tandem repeats DNA transposons copied and moved via DNA Retrotransposons amplifying via an RNA intermediate Centromeric repeats Structural components of chromosomes Telomeric repeats Simple sequence repeats or microsatellites Repeated genes Subtelomeric repeats 45S and 5S rRNA genes Blocks of tandem repeats at discrete chromosomal loci DNA sequence components of the plant nuclear genome Heslop-Harrison & Schmidt  2012. Encyclopedia of Life Sciences Other genes
Derivative chromosome 1R of Lines 7-102 and 7-169
Oil Palm ,[object Object],[object Object],[object Object],[object Object],02/07/12
Repetitive Sequences ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Retrotransposons Class I transposable elements RNA intermediate DNA transposons Class II transposable elements Cut-and-paste
Genome Specificity of a CACTA ( En/Spm ) Transposon B. napus  (AACC, 2n=4x=38) – hybridized with C-genome CACTA element red B. oleracea (CC, 2n=2x=18)  B. rapa (AA, 2n=2x=20) Alix & HH 2008
Triticale: wheat  x  rye hybrid
[object Object],[object Object],[object Object]
dpTa1 Aegilops ventricosa DDNN ABDN AABBDDNN Marne AABBDD CWW1176-4 Rendezvous Piko VPM1 Dwarf A 96ST61 Virtue × × × × Hobbit × {Kraka × (Huntsman × Fruhgold)} Triticum persicum  Ac.1510 AABB Inheritance of Chromosome 5D
rRNA gene expression in Triticale ,[object Object]
Modification of DNA Methylation ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Copyright restrictions may apply. Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042 UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subsp
 
 
[object Object],Glu-1 Xpsr161 Xpsr957 Xpsr381 5SrRNA Nor-1 (d)  Em Gli-1 Tri-1 Physical map vs Genetic map Genes are often clustered Genes (and recombination) are often distal
Wsm-1: only effective source of resistance to WSMV
dpTa1 digoxigenin IWG genomic DNA biotin
 
Wild banana species: Musa acuminata  – A genome  Musa balbisiana  – B genome Basic chromosome number n=x=11  Genome size c. 550 Mbp Most cultivated hybrids are 2n=3x=33
[object Object],Insertion IRAP – InterRetroelement PCR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR LTR
IRAP diversity in Musa Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005  J Plant Biol Nair, Teo, Schwarzacher, HH 2006 Euphytica   Desai, Maha … , HH et al. in prep.
07/02/12 TCCCTGAG:  8-bp TSD. 30-bp TIRs 273-bp hAT ACCCACCTGGCTCTTGTGTC ATACCATTGAAAAGCCGATTATATTTGTCCCCATTCATCCAAAAGA TCCCTGAG CAAGGTCTG C CATACCG T A C CGTACCG G CG TTTCGAC CCGG GCTCGGTACGGTA CCGG TGTA CCGG GCAGTACATCAGGGTGTACCGAATGGTACACCCTGATGTACCGAACAATTTTATACTTTTTCATACTGTAGCAGTGCTACAGTATAATACTGTAGCACTGTAGCGGTATCGGGCGGTCCGCGTA CCGG TAACCTGTCGGA CCGG TACATACCGC CCGG TAT CG G CGGTACG C T T CGGTATG A CAGACCTTG TCCCTGAG TATATATCTCTTTTCTAAATTTATGACCACTCCAAGGCAACTTGCCAAAGAAAATGAAAAGAAGAAAAAAATTAGGGGAATGAAGATTCTCCACAATTCCTTATTCTTTGATTTGAGATAAATAATGTCCATAGTAAAACATATCTTATGATCATCATTGCTGATTAATCAAAATACCTGATTCTATAGTCTCAAGCTTT AGTGGTCAAAACACATTCGC TSD   TIR TIR   TSD hAT1 in  Musa acuminata F and R primers indicated by blue arrows in sequence Musa balbisiana Musa acuminata a) b)
07/02/12 hAT1  insertion sites in  Musa  diversity collection hAT486F and hAT037R Top bands (560-bp) amplified hAT element and lower bands amplifying the flanking sequences only HP-1  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48 1KB 800 600 400 200
Nuclear Copies of Banana Streak Virus in Banana
DNA Fibre Hybridization
Evolution  Epigenetics  Development ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
From Chromosome to Nucleus Pat Heslop-Harrison  [email_address]   www.molcyt.com
United Nations  Millennium Development Goals-  MDGs   ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Conventional Breeding Superdomestication ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
50 years of plant breeding progress
 
CytoGenomics … ,[object Object],[object Object]
Plant Molecular Cytogenetics Trude Schwarzacher [email_address] Website:  www.molcyt.com  or www.molecularcytogenetics.com UserID/PW ‘visitor’ To download full text of papers  Nimes ECA Course 27 February 2012

More Related Content

What's hot

Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...Pat (JS) Heslop-Harrison
 
chloroplast genome ppt.
chloroplast genome ppt.chloroplast genome ppt.
chloroplast genome ppt.dbskkv
 
Genetic markers in characterization2
Genetic markers in characterization2Genetic markers in characterization2
Genetic markers in characterization2Bruno Mmassy
 
