Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and Pat Heslop-Harrison

3,254 views

Published on

An overview of plant molecular cytogenetics. The lecture Trude Schwarzacher presented to the ECA conference Strasbourg in July 2015 is http://www.slideshare.net/PatHeslopHarrison/trude-schwarzacher

Published in: Education, Technology
  • Be the first to comment

  • Be the first to like this

Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and Pat Heslop-Harrison

  1. 1. Plant Molecular Cytogenetics Trude Schwarzacher [email_address] www.molcyt.com Including talk slides! www.molecularcytogenetics.com UserID/PW ‘visitor’ Nimes ECA Course 27 February 2012
  2. 2. <ul><li>The most popular garden varieties are sterile, diploid or triploid interspecific hybrids </li></ul>
  3. 3. ‘ Golden Yellow’ triploid 2n=3x=14 C. flavus 2n=2x=8 (8 yellow) C. angustifolius 2n=2x=12 (6 green) Orgaard, Jacobsen & HH ‘ Stellaris’ hybrid diploid 2n=2x=10 C. flavus 2n=2x=8 (4 green) C. angustifolius 2n=2x=12 (6 blue)
  4. 4. Metaphase I in triploid Golden Yellow Crocus <ul><li>In many metaphase I cells of this triploid, we see four bivalents from pairing of the four pairs of C. flavus (2n=2x=8)-origin chromosomes, with the six chromosomes from C. angustifolius (2n=2x=12) present as univalents. Alternative configurations also seen. </li></ul><ul><li>Antibodies below to meiosis components </li></ul>
  5. 5. Plant genome sizes vary over a 2350-fold range
  6. 7. Plant Molecular Cytogenetics <ul><ul><li>Plant chromosomes </li></ul></ul><ul><ul><li>Plant genomes and their sizes </li></ul></ul><ul><ul><li>DNA components of a chromosome </li></ul></ul><ul><ul><li>Retroelements </li></ul></ul><ul><ul><li>Chromosomes and sources of genetic markers </li></ul></ul><ul><ul><li>Chromosome and genome painting </li></ul></ul><ul><ul><li>Polyploids and cereal chromosome evolution </li></ul></ul><ul><ul><li>Plant breeding and aliens </li></ul></ul>Part I: Part II:
  7. 8. Somatic metaphase chromosomes Arabidopsis Human Pine Centromere Telomere
  8. 9. Darwin: The final paragraph of “The Origin” <ul><li>It is interesting to contemplate … many plants of many kinds … and to reflect that these elaborately constructed forms, so different from each other … . have all been produced by laws acting around us … from so simple a beginning endless forms most beautiful and most wonderful have been, and are being evolved. </li></ul>
  9. 10. OBJECTIVES Fundamental and Practical <ul><li>Explain major structures and features of the DNA in plant genomes </li></ul><ul><li>Understand the structure of chromosomes and genomes </li></ul><ul><li>Explain the nature and origin of molecular markers </li></ul><ul><li>Understand key events in evolution and generation of diversity including induced mutations </li></ul>
  10. 11. OBJECTIVES Fundamental and Practical <ul><li>  Understand how genomes and diversity can be manipulated and exploited </li></ul><ul><li>  Relate genome information and models to the applications in the genome of particular species </li></ul><ul><li>Decide which molecular markers are appropriate for various applications </li></ul><ul><li>Introduce the concept of superdomestication into breeding programmes and consider solutions to major problems facing breeders and farmers </li></ul><ul><li>Use the literature relating to genomics, genetics and plant breeding and communicate it in writing </li></ul>
  11. 12. The Genome and Chromosomes <ul><li>The DNA is organized in multiple chromosomes </li></ul><ul><li>Each is a single, linear DNA molecule </li></ul><ul><li>The DNA is packaged around proteins (histones) </li></ul><ul><li>The nuclear chromosome has special sequences at its ends </li></ul><ul><li>There are separate genomes in the plastids and mitochondria </li></ul><ul><li>There can be viral and bacteria-like genomes in the nucleus and cytoplasm </li></ul>