Organellar genome and its composition
Organellar genome and its compositionOrganellar genome and its composition
Organellar genome and its compositionShilpa C
 
Cytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringCytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringSANJAY KUMAR SANADYA
 
Plant genomics general overview
Plant genomics general overviewPlant genomics general overview
Plant genomics general overviewKAUSHAL SAHU
 
cytoplasmic effect and genetic engineering of chloroplasts
cytoplasmic effect and genetic engineering of chloroplastscytoplasmic effect and genetic engineering of chloroplasts
cytoplasmic effect and genetic engineering of chloroplastsSANJAY KUMAR SANADYA
 
Chloroplast Genetics
Chloroplast GeneticsChloroplast Genetics
Chloroplast Geneticsvibhakhanna1
 
[Micro] bacterial genetics (12 jan)
[Micro] bacterial genetics (12 jan)[Micro] bacterial genetics (12 jan)
[Micro] bacterial genetics (12 jan)Muhammad Ahmad
 
Gene families and clusters
Gene families and clusters Gene families and clusters
Gene families and clusters vidyadeepala
 
BACTERIAL GENETICS for MBBS students
BACTERIAL GENETICS for MBBS studentsBACTERIAL GENETICS for MBBS students
BACTERIAL GENETICS for MBBS studentsNCRIMS, Meerut
 
Chloroplast transformation
Chloroplast transformationChloroplast transformation
Chloroplast transformationSachin Ekatpure
 
Molecular ecology lecture
Molecular ecology lectureMolecular ecology lecture
Molecular ecology lecturedreamingbearcat
 
20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析
20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析
20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析Monascus2008
 
Bacterial genetics
Bacterial geneticsBacterial genetics
Bacterial geneticsPrbn Shah
 
Mitochondrial DNA in Taxonomy and Phylogeny
Mitochondrial DNA in Taxonomy and PhylogenyMitochondrial DNA in Taxonomy and Phylogeny
Mitochondrial DNA in Taxonomy and PhylogenyRachel Jacob
 

What's hot (20)

Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...
 
chloroplast genome ppt.
chloroplast genome ppt.chloroplast genome ppt.
chloroplast genome ppt.
 
Genetic markers in characterization2
Genetic markers in characterization2Genetic markers in characterization2
Genetic markers in characterization2
 
Organellar genome and its composition
Organellar genome and its compositionOrganellar genome and its composition
Organellar genome and its composition
 
Cytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringCytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineering
 
Plant genomics general overview
Plant genomics general overviewPlant genomics general overview
Plant genomics general overview
 
cytoplasmic effect and genetic engineering of chloroplasts
cytoplasmic effect and genetic engineering of chloroplastscytoplasmic effect and genetic engineering of chloroplasts
cytoplasmic effect and genetic engineering of chloroplasts
 
Genomics
GenomicsGenomics
Genomics
 
Chloroplast Genetics
Chloroplast GeneticsChloroplast Genetics
Chloroplast Genetics
 
[Micro] bacterial genetics (12 jan)
[Micro] bacterial genetics (12 jan)[Micro] bacterial genetics (12 jan)
[Micro] bacterial genetics (12 jan)
 
Genome origin
Genome originGenome origin
Genome origin
 
Gene families and clusters
Gene families and clusters Gene families and clusters
Gene families and clusters
 
Chloroplast transformation
Chloroplast transformationChloroplast transformation
Chloroplast transformation
 
BACTERIAL GENETICS for MBBS students
BACTERIAL GENETICS for MBBS studentsBACTERIAL GENETICS for MBBS students
BACTERIAL GENETICS for MBBS students
 
Mt DNA
Mt DNAMt DNA
Mt DNA
 
Chloroplast transformation
Chloroplast transformationChloroplast transformation
Chloroplast transformation
 
Molecular ecology lecture
Molecular ecology lectureMolecular ecology lecture
Molecular ecology lecture
 
20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析
20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析
20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析
 
Bacterial genetics
Bacterial geneticsBacterial genetics
Bacterial genetics
 
Mitochondrial DNA in Taxonomy and Phylogeny
Mitochondrial DNA in Taxonomy and PhylogenyMitochondrial DNA in Taxonomy and Phylogeny
Mitochondrial DNA in Taxonomy and Phylogeny
 

Viewers also liked

Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003Pat (JS) Heslop-Harrison
 
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...Pat (JS) Heslop-Harrison
 
Agrobacterium mediated Transformation in rice
Agrobacterium mediated Transformation in riceAgrobacterium mediated Transformation in rice
Agrobacterium mediated Transformation in riceSrinath Sri
 
Secondary metabolite from Plant organ culture
Secondary metabolite from  Plant organ cultureSecondary metabolite from  Plant organ culture
Secondary metabolite from Plant organ cultureamvannan
 
Agrobacterium mediated gene transformation
Agrobacterium mediated gene transformationAgrobacterium mediated gene transformation
Agrobacterium mediated gene transformationawareswapnil1111
 
Presentation on photo degradation and photo stabilization of polymers
Presentation on photo degradation and photo stabilization of polymersPresentation on photo degradation and photo stabilization of polymers
Presentation on photo degradation and photo stabilization of polymersIEI GSC
 