  12. 13. Genes!
  13. 14. Repetitive DNA-Sequences form the largest part of the genome Arabidopsis thaliana > 25% 145 Mbp Sugar beet Beta vulgaris 63% 758 Mbp Broad bean Vicia faba 85% 12000 Mbp Rye Secale cereale 92% 8800 Mbp Onion Allium cepa 95% 15100 Mbp These species are all diploid – 2x Species Repetitive DNA Genome size Human Homo sapiens 35% 3000 Mbp
  14. 15. Arabidopsis thaliana 2n=10
  15. 18. Arabidopis suecica Hybrid A. arenosa (pAa214 green) X A. thaliana (180bp red) Kamm, HH et al.
  16. 19. ancestral A B C D High-copy number High-copy number High-copy number High-copy number E F Low-copy number Low-copy number New species-specific variants High copy spp: homogenized old (ABC) or new (D) variants Low copy spp: most old variants in low copy number (EF) See Kuhn, HH et al. 2009. Heredity & 2008. Chr. Res.
  17. 20. Organelle sequences from chloroplasts or mitochondria Sequences from viruses, Agrobacterium or other vectors Transgenes introduced with molecular biology methods Genes, regulatory and non-coding single copy sequences Dispersed repeats: Transposable Elements Repetitive DNA sequences Plant Nuclear Genome Tandem repeats DNA transposons copied and moved via DNA Retrotransposons amplifying via an RNA intermediate Centromeric repeats Structural components of chromosomes Telomeric repeats Simple sequence repeats or microsatellites Repeated genes Subtelomeric repeats 45S and 5S rRNA genes Blocks of tandem repeats at discrete chromosomal loci DNA sequence components of the plant nuclear genome Heslop-Harrison & Schmidt 2012. Encyclopedia of Life Sciences Other genes
  18. 21. Derivative chromosome 1R of Lines 7-102 and 7-169
  19. 22. Oil Palm <ul><li>32 chromosomes DAPI; </li></ul><ul><li>TTTAGGG telomere; </li></ul><ul><li>45S rDNA (1 major pair + minor) </li></ul><ul><li>5S rDNA (1 major + minor) </li></ul>02/07/12
  20. 23. Repetitive Sequences <ul><li>The majority of the genomic DNA in most species (95% sometimes) </li></ul><ul><li>Tandem Repeats </li></ul><ul><li>Simple Sequence Repeats </li></ul><ul><li>Dispersed Repeats </li></ul><ul><li>Functional Repeats </li></ul><ul><li>Retroelements </li></ul>
  21. 24. Retrotransposons Class I transposable elements RNA intermediate DNA transposons Class II transposable elements Cut-and-paste
  22. 25. Genome Specificity of a CACTA ( En/Spm ) Transposon B. napus (AACC, 2n=4x=38) – hybridized with C-genome CACTA element red B. oleracea (CC, 2n=2x=18) B. rapa (AA, 2n=2x=20) Alix & HH 2008
  23. 26. Triticale: wheat x rye hybrid
  24. 27. <ul><li>Total genomic DNA can be used as a probe to distinguish </li></ul><ul><li>Genomes in sexual hybrids </li></ul><ul><li>Alien chromosome introgression </li></ul>
  25. 28. dpTa1 Aegilops ventricosa DDNN ABDN AABBDDNN Marne AABBDD CWW1176-4 Rendezvous Piko VPM1 Dwarf A 96ST61 Virtue × × × × Hobbit × {Kraka × (Huntsman × Fruhgold)} Triticum persicum Ac.1510 AABB Inheritance of Chromosome 5D
  26. 29. rRNA gene expression in Triticale <ul><li>Four expression sites Six gene sites </li></ul>
  27. 30. Modification of DNA Methylation <ul><li>Methylation widely implicated in gene expression control </li></ul><ul><li>Treat with 5-azacytidine </li></ul><ul><ul><li>N at carbon-5 position not C so –CH 3 cannot be added </li></ul></ul><ul><li>Effect of treatment on Triticale </li></ul><ul><li>Ag-NOR method </li></ul><ul><ul><li>see www.methods.molcyt.com methods page </li></ul></ul>
  28. 31. Copyright restrictions may apply. Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042 UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subsp
  29. 34. <ul><li>Adpg2-1 </li></ul>Glu-1 Xpsr161 Xpsr957 Xpsr381 5SrRNA Nor-1 (d) Em Gli-1 Tri-1 Physical map vs Genetic map Genes are often clustered Genes (and recombination) are often distal
  30. 35. Wsm-1: only effective source of resistance to WSMV