Why arabidopsis is a model plant
Why arabidopsis is a model plantWhy arabidopsis is a model plant
Why arabidopsis is a model plantSachin Ekatpure
 
Arabidopsis thaliana genome project
Arabidopsis thaliana genome projectArabidopsis thaliana genome project
Arabidopsis thaliana genome projectKarishma Gangwani
 
Agrobacterium mediated gene transfer in plants.
Agrobacterium mediated gene transfer in plants.Agrobacterium mediated gene transfer in plants.
Agrobacterium mediated gene transfer in plants.ICHHA PURAK
 
Bioplastic from banana peels
Bioplastic from banana peelsBioplastic from banana peels
Bioplastic from banana peelsjithingkannan2
 
Thermal degradation ppt of polymers
Thermal degradation ppt of polymersThermal degradation ppt of polymers
Thermal degradation ppt of polymersozagaurang
 
Agrobacterium mediated gene transfer
Agrobacterium mediated gene transferAgrobacterium mediated gene transfer
Agrobacterium mediated gene transferPrabhu Thirusangu
 

Viewers also liked (20)

Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003
 
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
 
Agro
AgroAgro
Agro
 
Agrobacterium mediated Transformation in rice
Agrobacterium mediated Transformation in riceAgrobacterium mediated Transformation in rice
Agrobacterium mediated Transformation in rice
 
Secondary metabolite from Plant organ culture
Secondary metabolite from  Plant organ cultureSecondary metabolite from  Plant organ culture
Secondary metabolite from Plant organ culture
 
Bioplastic
Bioplastic Bioplastic
Bioplastic
 
In vitro plant development
In vitro plant developmentIn vitro plant development
In vitro plant development
 
Agrobacterium mediated gene transformation
Agrobacterium mediated gene transformationAgrobacterium mediated gene transformation
Agrobacterium mediated gene transformation
 
Bioplastic
BioplasticBioplastic
Bioplastic
 
Presentation on photo degradation and photo stabilization of polymers
Presentation on photo degradation and photo stabilization of polymersPresentation on photo degradation and photo stabilization of polymers
Presentation on photo degradation and photo stabilization of polymers
 
Bioplastics
BioplasticsBioplastics
Bioplastics
 
Why arabidopsis is a model plant
Why arabidopsis is a model plantWhy arabidopsis is a model plant
Why arabidopsis is a model plant
 
Arabidopsis thaliana genome project
Arabidopsis thaliana genome projectArabidopsis thaliana genome project
Arabidopsis thaliana genome project
 
Agrobacterium mediated gene transfer in plants.
Agrobacterium mediated gene transfer in plants.Agrobacterium mediated gene transfer in plants.
Agrobacterium mediated gene transfer in plants.
 
Bioplastic from banana peels
Bioplastic from banana peelsBioplastic from banana peels
Bioplastic from banana peels
 
Thermal degradation ppt of polymers
Thermal degradation ppt of polymersThermal degradation ppt of polymers
Thermal degradation ppt of polymers
 
Biodegradable polymers
Biodegradable polymersBiodegradable polymers
Biodegradable polymers
 
Gene transformation methods
Gene transformation methodsGene transformation methods
Gene transformation methods
 
Agrobacterium mediated gene transfer
Agrobacterium mediated gene transferAgrobacterium mediated gene transfer
Agrobacterium mediated gene transfer
 
Biodegradable polymers by madhuri phute
Biodegradable polymers by madhuri phuteBiodegradable polymers by madhuri phute
Biodegradable polymers by madhuri phute
 

Similar to Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and Pat Heslop-Harrison

In situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude SchwarzacherIn situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude SchwarzacherPat (JS) Heslop-Harrison
 
Genomics Technologies
Genomics TechnologiesGenomics Technologies
Genomics TechnologiesSean Davis
 
SYNTHETIC CHROMOSOME PLATFORMs IN PLANTS: CONCEPTS & APPLICATIONs
SYNTHETIC CHROMOSOME PLATFORMs IN PLANTS:  CONCEPTS & APPLICATIONsSYNTHETIC CHROMOSOME PLATFORMs IN PLANTS:  CONCEPTS & APPLICATIONs
SYNTHETIC CHROMOSOME PLATFORMs IN PLANTS: CONCEPTS & APPLICATIONskundan Jadhao
 
Models of Human Diseases Conference (2010) Tetrahymena model by Dr. R. Pearl...
Models of Human Diseases Conference (2010)  Tetrahymena model by Dr. R. Pearl...Models of Human Diseases Conference (2010)  Tetrahymena model by Dr. R. Pearl...
Models of Human Diseases Conference (2010) Tetrahymena model by Dr. R. Pearl...Medical Education Advising
 
Biotechnology Ap
Biotechnology ApBiotechnology Ap
Biotechnology Apsmithbio
 
Techniques of-biotechnology-mcclean-good
Techniques of-biotechnology-mcclean-goodTechniques of-biotechnology-mcclean-good
Techniques of-biotechnology-mcclean-goodana_isa_barbosa
 
Genome Evolution Chromosomes Heslop-Harrison ICC Prague
Genome Evolution Chromosomes Heslop-Harrison ICC PragueGenome Evolution Chromosomes Heslop-Harrison ICC Prague
Genome Evolution Chromosomes Heslop-Harrison ICC PraguePat (JS) Heslop-Harrison
 
Transplastomics in Vegetable Crops.pptx
Transplastomics in Vegetable Crops.pptxTransplastomics in Vegetable Crops.pptx
Transplastomics in Vegetable Crops.pptxSumanthBT1
 
Phylogenomic Revisit for Green Contribution to Diatoms
Phylogenomic Revisit for Green Contribution to DiatomsPhylogenomic Revisit for Green Contribution to Diatoms
Phylogenomic Revisit for Green Contribution to DiatomsAhmed Moustafa
 
OKC Grand Rounds 2009
OKC Grand Rounds 2009OKC Grand Rounds 2009
OKC Grand Rounds 2009Sean Davis
 
SAB presentation to Jim narrated
SAB presentation to Jim narratedSAB presentation to Jim narrated
SAB presentation to Jim narratedguestba7bf7
 
Chloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptxChloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptxSwaatiSharma2
 

Similar to Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and Pat Heslop-Harrison (20)

In situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude SchwarzacherIn situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude Schwarzacher
 
Transplastomics
TransplastomicsTransplastomics
Transplastomics
 
Genomics Technologies
Genomics TechnologiesGenomics Technologies
Genomics Technologies
 
SYNTHETIC CHROMOSOME PLATFORMs IN PLANTS: CONCEPTS & APPLICATIONs
SYNTHETIC CHROMOSOME PLATFORMs IN PLANTS:  CONCEPTS & APPLICATIONsSYNTHETIC CHROMOSOME PLATFORMs IN PLANTS:  CONCEPTS & APPLICATIONs
SYNTHETIC CHROMOSOME PLATFORMs IN PLANTS: CONCEPTS & APPLICATIONs
 
Heslopharrisonassisiweb
HeslopharrisonassisiwebHeslopharrisonassisiweb
Heslopharrisonassisiweb
 
Models of Human Diseases Conference (2010) Tetrahymena model by Dr. R. Pearl...
Models of Human Diseases Conference (2010)  Tetrahymena model by Dr. R. Pearl...Models of Human Diseases Conference (2010)  Tetrahymena model by Dr. R. Pearl...
Models of Human Diseases Conference (2010) Tetrahymena model by Dr. R. Pearl...
 
Biotechnology Ap
Biotechnology ApBiotechnology Ap
Biotechnology Ap
 
Techniques of-biotechnology-mcclean-good
Techniques of-biotechnology-mcclean-goodTechniques of-biotechnology-mcclean-good
Techniques of-biotechnology-mcclean-good
 
Genome Evolution Chromosomes Heslop-Harrison ICC Prague
Genome Evolution Chromosomes Heslop-Harrison ICC PragueGenome Evolution Chromosomes Heslop-Harrison ICC Prague
Genome Evolution Chromosomes Heslop-Harrison ICC Prague
 
Transplastomics in Vegetable Crops.pptx
Transplastomics in Vegetable Crops.pptxTransplastomics in Vegetable Crops.pptx
Transplastomics in Vegetable Crops.pptx
 
Bliss
BlissBliss
Bliss
 
Cloning dna f inal
Cloning dna f inalCloning dna f inal
Cloning dna f inal
 
Phylogenomic Revisit for Green Contribution to Diatoms
Phylogenomic Revisit for Green Contribution to DiatomsPhylogenomic Revisit for Green Contribution to Diatoms
Phylogenomic Revisit for Green Contribution to Diatoms
 
155 dna microarray
155 dna microarray155 dna microarray
155 dna microarray
 
155 dna microarray
155 dna microarray155 dna microarray
155 dna microarray
 
Dna microarray mehran
Dna microarray  mehranDna microarray  mehran
Dna microarray mehran
 
OKC Grand Rounds 2009
OKC Grand Rounds 2009OKC Grand Rounds 2009
OKC Grand Rounds 2009
 
Dna microarray mehran- u of toronto
Dna microarray  mehran- u of torontoDna microarray  mehran- u of toronto
Dna microarray mehran- u of toronto
 
SAB presentation to Jim narrated
SAB presentation to Jim narratedSAB presentation to Jim narrated
SAB presentation to Jim narrated
 
Chloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptxChloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptx
 

More from Pat (JS) Heslop-Harrison

Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiMolecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiPat (JS) Heslop-Harrison
 
Saffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis SeminarSaffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis SeminarPat (JS) Heslop-Harrison
 
Evolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenomeEvolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenomePat (JS) Heslop-Harrison
 
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonBiodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitleHeslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitlePat (JS) Heslop-Harrison
 
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...Pat (JS) Heslop-Harrison
 
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-HarrisonMolecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Pat (JS) Heslop-Harrison
 
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Pat (JS) Heslop-Harrison
 
Banana Transposable Elements: The hAT DNA element story PAGXXIII
Banana Transposable Elements: The hAT DNA element story PAGXXIIIBanana Transposable Elements: The hAT DNA element story PAGXXIII
Banana Transposable Elements: The hAT DNA element story PAGXXIIIPat (JS) Heslop-Harrison
 