  31. 36. dpTa1 digoxigenin IWG genomic DNA biotin
  32. 38. Wild banana species: Musa acuminata – A genome Musa balbisiana – B genome Basic chromosome number n=x=11 Genome size c. 550 Mbp Most cultivated hybrids are 2n=3x=33
  33. 39. <ul><li>Retroelement Markers </li></ul>Insertion IRAP – InterRetroelement PCR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR LTR
  34. 40. IRAP diversity in Musa Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant Biol Nair, Teo, Schwarzacher, HH 2006 Euphytica Desai, Maha … , HH et al. in prep.
  35. 41. 07/02/12 TCCCTGAG: 8-bp TSD. 30-bp TIRs 273-bp hAT ACCCACCTGGCTCTTGTGTC ATACCATTGAAAAGCCGATTATATTTGTCCCCATTCATCCAAAAGA TCCCTGAG CAAGGTCTG C CATACCG T A C CGTACCG G CG TTTCGAC CCGG GCTCGGTACGGTA CCGG TGTA CCGG GCAGTACATCAGGGTGTACCGAATGGTACACCCTGATGTACCGAACAATTTTATACTTTTTCATACTGTAGCAGTGCTACAGTATAATACTGTAGCACTGTAGCGGTATCGGGCGGTCCGCGTA CCGG TAACCTGTCGGA CCGG TACATACCGC CCGG TAT CG G CGGTACG C T T CGGTATG A CAGACCTTG TCCCTGAG TATATATCTCTTTTCTAAATTTATGACCACTCCAAGGCAACTTGCCAAAGAAAATGAAAAGAAGAAAAAAATTAGGGGAATGAAGATTCTCCACAATTCCTTATTCTTTGATTTGAGATAAATAATGTCCATAGTAAAACATATCTTATGATCATCATTGCTGATTAATCAAAATACCTGATTCTATAGTCTCAAGCTTT AGTGGTCAAAACACATTCGC TSD TIR TIR TSD hAT1 in Musa acuminata F and R primers indicated by blue arrows in sequence Musa balbisiana Musa acuminata a) b)
  36. 42. 07/02/12 hAT1 insertion sites in Musa diversity collection hAT486F and hAT037R Top bands (560-bp) amplified hAT element and lower bands amplifying the flanking sequences only HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 1KB 800 600 400 200
  37. 43. Nuclear Copies of Banana Streak Virus in Banana
  38. 44. DNA Fibre Hybridization
  39. 45. Evolution  Epigenetics  Development <ul><li>Phenotype </li></ul><ul><li>Multiple abnormalities </li></ul><ul><li>Genetic changes   </li></ul><ul><li>non-reverting </li></ul><ul><li>Changes seen, some reverting </li></ul><ul><li>(Male/Female) </li></ul><ul><li>Normal Differentiation </li></ul><ul><li>Cause </li></ul><ul><li>Chromosomal loss, deletion or translocation </li></ul><ul><li>Gene mutation / base pair changes </li></ul><ul><li>Telomere shortening </li></ul><ul><li>Retro)transposon insertion </li></ul><ul><li>Retrotransposon activation </li></ul><ul><li>SSR expansion </li></ul><ul><li>Methylation </li></ul><ul><li>Heterochromatinization </li></ul><ul><li>Chromatin remodelling </li></ul><ul><li>Histone modification </li></ul>
  40. 46. From Chromosome to Nucleus Pat Heslop-Harrison [email_address] www.molcyt.com
  41. 47. United Nations Millennium Development Goals- MDGs <ul><li>Goal 1 – Eradicate extreme poverty and hunger </li></ul><ul><li>Goal 2 – Achieve universal primary education </li></ul><ul><li>Goal 3 – Promote gender equity and empower women </li></ul><ul><li>Goal 4 – Reduce child mortality </li></ul><ul><li>Goal 5 – Improve maternal health </li></ul><ul><li>Goal 6- Combat HIV/AIDS, malaria and other diseases </li></ul><ul><li>Goal 7 - Ensure environmental sustainability </li></ul><ul><li>Goal 8 - Develop a global partnership for development </li></ul>
  42. 48. Conventional Breeding Superdomestication <ul><li>Cross the best with the best and hope for something better </li></ul><ul><li>Decide what is wanted and then plan how to get it </li></ul><ul><li>- variety crosses </li></ul><ul><li>- mutations </li></ul><ul><li>- genepool </li></ul><ul><li>- genes </li></ul>
  43. 49. 50 years of plant breeding progress
  44. 51. CytoGenomics … <ul><li>The genepool has the diversity to address these challenges … </li></ul><ul><li>New methods to exploit and characterize germplasm let use make better and sustainable use of the genepool </li></ul>
  45. 52. Plant Molecular Cytogenetics Trude Schwarzacher [email_address] Website: www.molcyt.com or www.molecularcytogenetics.com UserID/PW ‘visitor’ To download full text of papers Nimes ECA Course 27 February 2012

×