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-HarrisonIn situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsTandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsPat (JS) Heslop-Harrison
 
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison MalaysiaChromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison MalaysiaPat (JS) Heslop-Harrison
 
BS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-HarrisonBS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
BS1003 - Light and plant development lecture
BS1003 - Light and plant development lectureBS1003 - Light and plant development lecture
BS1003 - Light and plant development lecturePat (JS) Heslop-Harrison
 
Superdomestication, feed-forward breeding and climate proofing crops
Superdomestication, feed-forward breeding and climate proofing cropsSuperdomestication, feed-forward breeding and climate proofing crops
Superdomestication, feed-forward breeding and climate proofing cropsPat (JS) Heslop-Harrison
 
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory TalkHeslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory TalkPat (JS) Heslop-Harrison
 
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonDomestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...Pat (JS) Heslop-Harrison
 

More from Pat (JS) Heslop-Harrison (20)

Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiMolecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
 
HeslopHarrisonDurhamFlax.pptx
HeslopHarrisonDurhamFlax.pptxHeslopHarrisonDurhamFlax.pptx
HeslopHarrisonDurhamFlax.pptx
 
Saffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis SeminarSaffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis Seminar
 
Evolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenomeEvolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenome
 
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonBiodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
 
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitleHeslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
 
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
 
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-HarrisonMolecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
 
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
 
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
 
Banana Transposable Elements: The hAT DNA element story PAGXXIII
Banana Transposable Elements: The hAT DNA element story PAGXXIIIBanana Transposable Elements: The hAT DNA element story PAGXXIII
Banana Transposable Elements: The hAT DNA element story PAGXXIII
 
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-HarrisonIn situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
 
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsTandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
 
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison MalaysiaChromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
 
BS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-HarrisonBS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-Harrison
 
BS1003 - Light and plant development lecture
BS1003 - Light and plant development lectureBS1003 - Light and plant development lecture
BS1003 - Light and plant development lecture
 
Superdomestication, feed-forward breeding and climate proofing crops
Superdomestication, feed-forward breeding and climate proofing cropsSuperdomestication, feed-forward breeding and climate proofing crops
Superdomestication, feed-forward breeding and climate proofing crops
 
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory TalkHeslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
 
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonDomestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
 
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
 

Recently uploaded

BÀI TẬP BỔ TRỢ TIẾNG ANH 11 THEO ĐƠN VỊ BÀI HỌC - CẢ NĂM - CÓ FILE NGHE (GLOB...
BÀI TẬP BỔ TRỢ TIẾNG ANH 11 THEO ĐƠN VỊ BÀI HỌC - CẢ NĂM - CÓ FILE NGHE (GLOB...BÀI TẬP BỔ TRỢ TIẾNG ANH 11 THEO ĐƠN VỊ BÀI HỌC - CẢ NĂM - CÓ FILE NGHE (GLOB...
BÀI TẬP BỔ TRỢ TIẾNG ANH 11 THEO ĐƠN VỊ BÀI HỌC - CẢ NĂM - CÓ FILE NGHE (GLOB...Nguyen Thanh Tu Collection
 
4.9.24 School Desegregation in Boston.pptx
4.9.24 School Desegregation in Boston.pptx4.9.24 School Desegregation in Boston.pptx
4.9.24 School Desegregation in Boston.pptxmary850239
 
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITW
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITWQ-Factor HISPOL Quiz-6th April 2024, Quiz Club NITW
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITWQuiz Club NITW
 
31 ĐỀ THI THỬ VÀO LỚP 10 - TIẾNG ANH - FORM MỚI 2025 - 40 CÂU HỎI - BÙI VĂN V...
31 ĐỀ THI THỬ VÀO LỚP 10 - TIẾNG ANH - FORM MỚI 2025 - 40 CÂU HỎI - BÙI VĂN V...31 ĐỀ THI THỬ VÀO LỚP 10 - TIẾNG ANH - FORM MỚI 2025 - 40 CÂU HỎI - BÙI VĂN V...
31 ĐỀ THI THỬ VÀO LỚP 10 - TIẾNG ANH - FORM MỚI 2025 - 40 CÂU HỎI - BÙI VĂN V...Nguyen Thanh Tu Collection
 
4.9.24 Social Capital and Social Exclusion.pptx
4.9.24 Social Capital and Social Exclusion.pptx4.9.24 Social Capital and Social Exclusion.pptx
4.9.24 Social Capital and Social Exclusion.pptxmary850239
 
Narcotic and Non Narcotic Analgesic..pdf
Narcotic and Non Narcotic Analgesic..pdfNarcotic and Non Narcotic Analgesic..pdf
Narcotic and Non Narcotic Analgesic..pdfPrerana Jadhav
 
An Overview of the Calendar App in Odoo 17 ERP
An Overview of the Calendar App in Odoo 17 ERPAn Overview of the Calendar App in Odoo 17 ERP
An Overview of the Calendar App in Odoo 17 ERPCeline George
 
Oppenheimer Film Discussion for Philosophy and Film
Oppenheimer Film Discussion for Philosophy and FilmOppenheimer Film Discussion for Philosophy and Film
Oppenheimer Film Discussion for Philosophy and FilmStan Meyer
 
Comparative Literature in India by Amiya dev.pptx
Comparative Literature in India by Amiya dev.pptxComparative Literature in India by Amiya dev.pptx
Comparative Literature in India by Amiya dev.pptxAvaniJani1
 
6 ways Samsung’s Interactive Display powered by Android changes the classroom
6 ways Samsung’s Interactive Display powered by Android changes the classroom6 ways Samsung’s Interactive Display powered by Android changes the classroom
6 ways Samsung’s Interactive Display powered by Android changes the classroomSamsung Business USA
 
Sulphonamides, mechanisms and their uses
Sulphonamides, mechanisms and their usesSulphonamides, mechanisms and their uses
Sulphonamides, mechanisms and their usesVijayaLaxmi84
 
4.11.24 Poverty and Inequality in America.pptx
4.11.24 Poverty and Inequality in America.pptx4.11.24 Poverty and Inequality in America.pptx
4.11.24 Poverty and Inequality in America.pptxmary850239
 
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 - I-LEARN SMART WORLD - CẢ NĂM - CÓ FILE NGHE (BẢN...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 - I-LEARN SMART WORLD - CẢ NĂM - CÓ FILE NGHE (BẢN...BÀI TẬP BỔ TRỢ TIẾNG ANH 8 - I-LEARN SMART WORLD - CẢ NĂM - CÓ FILE NGHE (BẢN...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 - I-LEARN SMART WORLD - CẢ NĂM - CÓ FILE NGHE (BẢN...Nguyen Thanh Tu Collection
 
Scientific Writing :Research Discourse
Scientific  Writing :Research  DiscourseScientific  Writing :Research  Discourse
Scientific Writing :Research DiscourseAnita GoswamiGiri
 
CLASSIFICATION OF ANTI - CANCER DRUGS.pptx
CLASSIFICATION OF ANTI - CANCER DRUGS.pptxCLASSIFICATION OF ANTI - CANCER DRUGS.pptx
CLASSIFICATION OF ANTI - CANCER DRUGS.pptxAnupam32727
 

Recently uploaded (20)

BÀI TẬP BỔ TRỢ TIẾNG ANH 11 THEO ĐƠN VỊ BÀI HỌC - CẢ NĂM - CÓ FILE NGHE (GLOB...
BÀI TẬP BỔ TRỢ TIẾNG ANH 11 THEO ĐƠN VỊ BÀI HỌC - CẢ NĂM - CÓ FILE NGHE (GLOB...BÀI TẬP BỔ TRỢ TIẾNG ANH 11 THEO ĐƠN VỊ BÀI HỌC - CẢ NĂM - CÓ FILE NGHE (GLOB...
BÀI TẬP BỔ TRỢ TIẾNG ANH 11 THEO ĐƠN VỊ BÀI HỌC - CẢ NĂM - CÓ FILE NGHE (GLOB...
 
4.9.24 School Desegregation in Boston.pptx
4.9.24 School Desegregation in Boston.pptx4.9.24 School Desegregation in Boston.pptx
4.9.24 School Desegregation in Boston.pptx
 
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITW
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITWQ-Factor HISPOL Quiz-6th April 2024, Quiz Club NITW
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITW
 
31 ĐỀ THI THỬ VÀO LỚP 10 - TIẾNG ANH - FORM MỚI 2025 - 40 CÂU HỎI - BÙI VĂN V...
31 ĐỀ THI THỬ VÀO LỚP 10 - TIẾNG ANH - FORM MỚI 2025 - 40 CÂU HỎI - BÙI VĂN V...31 ĐỀ THI THỬ VÀO LỚP 10 - TIẾNG ANH - FORM MỚI 2025 - 40 CÂU HỎI - BÙI VĂN V...
31 ĐỀ THI THỬ VÀO LỚP 10 - TIẾNG ANH - FORM MỚI 2025 - 40 CÂU HỎI - BÙI VĂN V...
 
4.9.24 Social Capital and Social Exclusion.pptx
4.9.24 Social Capital and Social Exclusion.pptx4.9.24 Social Capital and Social Exclusion.pptx
4.9.24 Social Capital and Social Exclusion.pptx
 
Narcotic and Non Narcotic Analgesic..pdf
Narcotic and Non Narcotic Analgesic..pdfNarcotic and Non Narcotic Analgesic..pdf
Narcotic and Non Narcotic Analgesic..pdf
 
Mattingly "AI & Prompt Design" - Introduction to Machine Learning"
Mattingly "AI & Prompt Design" - Introduction to Machine Learning"Mattingly "AI & Prompt Design" - Introduction to Machine Learning"
Mattingly "AI & Prompt Design" - Introduction to Machine Learning"
 
Plagiarism,forms,understand about plagiarism,avoid plagiarism,key significanc...
Plagiarism,forms,understand about plagiarism,avoid plagiarism,key significanc...Plagiarism,forms,understand about plagiarism,avoid plagiarism,key significanc...
Plagiarism,forms,understand about plagiarism,avoid plagiarism,key significanc...
 
An Overview of the Calendar App in Odoo 17 ERP
An Overview of the Calendar App in Odoo 17 ERPAn Overview of the Calendar App in Odoo 17 ERP
An Overview of the Calendar App in Odoo 17 ERP
 
Oppenheimer Film Discussion for Philosophy and Film
Oppenheimer Film Discussion for Philosophy and FilmOppenheimer Film Discussion for Philosophy and Film
Oppenheimer Film Discussion for Philosophy and Film
 
Comparative Literature in India by Amiya dev.pptx
Comparative Literature in India by Amiya dev.pptxComparative Literature in India by Amiya dev.pptx
Comparative Literature in India by Amiya dev.pptx
 
prashanth updated resume 2024 for Teaching Profession
prashanth updated resume 2024 for Teaching Professionprashanth updated resume 2024 for Teaching Profession
prashanth updated resume 2024 for Teaching Profession
 
6 ways Samsung’s Interactive Display powered by Android changes the classroom
6 ways Samsung’s Interactive Display powered by Android changes the classroom6 ways Samsung’s Interactive Display powered by Android changes the classroom
6 ways Samsung’s Interactive Display powered by Android changes the classroom
 
Introduction to Research ,Need for research, Need for design of Experiments, ...
Introduction to Research ,Need for research, Need for design of Experiments, ...Introduction to Research ,Need for research, Need for design of Experiments, ...
Introduction to Research ,Need for research, Need for design of Experiments, ...
 
Sulphonamides, mechanisms and their uses
Sulphonamides, mechanisms and their usesSulphonamides, mechanisms and their uses
Sulphonamides, mechanisms and their uses
 
4.11.24 Poverty and Inequality in America.pptx
4.11.24 Poverty and Inequality in America.pptx4.11.24 Poverty and Inequality in America.pptx
4.11.24 Poverty and Inequality in America.pptx
 
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 - I-LEARN SMART WORLD - CẢ NĂM - CÓ FILE NGHE (BẢN...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 - I-LEARN SMART WORLD - CẢ NĂM - CÓ FILE NGHE (BẢN...BÀI TẬP BỔ TRỢ TIẾNG ANH 8 - I-LEARN SMART WORLD - CẢ NĂM - CÓ FILE NGHE (BẢN...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 - I-LEARN SMART WORLD - CẢ NĂM - CÓ FILE NGHE (BẢN...
 
Scientific Writing :Research Discourse
Scientific  Writing :Research  DiscourseScientific  Writing :Research  Discourse
Scientific Writing :Research Discourse
 
CLASSIFICATION OF ANTI - CANCER DRUGS.pptx
CLASSIFICATION OF ANTI - CANCER DRUGS.pptxCLASSIFICATION OF ANTI - CANCER DRUGS.pptx
CLASSIFICATION OF ANTI - CANCER DRUGS.pptx
 
Faculty Profile prashantha K EEE dept Sri Sairam college of Engineering
Faculty Profile prashantha K EEE dept Sri Sairam college of EngineeringFaculty Profile prashantha K EEE dept Sri Sairam college of Engineering
Faculty Profile prashantha K EEE dept Sri Sairam college of Engineering
 

Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and Pat Heslop-Harrison

  • 1. Plant Molecular Cytogenetics Trude Schwarzacher [email_address] www.molcyt.com Including talk slides! www.molecularcytogenetics.com UserID/PW ‘visitor’ Nimes ECA Course 27 February 2012
  • 2.
  • 3. ‘ Golden Yellow’ triploid 2n=3x=14 C. flavus 2n=2x=8 (8 yellow) C. angustifolius 2n=2x=12 (6 green) Orgaard, Jacobsen & HH ‘ Stellaris’ hybrid diploid 2n=2x=10 C. flavus 2n=2x=8 (4 green) C. angustifolius 2n=2x=12 (6 blue)
  • 4.
  • 5. Plant genome sizes vary over a 2350-fold range
  • 6.  
  • 7.
  • 8. Somatic metaphase chromosomes Arabidopsis Human Pine Centromere Telomere
  • 9.
  • 10.
  • 11.
  • 12.
  • 14. Repetitive DNA-Sequences form the largest part of the genome Arabidopsis thaliana > 25% 145 Mbp Sugar beet Beta vulgaris 63% 758 Mbp Broad bean Vicia faba 85% 12000 Mbp Rye Secale cereale 92% 8800 Mbp Onion Allium cepa 95% 15100 Mbp These species are all diploid – 2x Species Repetitive DNA Genome size Human Homo sapiens 35% 3000 Mbp
  • 16.  
  • 17.  
  • 18. Arabidopis suecica Hybrid A. arenosa (pAa214 green) X A. thaliana (180bp red) Kamm, HH et al.
  • 19. ancestral A B C D High-copy number High-copy number High-copy number High-copy number E F Low-copy number Low-copy number New species-specific variants High copy spp: homogenized old (ABC) or new (D) variants Low copy spp: most old variants in low copy number (EF) See Kuhn, HH et al. 2009. Heredity & 2008. Chr. Res.
  • 20. Organelle sequences from chloroplasts or mitochondria Sequences from viruses, Agrobacterium or other vectors Transgenes introduced with molecular biology methods Genes, regulatory and non-coding single copy sequences Dispersed repeats: Transposable Elements Repetitive DNA sequences Plant Nuclear Genome Tandem repeats DNA transposons copied and moved via DNA Retrotransposons amplifying via an RNA intermediate Centromeric repeats Structural components of chromosomes Telomeric repeats Simple sequence repeats or microsatellites Repeated genes Subtelomeric repeats 45S and 5S rRNA genes Blocks of tandem repeats at discrete chromosomal loci DNA sequence components of the plant nuclear genome Heslop-Harrison & Schmidt 2012. Encyclopedia of Life Sciences Other genes
  • 21. Derivative chromosome 1R of Lines 7-102 and 7-169
  • 22.
  • 23.
  • 24. Retrotransposons Class I transposable elements RNA intermediate DNA transposons Class II transposable elements Cut-and-paste
  • 25. Genome Specificity of a CACTA ( En/Spm ) Transposon B. napus (AACC, 2n=4x=38) – hybridized with C-genome CACTA element red B. oleracea (CC, 2n=2x=18) B. rapa (AA, 2n=2x=20) Alix & HH 2008
  • 26. Triticale: wheat x rye hybrid
  • 27.
  • 28. dpTa1 Aegilops ventricosa DDNN ABDN AABBDDNN Marne AABBDD CWW1176-4 Rendezvous Piko VPM1 Dwarf A 96ST61 Virtue × × × × Hobbit × {Kraka × (Huntsman × Fruhgold)} Triticum persicum Ac.1510 AABB Inheritance of Chromosome 5D
  • 29.
  • 30.
  • 31. Copyright restrictions may apply. Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042 UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subsp
  • 32.  
  • 33.  
  • 34.
  • 35. Wsm-1: only effective source of resistance to WSMV
  • 36. dpTa1 digoxigenin IWG genomic DNA biotin
  • 37.  
  • 38. Wild banana species: Musa acuminata – A genome Musa balbisiana – B genome Basic chromosome number n=x=11 Genome size c. 550 Mbp Most cultivated hybrids are 2n=3x=33
  • 39.
  • 40. IRAP diversity in Musa Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant Biol Nair, Teo, Schwarzacher, HH 2006 Euphytica Desai, Maha … , HH et al. in prep.
  • 41. 07/02/12 TCCCTGAG: 8-bp TSD. 30-bp TIRs 273-bp hAT ACCCACCTGGCTCTTGTGTC ATACCATTGAAAAGCCGATTATATTTGTCCCCATTCATCCAAAAGA TCCCTGAG CAAGGTCTG C CATACCG T A C CGTACCG G CG TTTCGAC CCGG GCTCGGTACGGTA CCGG TGTA CCGG GCAGTACATCAGGGTGTACCGAATGGTACACCCTGATGTACCGAACAATTTTATACTTTTTCATACTGTAGCAGTGCTACAGTATAATACTGTAGCACTGTAGCGGTATCGGGCGGTCCGCGTA CCGG TAACCTGTCGGA CCGG TACATACCGC CCGG TAT CG G CGGTACG C T T CGGTATG A CAGACCTTG TCCCTGAG TATATATCTCTTTTCTAAATTTATGACCACTCCAAGGCAACTTGCCAAAGAAAATGAAAAGAAGAAAAAAATTAGGGGAATGAAGATTCTCCACAATTCCTTATTCTTTGATTTGAGATAAATAATGTCCATAGTAAAACATATCTTATGATCATCATTGCTGATTAATCAAAATACCTGATTCTATAGTCTCAAGCTTT AGTGGTCAAAACACATTCGC TSD TIR TIR TSD hAT1 in Musa acuminata F and R primers indicated by blue arrows in sequence Musa balbisiana Musa acuminata a) b)
  • 42. 07/02/12 hAT1 insertion sites in Musa diversity collection hAT486F and hAT037R Top bands (560-bp) amplified hAT element and lower bands amplifying the flanking sequences only HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 1KB 800 600 400 200
  • 43. Nuclear Copies of Banana Streak Virus in Banana
  • 45.
  • 46. From Chromosome to Nucleus Pat Heslop-Harrison [email_address] www.molcyt.com
  • 47.
  • 48.
  • 49. 50 years of plant breeding progress
  • 50.  
  • 51.
  • 52. Plant Molecular Cytogenetics Trude Schwarzacher [email_address] Website: www.molcyt.com or www.molecularcytogenetics.com UserID/PW ‘visitor’ To download full text of papers Nimes ECA Course 27 February 2012

Editor's Notes

  1. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  2. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  3. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  4. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  5. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  6. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  7. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  8. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  9. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  10. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com 1 1 1 1 1
  11. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  12. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  13. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  14. Patg Heslop-Harrison www.molcyt.com
  15. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  16. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  17. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  18. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  19. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  20. Patg Heslop-Harrison www.molcyt.com 18
  21. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  22. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  23. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  24. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  25. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  26. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  27. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  28. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  29. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  30. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  31. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  32. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  33. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com
  34. Trude Schwarzacher ts32@le.ac.uk www.molcyt.com